Table 2

Oligonucleotides used for the amplification of the GFP-constructs

Construct

Forward primer

Reverse primer


EGFP-tyrosinase

GAATTCAATGCTCCTGGCTGTTTTGTACTG

GGATCCTTATAAATGGCTCTGATACAAGCTG

EGFP-lysozyme

GAATTCCATGAGGTCTTTGCTAATCTTGGT

GGATCCGGCAGCTCCTCACAGCCG

GFP-MRP7

CGGGATCCAATGTGGAATCCTATTTTACTAGATAC

GGGCATGCTCAAAGCTTGCTCAAAAAAGCCCG

GFP-GSA

CGGGATCCAATGAGGAAGTCTGAAAATCTTTACCAG

GGGCATGCTCACAACTTCGCAAACACCCGACG

DsRed2-SKL (COS7 cells)

CGGCTAGCGCTACCGGTCGCCACCATGGCC

CGTCTCGAGTTATAATTTGGACAGGTGGTGGCGGCC

DsRed-SKL (yeast cells)

AGATCTATGGTGAGGTCTTCCAAG

CTGCAGTTATAATTTGGATAGGATCCCAAGGAACAGATGGTGGCG


Neuberger et al. Genome Biology 2004 5:R97   doi:10.1186/gb-2004-5-12-r97

Open Data