Genome Biology

official impact factor 6.89

Open Access Highly Access Research

Identification of ciliary and ciliopathy genes in Caenorhabditis elegans through comparative genomics

Nansheng Chen1,2*, Allan Mah2, Oliver E Blacque2,3, Jeffrey Chu2, Kiran Phgora2, Mathieu W Bakhoum2, C Rebecca Hunt Newbury4, Jaswinder Khattra4, Susanna Chan4, Anne Go4, Evgeni Efimenko5, Robert Johnsen2, Prasad Phirke5, Peter Swoboda5, Marco Marra6, Donald G Moerman4, Michel R Leroux2, David L Baillie2 and Lincoln D Stein1

Author Affiliations

1 Cold Spring Harbor Laboratory, Cold Spring Harbor, New York 11724, USA

2 Department of Molecular Biology and Biochemistry, Simon Fraser University, University Drive, Burnaby, British Columbia, Canada V5A 1S6

3 School of Biomolecular and Biomedical Sciences, Conway Institute, University College Dublin, Belfield, Dublin 4, Ireland

4 Department of Zoology, University of British Columbia, West Mall, Vancouver, British Columbia, Canada V6T 1Z4

5 Karolinska Institute, Department of Biosciences and Nutrition, Södertörn University College, School of Life Sciences, S-14189 Huddinge, Sweden

6 British Columbia Cancer Agency, Genome Sciences Centre, Vancouver, British Columbia, Canada V5Z 4S6

For all author emails, please log on.

Genome Biology 2006, 7:R126 doi:10.1186/gb-2006-7-12-r126


The electronic version of this article is the complete one and can be found online at: http://genomebiology.com/2006/7/12/R126


Received:8 August 2006
Revisions received:20 October 2006
Accepted:22 December 2006
Published:22 December 2006

© 2006 Chen et al.; licensee BioMed Central Ltd.

This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Background

The recent availability of genome sequences of multiple related Caenorhabditis species has made it possible to identify, using comparative genomics, similarly transcribed genes in Caenorhabditis elegans and its sister species. Taking this approach, we have identified numerous novel ciliary genes in C. elegans, some of which may be orthologs of unidentified human ciliopathy genes.

Results

By screening for genes possessing canonical X-box sequences in promoters of three Caenorhabditis species, namely C. elegans, C. briggsae and C. remanei, we identified 93 genes (including known X-box regulated genes) that encode putative components of ciliated neurons in C. elegans and are subject to the same regulatory control. For many of these genes, restricted anatomical expression in ciliated cells was confirmed, and control of transcription by the ciliogenic DAF-19 RFX transcription factor was demonstrated by comparative transcriptional profiling of different tissue types and of daf-19(+) and daf-19(-) animals. Finally, we demonstrate that the dye-filling defect of dyf-5(mn400) animals, which is indicative of compromised exposure of cilia to the environment, is caused by a nonsense mutation in the serine/threonine protein kinase gene M04C9.5.

Conclusion

Our comparative genomics-based predictions may be useful for identifying genes involved in human ciliopathies, including Bardet-Biedl Syndrome (BBS), since the C. elegans orthologs of known human BBS genes contain X-box motifs and are required for normal dye filling in C. elegans ciliated neurons.

Background

The cilium is an evolutionarily conserved subcellular organelle that projects from the surface of many eukaryotic cells in vertebrates, including kidney and endothelial cells, myocardial cells, odontoblasts, retinal photoreceptor cells and cortical and hypothalamic neurons [1]. The biogenesis and maintenance of cilia is dependent on intraflagellar transport (IFT), which is a bidirectional motility process driven by anterograde and retrograde motors that operate along the microtubule-based ciliary axoneme [2]. Consistent with the ubiquitous distribution of cilia, many physiological processes are critically dependent on their function, which can be broadly classified into two categories, namely cell (and fluid) motility and sensory perception [3]. Defects in the molecular components of cilia and IFT are associated with a variety of human disorders, including cystic kidney disease, primary cilia dyskinesia, retinitis pigmentosa, and Bardet-Biedl syndrome (BBS) [1,3-5].

Because of the importance of cilia function in diverse physiological processes and pathological conditions, significant efforts have recently been made to identify the molecular components of these organelles (reviewed by Inglis et al. [5]). A key finding, which has provided the groundwork for uncovering new ciliary genes, was the discovery in 2000 by Swoboda et al. [6] that C. elegans transcription factor DAF-19 regulates the expression of key ciliogenic genes (for example, che-2, osm-1, and osm-6), and is, therefore, required for building and maintaining nematode ciliary structures. DAF-19 is orthologous to human RFX transcription factors, which bind to cis-regulatory elements called X-box motifs [7]. The identification of DAF-19 and its cognate binding motifs has greatly facilitated the identification of many novel ciliary genes both in C. elegans (for example, bbs-3/arl-6 [8], bbs-5 [9] and bbs-8 [10]), and in the fruit fly Drosophila melanogaster [11]. Interestingly, all but 3 of the 11 known human BBS genes (BBS6 [12], BBS10 [13,14] and BBS11 [15]) have clear one-to-one C. elegans orthologs. All studied C. elegans bbs genes have readily identifiable X-box motifs in their promoters and all are exclusively expressed in ciliated neurons [8-10]. In addition, loss-of-function C. elegans bbs alleles possess ciliary structure abnormalities, including an inability to take up fluorescent dyes [16-20]. Similar to bbs gene mutants, dye-filling defect (Dyf) phenotypes are found in other ciliary and IFT mutants, including dyf-1 through dyf-13, as well as many Osm (osmotic avoidance abnormal) and Che (abnormal chemotaxis) mutants [3]. Taken together, the above findings underscore the importance of the daf-19/X-box system in regulating C. elegans cilia formation and demonstrate that C. elegans is a very useful model for identifying new human BBS genes.

