Method
Synthetic lethal analysis of Caenorhabditis elegans posterior embryonic patterning genes identifies conserved genetic interactions
-
* Corresponding author: Craig P Hunter hunter@mcb.harvard.edu
1 Department of Molecular and Cellular Biology, Harvard University, Cambridge, MA 02138, USA
2 Department of Genomics, Wyeth Research, Cambridge, MA 02140, USA
3 Current address: Biology Division, California Institute of Technology, Pasadena, CA 91125
4 Current address: Department of Computer Science, Tufts University, Medford, MA 02155
Genome Biology 2005, 6:R45 doi:10.1186/gb-2005-6-5-r45
Published: 11 April 2005Additional files
Additional File 1:
Replicate embryonic lethality measurements and corresponding P-values for synthetic lethality. Replicate embryonic lethality measurements and corresponding P-values for synthetic lethality.
Format: DOC Size: 51KB Download file
This file can be viewed with: Microsoft Word Viewer
Additional File 2:
Double RNAi by soaking worms in dsRNA for two genes at once is an inefficient means of synthetic genetic analysis. Percent embryonic lethality measured by both double RNAi and RNAi in mutant backgrounds is presented for comparison. Each column corresponds to RNAi of a given gene, and each row corresponds to either RNAi or a mutant allele of a given gene. Each value corresponds to a specific combination of perturbations, either RNAi of two genes or RNAi and mutation, with the controls as exceptions. A genetic interaction is detected for the highly homologous genes tbx-8 and tbx-9 with both methods, but none of the strong interactions between the three relatively non-homologous myogenic regulators (hlh-1, unc-120, and hnd-1) are detected by double RNAi. Each value presented is the average of two independent experiments; at least 100 progeny were counted for each experiment. dsRNA concentration was 5 mg/ml for all experiments. NA stands for not applicable.
Format: DOC Size: 31KB Download file
This file can be viewed with: Microsoft Word Viewer
Additional File 3:
A table listing primer sequences used in this study to amplify coding sequences from cDNA for use as templates for dsRNA. A minimal T7 promoter sequence (TAATACGACTCACTATAGGG) was added to the 5' end of each of the gene-specific sequences listed in the table so that PCR products could be used as in vitro transcription templates to make dsRNA.
Format: DOC Size: 27KB Download file
This file can be viewed with: Microsoft Word Viewer