Table 2

Primer sequences for internal control genes

Symbol*

Forward primer

Reverse primer


ACTB

CTGGAACGGTGAAGGTGACA

AAGGGACTTCCTGTAACAATGCA

B2M

TGCTGTCTCCATGTTTGATGTATCT

TCTCTGCTCCCCACCTCTAAGT

GAPD

TGCACCACCAACTGCTTAGC

GGCATGGACTGTGGTCATGAG

HMBS

GGCAATGCGGCTGCAA

GGGTACCCACGCGAATCAC

HPRT1

TGACACTGGCAAAACAATGCA

GGTCCTTTTCACCAGCAAGCT

RPL13A

CCTGGAGGAGAAGAGGAAAGAGA

TTGAGGACCTCTGTGTATTTGTCAA

SDHA

TGGGAACAAGAGGGCATCTG

CCACCACTGCATCAAATTCATG

UBC

ATTTGGGTCGCGGTTCTTG

TGCCTTGACATTCTCGATGGT

YWHAZ

ACTTTTGGTACATTGTGGCTTCAA

CCGCCAGGACAAACCAGTAT


*TBP primer sequences are described in [24]. HMBS primer sequences kindly provided by E. Mensink and L. van de Locht (Nijmegen, The Netherlands).

Vandesompele et al. Genome Biology 2002 3:research0034.1-research0034.11   doi:10.1186/gb-2002-3-7-research0034

Open Data