The discovery of the DAF-19/X-box regulatory system also provided the rationale for using bioinformatics and genomics approaches to screen for additional C. elegans genes required for cilia function using bioinformatics and genomics approaches [5]. In one such project, Efimenko et al. [16] screened C. elegans promoters for X-box motifs that match an 'average' X-box consensus, producing a set of 758 putative X-box-regulated genes with one or more X-boxes within 1,000 base-pairs (bp) upstream of the start codon. Similarly, Blacque et al. [17] scanned the C. elegans genome for candidate X-boxes that match a hidden Markov model (HMM) [21] profile assembled from known X-box motif sequences, revealing a set of 1,572 genes with putative X-boxes within 1,500 bp upstream of the start codon. Applying a more stringent criterion of X-boxes within 250 bp upstream of the start codon, 293 genes were uncovered. Blacque et al. also performed serial analysis of gene expression (SAGE) on ciliated and non-ciliated cell types in C. elegans and searched for genes with a 1.5-fold or greater level of expression in the ciliated subset of neuronal cells versus predominantly non-ciliated cell subsets (that is, pan-neuronal, intestinal and muscle cell subsets). Combining the X-box and SAGE data, Blacque et al. [17] were able to further refine their list of candidate ciliary genes from 293 genes to a final total of 46 genes. Although the above studies [16,17] produced large gene sets that contain many known and putative X-box regulated genes, including protein kinases, receptors, and transcription factors [5,16,17], both approaches are limited by high false positive rates. In addition, both may have high false negative rates, especially with more stringent candidate gene sets such as the X-box-containing genes where X-boxes are considered only within 250 bp upstream of the start codon. Since candidate X-box motifs fall outside of the 250 bp (from the start codon) range, many genes may potentially be omitted. For example, a candidate X-box motif in the promoter of arl-6 (bbs-3) is >1,000 bp upstream of the start codon and was missed by both projects but uncovered when the search space was extended to 1,500 [8] (Table 1).

Table 1. Expression patterns of known and putative X-box containing C. elegans genes revealed by promoter::GFP transgenic analyses

Other approaches used to identify new ciliary genes include microarray expression profiling of isolated chemosensory neurons [22] and labeled ciliated neurons [23]. These C. elegans-based approaches uncovered ciliated-neuron specific genes, including X-box regulated genes and non-X-box regulated genes. Although such gene profiling approaches have been successful in identifying candidate ciliary genes, in particular those that are not directly regulated by X-box motifs, they are less effective in identifying X-box regulated genes since not all ciliary genes are X-box regulated. Nevertheless, results from these functional genomics studies can be combined with data from comparative genomics analyses for prediction and data validation (see also [9,11]).

Although many ciliary genes have been identified, it is certain that many more remain undiscovered, including new BBS and IFT components. Indeed, underscoring this notion is the fact that all of the studied BBS proteins [8,18], as well as several novel ciliary genes that encode IFT proteins with roles in building C. elegans cilia, including dyf-1 [19], dyf-2 [24], dyf-3 [25], dyf-6 [26], dyf-13 [17] and ifta-1 [27], have only very recently been identified and characterized. It is also interesting to note that not all BBS patient cohorts are accounted for by mutations in known BBS genes [28,29], indicating that additional BBS genes likely remain to be identified in C. elegans. For these reasons, the aim of this project is to identify additional ciliary genes, including potential BBS gene candidates. To do this, we have taken a comparative genomics approach, based on the rationale that ciliary genes from related nematode species are similarly dependent on X-box motifs for their transcriptional regulation. The sequence availability of several C. elegans sister species has now made such a comparative approach possible. Specifically, the C. briggsae genome has been sequenced and annotated [30], as has the C. remanei genome. With comparative genomics, the distance-to-start codon requirement can be relaxed (to 2,000 bp upstream of the start codon) so that more genuine X-boxes can be retained. Additionally, comparative genomics avoids the data noise and biased sampling associated with functional genomics (including microarray expression profiling and SAGE). Using this strategy, we have identified 93 known and putative ciliary genes, including some that are known to be, or likely to be associated with cilia biogenesis and human ciliary disorders. In addition, our comparative genomics approach was used to clone a novel X-box-containing gene, dyf-5, which when mutated results in abnormal dye filling of ciliated neurons.

Results

Identification of ciliary genes using comparative genomics

To identify X-box motif-regulated C. elegans genes, we performed a genome-wide screen for the X-box motif using the HMMER program [21] and a HMM profile generated from a set (15 motifs from 13 genes; Additional data file 1) of experimentally validated instances of X-box motifs in C. elegans. Using this approach, we uncovered 4,291 individual X-box motifs (Figure 1), which is comparable to the number of X-boxes obtained by Efimenko et al. [16] and Blacque et al. [17]. Since our dataset of 4,291 candidate genes undoubtedly contains many false positives, we sought to filter for genuine X-box motifs in the C. elegans genome. To do this we exploited the fully annotated whole genome sequences of C. briggsae [30] and the partially finished genome of C. remanei, reasoning that bona fide X-box motifs are highly conserved among these three closely related species. By assuming and requiring that candidate X-box motifs exist within the promoter regions of orthologous genes in all three species, we obtained 93 candidate-X-box motif-containing genes (Figure 1; Additional data file 2). Note that we screened for X-boxes up to 2,000 bp upstream of start codons, since some genuine X-box motifs may reside outside of the preferred region (-50 to -200 bp upstream of the ATG codon) [6,16,17]. All but two of the X-box containing genes used to generate the X-box HMM profile are in the 93 candidate gene set, suggesting a low false negative rate of approximately 15% (2/13).

thumbnailFigure 1. Procedure and searching results. (a) Procedure for identifying genes that are expressed in ciliated neurons in C. elegans. Known X-boxes used in this procedure are listed in 1. The program hmmb was used to build an HMM profile, which was then used to search the promoter sequences using the program hmmfs. (b) The Generic Genome Browser and Bio::DB::GFF database [49] were used for finding candidate X-boxes and X-box regulated genes.

