Table 1

TaqMan primers and probes used in this study

Gene

Accession

1) 5' - (FAM)-probe-(TAMRA) - 3'

(human)

number

2) 5' - primer 1 - 3'

3) 5' - primer 2 - 3'


Caspase-1

M87507

1) AA GACGTGTGCGGCTTGACTTGTCC

2) AATACTGTCAAATTCTTCATTGCAGATAAT

3) AAGTCGGCAGAGATTTATCCAATAA

CCR1

L10918

1) TGGCCATCGTCCACGCCG

2) TCCTGCTGACGATTGACAGGTA

3) GTGCCCGCAAGGCAAAC

CCR2

U03882

1) AGTGCTTCGCAGATGTCCTTGATGCTC

2) GCGTTTAATCACATTCGAGTGTTT

3) CCACTGGCAAATTAGGGAACAA

CCR4

X85740

1) TTACTCTGCTGACACCCCCAGCTCATC

2) CAATACTGTGGGCTCCTCCAA

3) ATCCATGGTGGACTGCGTGTA

CCR5

U54994

1) TGCAAAAGGCTGAAGAGCATGACTGACAT

2) GCTGGTCATCCTCATCCTGATAA

3) ATGGCCAGGTTGAGCAGGTA

Clusterin

X14728

1) TGCCAGCCGGGACACCCAG

2) CTTCGCCTTGCGTGAGGT

3) GAGCAGCTGAACGAGCAGTTT

FGFR

X51803

1) CCGTAGCTCCATATTGGACATCCCCAG

2) AGATAACACCAAACCAAACCGTATG

3) GCATGCAATTTCTTTTCCATCTT

GM-CSF

M11222

1) CCCCTTTGACTGCTGGGAGCCAG

2) CCTGAAGGACTTTCTGCTTGTCA

3) CTCATCTGGCCGGTCTCACT

IκB

M69043

1) TTCTAGTGTCAGCTGGCCCAGCTGC

2) TCTCTGGCAGCATCTGAAGGT

3) CCCAAGCACCCGGATACAG

IL-4R

X52425

1) AATGCCACTGCCCAGGCTGTCC

2) GTGGCAGGTAAGGGCTGAGTAGA

3) CACCTCGCAGTCCGCAGA

RANTES

M21121

1) TTGGCACACACTTGGCGGTTCTTC

2) TCCCGAACCCATTTCTTCTCT

3) CCCAGCAGTCGTCTTTGTCA

STAT4

L78440

1) AGTCTCGCAGGATGTCAGCGAATGG

2) GCTGAGAGCTGTAGTGTTTACCGA

3) AATAAAGGCCGGTTGTCTGCT

TIMP-1

X03124

1) CAATTCCGACCTCGTCATCAGGGC

2) CACCCACAGACGGCCTTCT

3) TCTGGTGTCCCCACGAACTT

TNF-α

M10988

1) CATCTTCTCGAACCCCGAGTGACAAGC

2) TGGCCCAGGCAGTCAGA

3) GGTTTGCTACAACATGGGCTACA


Abbreviations: FAM, 6-carboxyfluorescein; TAMRA, 6-carboxytetramethyl-rhodamine.

Hamalainen et al. Genome Biology 2001 2:research0022.1-research0022.11   doi:10.1186/gb-2001-2-7-research0022

Open Data