Table 1

miRNAs verified by northern blot hybridizations and their supporting evidence

miRNA name

Sequence

NB

MPSS

ASRP


miR171b

CGAUUGAGCCGUGCCAAUAUC

+

+

NA

miR413

AUAGUUUCUCUUGUUCUGCAC

+

+

NA

miR414

UUCAUCUUCAUCAUCAUCGUC

+

+

NA

miR415

AACAGAGCAGAAACAGAACAU

+

+

NA

miR416

UGAACAGUGUACGUACGAACC

+

NA

NA

miR417

UGAAGGUAGUGAAUUUGUUCG

+

NA

NA

miR393a

UCCAAAGGGAUCGCAUUGAUC

+

NA

NA

miR418

UAAUGUGAUGAUGAACUGACC

+

+

NA

miR419

UUAUGAAUGCUGAGGAUGUUG

+

+

NA

miR169b

CAGCCAAGGAUGACUUGCCGG

+

NA

+

miR396b

UUUCCACAGCUUUCUUGAACU

+

NA

NA

miR420

UAAACUAAUCACGGAAAUGCA

+

+

NA

miR169g*

UCCGGCAAGUUGACCUUGGCU

+

NA

NA

miR172b*

GCAGCACCAUUAAGAUUCAC

+

+

+


NB, northern blot hybridization; MPSS, massively parallel signature sequence; ASRP, sequence present in the Arabidopsis Small RNA Project database; NA, data not available.

Wang et al. Genome Biology 2004 5:R65   doi:10.1186/gb-2004-5-9-r65

Open Data