Anatomical expression analysis

To assess the validity of our procedure in identifying bona fide X-box containing genes, which we would expect to be expressed only in C. elegans ciliated neurons, we examined available C. elegans anatomical gene expression pattern data in WormBase [31,32], the published literature, and the British Columbia promoter::GFP transgenic strains database [33] (Table 1). Among the 93 candidate X-box-containing genes that we have identified (Additional data file 2), 25 had pre-engineered promoter::GFP transgenic strains and recorded expression profiles. Of these 25 genes, 24 were found to be expressed in the ciliated amphid (head) and/or phasmid (tail) neurons (Table 1), as expected for genes required for cilia function or ciliated cell differentiation; 4 of the 24 genes showed additional weak signals in the gut and other tissues (for example, pharyngeal signals for C04C3.3) (Table 1). One gene was not expressed in ciliated neurons but instead showed expression in the pharynx (Y37D8A.17). Hence, we estimate the false positive prediction rate to be also very low, at approximately 4% (1/25). As described in Table 1, 7 of the 25 genes are as yet uncharacterized. Except for C04C3.3, these genes are exclusively expressed in ciliated neurons (five genes are shown in Figure 2), suggesting that they likely have a role in cilia function. Among the remaining genes without known anatomical expression patterns (Additional data file 2), approximately one-quarter have been characterized and assigned with CGC (Caenorhabditis Genetics Center) gene names (Table 1). The anatomical expression patterns of all remaining candidate X-box containing genes from Additional data file 2 will be ascertained in a separate study.

thumbnailFigure 2. The X-box-containing genes Y69A2AR.2a, C02H7.1, F41E7.9, F32A6.2 and M04C9.5 are expressed exclusively within ciliated cells. Shown are green fluorescent protein (GFP) fluorescence images of the head (for example, amphid cell region) and tail (for example, phasmid cell region) regions of worms expressing transcriptional GFP reporters to the indicated genes. In all cases, expression is observed only within ciliated neuronal cells such as the amphid head cells and the phasmid tail cells.

SAGE data analysis

It is anticipated that the transcriptional expression pattern of X-box regulated genes will be strongly correlated with that of daf-19, which encodes the transcription factor that binds to the X-box motif [6]. To address this hypothesis, we employed a series of SAGE datasets that were previously generated by the C. elegans Gene Expression Consortium [33] for various tissue types, including the ciliated cell subset of neuronal cells [17]. For each type of tissue analyzed by SAGE, we determined the number of expressed tags corresponding to daf-19 and to each of the 93 candidate X-box genes (Additional data file 2). We then calculated Pearson correlation coefficient (PCC) values between the daf-19 and X-box gene tag counts using a procedure described previously [34]. Among the 93 candidate genes, 50 possessed usable SAGE tags that could be unambiguously mapped to a single gene model and had at least five tags in one or more tissue libraries (Table 1, Additional data file 2) [35]. As illustrated in Figure 3, the density curve for the pooled PCC values for all 50 X-box-regulated candidate genes shows a prominent peak at a PCC of about 0.8, suggesting that a large portion of our candidate X-box regulated genes (Additional data file 2) are positively correlated with daf-19. In contrast, the 4,291 raw X-box-containing genes identified before applying the species conservation criteria show only a weak positively correlated peak, with a much stronger peak centered around the uncorrelated PCC value of 0.0. The curve representing the PCC values for daf-19 and 1,000 randomly chosen C. elegans genes shows that, for most genes, their expression is not correlated to daf-19. In summary, 32% of the filtered gene set (Additional data file 2), including well studied X-box-containing genes such as bbs-1 (0.56), bbs-2 (0.89), bbs-9 (0.75), che-2 (0.82), and osm-5 (0.58), had a PCC greater than 0.5. In contrast, only 13% of random genes and 16% of raw X-box containing genes had a PCC greater than 0.5.

thumbnailFigure 3. The candidate gene dataset (2) is enriched with genes whose SAGE tag expression profile positively correlates with that of daf-19. 'Random genes' (black line) represents the correlation profile in gene expression between daf-19 and a random set of 1,000 genes in C. elegans; 'before filtration' (blue line) represents the correlation profile between DAF-19 and a raw list of genes that contain all putative X-box motifs in their promoters; and 'after comparative filtration' (green line) represents the correlation profile between DAF-19 and the set of filtered genes that contain X-box motifs in orthologous genes in three Caenorhabditis species.

Microarray analysis for DAF-19 regulated genes

To further ascertain whether the X-box-containing genes identified in Additional data file 2 are regulated by the DAF-19 ciliogenic transcription factor, we carried out microarray analysis using Affymetrix chips that encompass >95% of all C. elegans genes and compared the expression profiles of daf-19(+) and daf-19(-) animals. The entire dataset, obtained from two separate microarray experiments, lists the expression data for 15,879 genes (Additional data file 3), and is ordered by genes with the highest level of down regulation in daf-19(-) animals compared to the daf-19(+) control animals. Among these genes, 466 genes show a down regulation of 2.0-fold or higher. To estimate the sensitivity of this approach, we examined the enrichment of genes used for generating the X-box HMM profile (shown in Additional data file 1) and found that 9/13 (69%) are highly enriched in the daf-19(+) animals (that is, down regulated in the absence of DAF-19), which indicates 69% sensitivity. Similarly, to estimate the specificity of this approach, we examined the top 50 genes in the entire dataset (shown in Additional data file 3) and found that 29 (58%) genes are well characterized X-box regulated genes (for example, osm-6, xbx-1, dyf-1, dyf-2, che-2, che-3 and bbs-5), contain conserved X-box motifs in all three species (for example, ZK418.3 and T28F3.6) or are exclusively expressed in ciliated neurons (for example, C33A12.4 [23], K07G5.3 [17] and F53A9.4 [23]). These data suggest that the microarray approach shows a better level of specificity and sensitivity than the SAGE approach, which was found to have a 67% false-positive rate [17]. Among the 83 X-box-containing genes in Additional data file 2 that have human homologs, 61 genes have usable microarray results; 25 of these are enriched more than 2-fold in the daf-19(+) strains (Additional data file 2), suggesting that these X-box-containing C. elegans genes contain significantly (p = 7.6 × e-9, Fisher's exact test) overrepresented genes that are dependent on DAF-19 for expression compared to the genome-wide data. Approximately half of all X-box containing genes that show both strong correlation in gene expression with daf-19 (PCC = 0.4) and whose expression requires daf-19 (ratio = 2.0) are well known cilium-specific genes, including bbs-2, bbs-5, bbs-8, che-2 and osm-5 (Table 2). The other genes in Table 2 represent strong candidates for ciliary genes.

Table 2. C. elegans genes that contain X-box motifs in their promoters, are positively correlated with daf-19 in gene expression, and have reduced expression in daf-19(-) strains

Identification of the dyf-5 gene

Since all studied C. elegans orthologs of known human BBS genes and other ciliogenic genes (for example, IFT genes) possess a dye-filling defect when disrupted, we were interested in determining whether any of the 93 genes in the candidate X-box gene dataset (Additional data file 2) correspond to previously described C. elegans dyf alleles that have not been cloned. To do this, we obtained the predicted genetic map locations for each of the candidate X-box genes and investigated whether they overlapped with the genetic intervals of uncloned dyf alleles [36] in the C. elegans genome. This analysis revealed three strong matches: dyf-2/ZK520.3, dyf-5/M04C9.5 and dyf-10/C48B6.8. One of these genes, dyf-2, was independently identified during the course of this project and was found to encode an IFT protein in another study [24]. The uncloned gene dyf-10(e1383), maps to chromosome I:1.56 +/- 0.043 cM [36]. Since the C48B6.8 (gk471) deletion mutant we obtained from the C. elegans knockout consortium is dye-filling defective (data not shown) and maps within the genetic interval of dyf-10(e1383), we tested the hypothesis that the two genes were the same. We sequenced the coding regions and intron-exon boundaries of C48B6.8 from the dyf-10 strain but found no mutations. Given the possibility of lesions in non-coding region(s) such as the promoter, we performed complementation analyses. C48B6.8 (gk471) mutant males were crossed to dyf-10(e1383) hermaphrodites, and the resulting progeny took up dye. Thus, the two mutations are likely to be in different genes, and dyf-10 remains uncloned. However, the finding that the C48B6.8 mutant exhibits a Dyf phenotype is consistent with the fact that it is the homolog of the recently identified BBS9 gene [28], as all bbs mutants tested to date have ciliary abnormalities and are Dyf [18,20].

In contrast to our efforts to clone dyf-10, we were successful in identifying the dyf-5(mn400) mutation, which was mapped by Wicks et al. [37]. Specifically, we found that dyf-5(mn400) animals carry a G→A point mutation in the second coding exon of M04C9.5, which creates a premature stop codon (TAG) in the predicted serine/threonine kinase domain of this gene (Figure 4). Importantly, the Dyf phenotype of dyf-5(mn400) mutants was rescued by transgenic expression of the wild-type M04C9.5 gene (data not shown). Furthermore, the dyf-5(mn400) and M04C9.5 (ok1170) genes failed to complement each other based on a Dyf assay, consistent with each strain carrying mutations in the same gene. Taken together, these data provide strong evidence that we have identified the dyf-5 gene. M04C9.5 encodes a previously uncharacterized but evolutionarily conserved serine/threonine kinase that, consistent with its likely role in cilia formation/function, has been identified in human and Chlamydomonas ciliary proteomes [38,39].

thumbnailFigure 4. Identification of X-box regulated genes facilitated the cloning of the C. elegans dye filling defective gene, dyf-5. M04C9.5 in C. elegans and its orthologs in C. briggsae (CBG22182) and C. remanei (Cr_M04C9.5) all have X-box motifs in their promoters. The C. elegans candidate gene M04C9.5 matches the genetic position of dyf-5. Sequencing of M04C9.5 in the dyf-5 strain revealed that it carries a G→A point mutation in its second coding exon, which generates a nonsense mutation and, therefore, causes a premature termination in translation. Numbers next to X-box motifs are their HMM scores. This figure was drawn using the Generic Genome Browser [49].

Discussion

The aim of this project was to identify novel ciliary/ciliopathy genes by using a comparative genomics approach that exploits emerging sequence and sequence annotation data of related animal species. Here, we have identified an extensive list (total 93) of candidate X-box regulated genes, of which approximately one-third are known X-box-regulated/ciliary genes. Many, or even the majority, of these candidate ciliary genes when mutated may cause a dye filling defect. Since the majority (83 out of 93) of the candidate X-box-regulated genes in C. elegans have readily identifiable human orthologs (Additional data file 2), it would be productive to screen patients with known ciliopathies, such as BBS, for mutations affecting some of these genes. In addition, based on the correlation between the Dyf phenotype and ciliary gene function, the regulation of such genes by the X-box-binding DAF-19 transcription factor, and the conservation of such motifs across sister Caenorhabditis genomes, we have successfully cloned dyf-5 and identified at least one other dyf gene, namely ZK520.3 for dyf-2, which has been characterized elsewhere [24]. The cloning of these dyf genes has demonstrated the effectiveness of the combined comparative genomics and genetics analysis approach presented here. The newly cloned dyf-5 gene may be a C. elegans ortholog of a yet unidentified human BBS or other ciliopathy-associated gene since all studied C. elegans orthologs of known human BBS genes result in a Dyf phenotype when disrupted [18,20,40].

Because transcriptional regulatory motifs are generally short (less than 20 bp) and degenerate, many thousands of potential binding sites for any given transcription factor are expected to be found by chance [41] and this poses a great challenge in identifying bona fide binding sites, especially in large eukaryote genomes. Our approach overcomes such a challenge by using comparative genomics and the recent availability of multiple sister Caenorhabditis genomes. In the context of identifying transcription factor binding sites and target genes, such an approach is arguably advantageous compared to approaches that rely on co-expression, which can be coincidental or even secondary to a common transcriptional regulatory pathway and thus lead to a high rate of false positives. Indeed, many of the 466 daf-19 regulated genes identified in this study by microarray expression profiling do not contain the X-box motif in their promoters and are not necessarily directly regulated by DAF-19. Furthermore, comparative genomics is advantageous because it does not encounter problems of data noise and biased sampling associated with functional genomics projects. On the other hand, the comparative genomics based strategy reveals only highly conserved motifs while others are regarded as false positives and discarded accordingly. One caveat of this rather conservative filtering procedure is that species-specific binding motifs, or more divergent motifs, are mistakenly discarded, leading to a non-negligible false negative rate. Therefore, the candidate X-box regulated genes identified in this project may only represent a portion of the entire set of bona fide X-box regulated genes in C. elegans. In fact, there are still seven dyf genes (dyf-4, dyf-7, dyf-8, dyf-9, dyf-10, dyf-11 and dyf-12) in C. elegans that remain to be identified. However, we should be aware that not all of the uncloned dyf genes are DAF-19 and X-box dependent (for example, genes such as daf-6 [42] that are expressed in the sheath cell or socket cell when mutated can also lead to the Dyf phenotype). To clone these bona fide X-box-regulated dyf genes and identify additional X-box regulated genes, some of which might be uncloned osm or che genes, we will need to have a more detailed understanding of the properties of X-box motifs, including the variation, preferred position in the promoter, and interaction with other binding motifs. Some of these questions will be at least partially addressed after we have validated more of our candidate X-box-containing genes in C. elegans. This study and previous studies [6,10,16,17] have found that the majority of known X-boxes are located within 250 bp upstream of the translational start site (ATG). However, many genuine X-boxes reside far outside of this optimal region, further suggesting that other factors or properties of X-boxes that are critical for their functions remain to be identified.

Additionally, improvement in gene curation and the emergence of more related sequenced genomes, including Caenorhabditis japonica and CB5161, will undoubtedly serve to reduce false negative hits and reveal more targets. Lastly, functional genomics approaches, including ChIP-Chip [43], SACO [44], or ChIP-PET [45,46] technologies, will help to identify more novel candidate genes, in particular species-specific ones.

Conclusion

Our study demonstrates how comparative genomics is a powerful tool for facilitating identification of novel genes and positional cloning. In this study, we exploited the prior understanding of known BBS genes, the C. elegans dye filling defect phenotype, and, most importantly, the presence of a shared synteny of regulatory (X-box) motifs among conserved genes. It will be of great interest to pursue the characterization of the many X-box containing genes identified in this study, in particular with respect to their possible involvement in ciliary function and as candidates for BBS/ciliopathy-associated genes.

Materials and methods

Data mining and gene finding

Genomic sequences and gene annotations of C. elegans and C. briggsae were obtained from WormBase stable release WS150 [32]. Genomic sequences of C. remanei were obtained from the ftp site of the development site of WormBase. Since the C. remanei genome sequencing project is still in progress, a consensus gene set is not yet available. To annotate the PCAP-assembled [47]C. remanei genome, a homology-based gene finding program Exonerate (version 1.0.0) [48] was used. All sequence and annotation data were dumped into and retrieved from a MySQL database using the Bio::DB::GFF schema [49], and were viewed using the Generic Genome Browser [49].

HMMER and motif finding

The HMMER program package was downloaded from Sean Eddy's website [21,50]. Release version HMMER 1.8.5 was used because it has been tested and extensively used for DNA sequence analysis. Fifteen X-box motifs (from thirteen genes, shown in Additional data file 1) were aligned using the program ClustalW [51] before being fed to the hmmb and hmmfs programs for creating an HMM profile and searching instances of X-box motifs, respectively. Results were parsed and loaded into the Bio::DB::GFF database for further analysis.

SAGE analysis

SAGE libraries were downloaded from the British Columbia C. elegans Gene Expression Consortium, Canada [33,34]. Before being used for gene expression analysis, SAGE tags were filtered for usable tags. Each of these usable tags can be unambiguously mapped to a single gene model and its tag frequency has to be five or more in at least one of the SAGE libraries. The density curves for PCC values were generated using the statistics package R [52] as reported previously [34].

Promoter::GFP transgenic strains

The engineering procedure was as described in our previous publications [53,54]. Briefly, the GFP coding sequence was 'stitched' together with the promoter of the gene of interest following the procedure developed by Oliver Hobert [55], followed by injection of the constructs into dpy-5 worms [56]. A wild-type dpy-5 gene was co-injected. F2 dyp-5(+) worms were subsequently selected, and then placed under the microscope for analysis of GFP signals.

Transgenic rescue

A rescuing construct for M04C9.5 was generated by PCR amplifying a 3,773 bp fragment of N2 genomic DNA encompassing the M04C9.5 gene and flanking sequences using the primers: M04C9.5F2 5' GAAAAAAAAGTATTTGTAACG3' and M04C9.5R2 5' GGATATTTCAGCACCATGAG 3'. Microinjection was performed as described [57]. Briefly, 50 ng/μl of rescuing construct along with 100 ng/μl of pCeh361 (a dpy-5 rescuing plasmid [56]) and 20 ng/μl of pmyo-2::GFP (dominant marker, gift from A Fire in Stanford University) was co-injected into dpy-5(e907) worms. The M04C9.5 rescuing constructs were crossed into the dyf-5(mn400) mutant background and assayed for rescue of the dye-filling defective phenotype by DiI staining [36].

Gene sequencing

The same PCR fragments used for transgenic rescue were used for sequencing of the M04C9.5 genomic regions. The constructs were subsequently PCR purified and sent to Macrogen [58] for sequencing. Sequencing primers are included in Additional data file 4.

Complementation test

The complementation test between dyf-5(mn400) and M04C9.5 (ok1170) and between dyf-10(e1383) and C48B6.8 (gk471) were performed as described [36]. Phenotypes were assessed by DiI dye filling [36].

DAF-19 microarray expression profiling

Embryo preparation

daf-19(-) animals (daf-19(m86);daf-12(sa204)) and daf-19(+) animals (daf-12(sa204)) were grown to adult stage on solid media. Note that the daf-12(sa204) mutation suppresses the Daf-c phenotype of daf-19(m86), thereby allowing us to obtain large populations of daf-19(-) worms. Eggs were prepared from gravid adults using a hypochlorite treatment [59], resuspended in 10 mM Tris-EDTA (pH 7.5) and stored at -80°C.

RNA isolation, analysis and labeling

Thawed embryos were disrupted using syringes fit with a 26-gauge needle. Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, California, USA) coupled with phase lock gel tubes (Eppendorf, Hamburg, Germany). Extracted RNA was subjected to rigorous quality assessment and quantification using the RNA Nano LabChip Kit (Agilent Technologies, Santa Clara) with the 2100 Bioanalyzer (Agilent Technologies). Numerical measures of RNA quality (rRNA ratio, RNA integrity number) were employed to ensure the high quality of extracted RNA. Good quality total RNA (5 micrograms) was subjected to a standard eukaryotic target preparation protocol as detailed in the GeneChip Expression Analysis Technical Manual (provided by Affymetrix, Santa Clara, California, USA) [60].

GeneChip hybridization, washing, staining, and scanning

A hybridization cocktail mixture was made for each labeled RNA sample. Each cocktail included spikes of GeneChip hybridization controls, which served as measures of hybridization quality and array performance. Each sample was subsequently hybridized to an Affymetrix GeneChip C. elegans genome array. This high-density GeneChip simultaneously probes for over 22,500 C. elegans transcripts. Sixteen-hour hybridizations were performed in a GeneChip Hybridization Oven 640, followed by automated washes and staining in a GeneChip Fluidics Station 450 controlled by GeneChip operating software (GCOS). The procedure involved a single stain protocol using a streptavidin-phycoerythrin conjugate coupled with antibody amplification of fluorescent signal. Lastly, scanning and image capture were done with a solid-state green laser GeneChip Scanner 3000.

Raw data processing and technical quality assessments

The raw array images were visually inspected for artifacts and for proper grid-alignment. Data processing followed using GCOS software, with a chip-by-chip analysis to assess global trends in expression data. For each analysis, signal intensities were scaled to All Probe Sets with a Target Signal setting of 500, the Normalization Value was set to 1, and default settings were used for the remaining expression analysis parameters. Relative scaling factors, average background and noise values were confirmed to be within ranges considered satisfactory as per the Affymetrix Data Analysis Fundamentals manual (provided by Affymetrix) [61]. Signals from spiked hybridization controls were checked to ensure that the limits of assay sensitivity were achieved. Ratios of the 3' versus 5' probe sets for selected endogenous transcripts (beta-actin and GAPDH), ideally approaching a value of 1, were checked to ensure efficiencies in cDNA synthesis and in vitro transcription reactions. Chips meeting all these quality metrics were passed for higher level analysis. Microarray datasets used for this project have been submitted to the Gene Expression Omnibus (GEO) database [62]. The GEO accession numbers are GSE6563 (project number), GSM151745 (daf-19(m86);daf-12(sa204), GSM151746 (daf-19(m86);daf-12(sa204)), GSM151747 (daf-12(sa204)), and GSM151748 (daf-12(sa204)).

Additional data files

The following additional data are available with the online version of this paper. Additional data file 1 is a table listing previously identified X-box motifs in C. elegans. These motifs were used as input to generate an HMM profile for finding novel X-box motifs. Additional data file 2 is a table listing known and newly identified X-box-regulated genes in C. elegans. Additional data file 3 is a table listing Affymetrix microarray analysis results. Additional data file 4 is a list of sequencing primers for identifying dyf-5.

Additional data file 1. These motifs were used as input to generate an HMM profile for finding novel X-box motifs.

Format: DOC Size: 36KB Download file

This file can be viewed with: Microsoft Word ViewerOpen Data

Additional data file 2. Known and newly identified X-box-regulated genes in C. elegans.

Format: DOC Size: 178KB Download file

This file can be viewed with: Microsoft Word ViewerOpen Data

Additional data file 3. Affymetrix microarray analysis results.

Format: XLS Size: 4.6MB Download file

This file can be viewed with: Microsoft Excel ViewerOpen Data

Additional data file 4. Sequencing primers for identifying dyf-5.

Format: DOC Size: 24KB Download file

This file can be viewed with: Microsoft Word ViewerOpen Data

Acknowledgements

LDS is funded by NHGRI. NC is supported by grants from NHGRI, NSERC and a start-up fund from Simon Fraser University. DLB is supported by grants from NSERC, CIHR of Canada and from Genome Canada and Genome British Columbia. DGM and MAM are supported by Genome Canada and Genome British Columbia. MRL is supported by a grant from the March of Dimes and holds scholar awards from CIHR and MSFHR. OEB was supported by a MSFHR fellowship and is currently supported by Science Foundation Ireland. AM is supported by an NSERC scholarship. Work in the laboratory of PS is supported by grants from the Swedish Research Council (VR) and from the Swedish Foundation for Strategic Research (SSF). Jamie Inglis worked on this project when he was a summer student in the Stein lab. Strains containing the dyf-5(mn400), dyf-5/M04C9.5(ok1170), daf-19(m86), daf-12(sa204), dyf-10(e1383) and C48B6.8 (gk471) mutant alleles were obtained from the Caenorhabditis Genetics Center (CGC). We thank Kim Wong who participated the in the microarray analysis project and Richard Karhol and Allen Delaney for submitting the microarray data to the Gene Expression Omnibus (GEO). We thank Doreen Ware for critical review of the manuscript.

References

  1. Badano JL, Mitsuma N, Beales PL, Katsanis N: The ciliopathies: an emerging class of human genetic disorders.

    Annu Rev Genomics Hum Genet 2006, 7:125-148. PubMed Abstract | Publisher Full Text OpenURL

  2. Kozminski KG, Forscher P, Rosenbaum JL: Three flagellar motilities in Chlamydomonas unrelated to flagellar beating. Video supplement.

    Cell Motil Cytoskeleton 1998, 39:347-348. PubMed Abstract OpenURL

  3. Scholey JM: Intraflagellar transport.

    Annu Rev Cell Dev Biol 2003, 19:423-443. PubMed Abstract | Publisher Full Text OpenURL

  4. Barr MM: Caenorhabditis elegans as a model to study renal development and disease: sexy cilia.

    J Am Soc Nephrol 2005, 16:305-312. PubMed Abstract | Publisher Full Text OpenURL

  5. Inglis PN, Boroevich KA, Leroux MR: Piecing together a ciliome.

    Trends Genet 2006, 22:491-500. PubMed Abstract | Publisher Full Text OpenURL

  6. Swoboda P, Adler HT, Thomas JH: The RFX-type transcription factor DAF-19 regulates sensory neuron cilium formation in C. elegans.

    Mol Cell 2000, 5:411-421. PubMed Abstract | Publisher Full Text OpenURL

  7. Emery P, Durand B, Mach B, Reith W: RFX proteins, a novel family of DNA binding proteins conserved in the eukaryotic kingdom.

    Nucleic Acids Res 1996, 24:803-807. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  8. Fan Y, Esmail MA, Ansley SJ, Blacque OE, Boroevich K, Ross AJ, Moore SJ, Badano JL, May-Simera H, Compton DS, et al.: Mutations in a member of the Ras superfamily of small GTP-binding proteins causes Bardet-Biedl syndrome.

    Nat Genet 2004, 36:989-993. PubMed Abstract | Publisher Full Text OpenURL

  9. Li JB, Gerdes JM, Haycraft CJ, Fan Y, Teslovich TM, May-Simera H, Li H, Blacque OE, Li L, Leitch CC, et al.: Comparative genomics identifies a flagellar and basal body proteome that includes the BBS5 human disease gene.

    Cell 2004, 117:541-552. PubMed Abstract | Publisher Full Text OpenURL

  10. Ansley SJ, Badano JL, Blacque OE, Hill J, Hoskins BE, Leitch CC, Kim JC, Ross AJ, Eichers ER, Teslovich TM, et al.: Basal body dysfunction is a likely cause of pleiotropic Bardet-Biedl syndrome.

    Nature 2003, 425:628-633. PubMed Abstract | Publisher Full Text OpenURL

  11. Avidor-Reiss T, Maer AM, Koundakjian E, Polyanovsky A, Keil T, Subramaniam S, Zuker CS: Decoding cilia function: defining specialized genes required for compartmentalized cilia biogenesis.

    Cell 2004, 117:527-539. PubMed Abstract | Publisher Full Text OpenURL

  12. Kim JC, Ou YY, Badano JL, Esmail MA, Leitch CC, Fiedrich E, Beales PL, Archibald JM, Katsanis N, Rattner JB, Leroux MR: MKKS/BBS6, a divergent chaperonin-like protein linked to the obesity disorder Bardet-Biedl syndrome, is a novel centrosomal component required for cytokinesis.

    J Cell Sci 2005, 118:1007-1020. PubMed Abstract | Publisher Full Text OpenURL

  13. Stoetzel C, Laurier V, Davis EE, Muller J, Rix S, Badano JL, Leitch CC, Salem N, Chouery E, Corbani S, et al.: BBS10 encodes a vertebrate-specific chaperonin-like protein and is a major BBS locus.

    Nat Genet 2006, 38:521-524. PubMed Abstract | Publisher Full Text OpenURL

  14. Stoetzel C, Laurier V, Davis EE, Muller J, Rix S, Badano JL, Leitch CC, Salem N, Chouery E, Corbani S, et al.: Corrigendum: BBS10 encodes a vertebrate-specific chaperonin-like protein and is a major BBS locus.

    Nat Genet 2006, 38:521-524. PubMed Abstract | Publisher Full Text OpenURL

  15. Chiang AP, Beck JS, Yen HJ, Tayeh MK, Scheetz TE, Swiderski RE, Nishimura DY, Braun TA, Kim KY, Huang J, et al.: Homozygosity mapping with SNP arrays identifies TRIM32, an E3 ubiquitin ligase, as a Bardet-Biedl syndrome gene (BBS11).

    Proc Natl Acad Sci USA 2006, 103:6287-6292. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  16. Efimenko E, Bubb K, Mak HY, Holzman T, Leroux MR, Ruvkun G, Thomas JH, Swoboda P: Analysis of xbx genes in C. elegans.

    Development 2005, 132:1923-1934. PubMed Abstract | Publisher Full Text OpenURL

  17. Blacque OE, Perens EA, Boroevich KA, Inglis PN, Li C, Warner A, Khattra J, Holt RA, Ou G, Mah AK, et al.: Functional genomics of the cilium, a sensory organelle.

    Curr Biol 2005, 15:935-941. PubMed Abstract | Publisher Full Text OpenURL

  18. Blacque OE, Reardon MJ, Li C, McCarthy J, Mahjoub MR, Ansley SJ, Badano JL, Mah AK, Beales PL, Davidson WS, et al.: Loss of C. elegans BBS-7 and BBS-8 protein function results in cilia defects and compromised intraflagellar transport.

    Genes Dev 2004, 18:1630-1642. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  19. Ou G, Blacque OE, Snow JJ, Leroux MR, Scholey JM: Functional coordination of intraflagellar transport motors.

    Nature 2005, 436:583-587. PubMed Abstract | Publisher Full Text OpenURL

  20. Mak HY, Nelson LS, Basson M, Johnson CD, Ruvkun G: Polygenic control of Caenorhabditis elegans fat storage.

    Nat Genet 2006, 38:363-368. PubMed Abstract | Publisher Full Text OpenURL

  21. Bateman A, Birney E, Durbin R, Eddy SR, Finn RD, Sonnhammer EL: Pfam 3.1: 1313 multiple alignments and profile HMMs match the majority of proteins.

    Nucleic Acids Res 1999, 27:260-262. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  22. Colosimo ME, Brown A, Mukhopadhyay S, Gabel C, Lanjuin AE, Samuel AD, Sengupta P: Identification of thermosensory and olfactory neuron-specific genes via expression profiling of single neuron types.

    Curr Biol 2004, 14:2245-2251. PubMed Abstract | Publisher Full Text OpenURL

  23. Kunitomo H, Uesugi H, Kohara Y, Iino Y: Identification of ciliated sensory neuron-expressed genes in Caenorhabditis elegans using targeted pull-down of poly(A) tails.

    Genome Biol 2005, 6:R17. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text OpenURL

  24. Efimenko E, Blacque OE, Ou G, Haycraft CJ, Yoder BK, Scholey JM, Leroux MR, Swoboda P: Caenorhabditis elegans DYF-2, an ortholog of human WDR19, is a component of the IFT machinery in sensory cilia.

    Mol Biol Cell 2006, 17:4801-4811. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  25. Murayama T, Toh Y, Ohshima Y, Koga M: The dyf-3 gene encodes a novel protein required for sensory cilium formation in Caenorhabditis elegans.

    J Mol Biol 2005, 346:677-687. PubMed Abstract | Publisher Full Text OpenURL

  26. Bell LR, Stone S, Yochem J, Shaw JE, Herman RK: The molecular identities of the Caenorhabditis elegans intraflagellar transport genes dyf-6, daf-10, and osm-1.

    Genetics 2006, 173:1275-1286. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  27. Blacque OE, Li C, Inglis PN, Esmail MA, Ou G, Mah AK, Baillie DL, Scholey JM, Leroux MR: The WD repeat-containing protein, IFTA-1, is required for retrograde intraflagellar transport.

    Mol Biol Cell 2006, 17:5053-5062. PubMed Abstract | Publisher Full Text OpenURL

  28. Nishimura DY, Swiderski RE, Searby CC, Berg EM, Ferguson AL, Hennekam R, Merin S, Weleber RG, Biesecker LG, Stone EM, Sheffield VC: Comparative genomics and gene expression analysis identifies BBS9, a new Bardet-Biedl syndrome gene.

    Am J Hum Genet 2005, 77:1021-1033. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  29. Stoetzel C, Laurier V, Davis EE, Muller J, Rix S, Badano JL, Leitch CC, Salem N, Chouery E, Corbani S, et al.: BBS10 encodes a vertebrate-specific chaperonin-like protein and is a major BBS locus.

    Nat Genet 2006, 38:521-524. PubMed Abstract | Publisher Full Text OpenURL

  30. Stein LD, Bao Z, Blasiar D, Blumenthal T, Brent MR, Chen N, Chinwalla A, Clarke L, Clee C, Coghlan A, et al.: The genome sequence of Caenorhabditis briggsae: a platform for comparative genomics.

    PLoS Biol 2003, 1:E45. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  31. WormBase [http://www.wormbase.org/] webcite

  32. Chen N, Harris TW, Antoshechkin I, Bastiani C, Bieri T, Blasiar D, Bradnam K, Canaran P, Chan J, Chen CK, et al.: WormBase: a comprehensive data resource for Caenorhabditis biology and genomics.

    Nucleic Acids Res 2005, 33:D383-389. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  33. McKay SJ, Johnsen R, Khattra J, Asano J, Baillie DL, Chan S, Dube N, Fang L, Goszczynski B, Ha E, et al.: Gene expression profiling of cells, tissues, and developmental stages of the nematode C. elegans.

    Cold Spring Harb Symp Quant Biol 2003, 68:159-169. PubMed Abstract | Publisher Full Text OpenURL

  34. Chen N, Stein LD: Conservation and functional significance of gene topology in the genome of Caenorhabditis elegans.

    Genome Res 2006, 16:606-617. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  35. Jones SJ, Riddle DL, Pouzyrev AT, Velculescu VE, Hillier L, Eddy SR, Stricklin SL, Baillie DL, Waterston R, Marra MA: Changes in gene expression associated with developmental arrest and longevity in Caenorhabditis elegans.

    Genome Res 2001, 11:1346-1352. PubMed Abstract | Publisher Full Text OpenURL

  36. Starich TA, Herman RK, Kari CK, Yeh WH, Schackwitz WS, Schuyler MW, Collet J, Thomas JH, Riddle DL: Mutations affecting the chemosensory neurons of Caenorhabditis elegans.

    Genetics 1995, 139:171-188. PubMed Abstract | PubMed Central Full Text OpenURL

  37. Wicks SR, Yeh RT, Gish WR, Waterston RH, Plasterk RH: Rapid gene mapping in Caenorhabditis elegans using a high density polymorphism map.

    Nat Genet 2001, 28:160-164. PubMed Abstract | Publisher Full Text OpenURL

  38. Ostrowski LE, Blackburn K, Radde KM, Moyer MB, Schlatzer DM, Moseley A, Boucher RC: A proteomic analysis of human cilia: identification of novel components.

    Mol Cell Proteomics 2002, 1:451-465. PubMed Abstract | Publisher Full Text OpenURL

  39. Pazour GJ, Agrin N, Leszyk J, Witman GB: Proteomic analysis of a eukaryotic cilium.

    J Cell Biol 2005, 170:103-113. PubMed Abstract | Publisher Full Text OpenURL

  40. Matsushime H, Jinno A, Takagi N, Shibuya M: A novel mammalian protein kinase gene (mak) is highly expressed in testicular germ cells at and after meiosis.

    Mol Cell Biol 1990, 10:2261-2268. PubMed Abstract | PubMed Central Full Text OpenURL

  41. Vavouri T, Elgar G: Prediction of cis-regulatory elements using binding site matrices - the successes, the failures and the reasons for both.

    Curr Opin Genet Dev 2005, 15:395-402. PubMed Abstract | Publisher Full Text OpenURL

  42. Perens EA, Shaham S: C. elegans daf-6 encodes a patched-related protein required for lumen formation.

    Dev Cell 2005, 8:893-906. PubMed Abstract | Publisher Full Text OpenURL

  43. Ren B, Robert F, Wyrick JJ, Aparicio O, Jennings EG, Simon I, Zeitlinger J, Schreiber J, Hannett N, Kanin E, et al.: Genome-wide location and function of DNA binding proteins.

    Science 2000, 290:2306-2309. PubMed Abstract | Publisher Full Text OpenURL

  44. Impey S, McCorkle SR, Cha-Molstad H, Dwyer JM, Yochum GS, Boss JM, McWeeney S, Dunn JJ, Mandel G, Goodman RH: Defining the CREB regulon: a genome-wide analysis of transcription factor regulatory regions.

    Cell 2004, 119:1041-1054. PubMed Abstract | Publisher Full Text OpenURL

  45. Ng P, Wei CL, Sung WK, Chiu KP, Lipovich L, Ang CC, Gupta S, Shahab A, Ridwan A, Wong CH, et al.: Gene identification signature (GIS) analysis for transcriptome characterization and genome annotation.

    Nat Methods 2005, 2:105-111. PubMed Abstract | Publisher Full Text OpenURL

  46. Wei CL, Wu Q, Vega VB, Chiu KP, Ng P, Zhang T, Shahab A, Yong HC, Fu Y, Weng Z, et al.: A global map of p53 transcription-factor binding sites in the human genome.

    Cell 2006, 124:207-219. PubMed Abstract | Publisher Full Text OpenURL

  47. Huang X, Wang J, Aluru S, Yang SP, Hillier L: PCAP: a whole-genome assembly program.

    Genome Res 2003, 13:2164-2170. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  48. Slater GS, Birney E: Automated generation of heuristics for biological sequence comparison.

    BMC Bioinformatics 2005, 6:31. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text OpenURL

  49. Stein LD, Mungall C, Shu S, Caudy M, Mangone M, Day A, Nickerson E, Stajich JE, Harris TW, Arva A, Lewis S: The generic genome browser: a building block for a model organism system database.

    Genome Res 2002, 12:1599-1610. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  50. HMMER [http://hmmer.janelia.org/] webcite

  51. Higgins DG, Thompson JD, Gibson TJ: Using CLUSTAL for multiple sequence alignments.

    Methods Enzymol 1996, 266:383-402. PubMed Abstract OpenURL

  52. Package R [http://www.r-project.org/] webcite

  53. Chen N, Pai S, Zhao Z, Mah A, Newbury R, Johnsen RC, Altun Z, Moerman DG, Baillie DL, Stein LD: Identification of a nematode chemosensory gene family.

    Proc Natl Acad Sci USA 2005, 102:146-151. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  54. Zhao Z, Fang L, Chen N, Johnsen RC, Stein L, Baillie DL: Distinct regulatory elements mediate similar expression patterns in the excretory cell of Caenorhabditis elegans.

    J Biol Chem 2005, 280:38787-38794. PubMed Abstract | Publisher Full Text OpenURL

  55. Hobert O, Loria P: Uses of GFP in Caenorhabditis elegans.

    Methods Biochem Anal 2006, 47:203-226. PubMed Abstract OpenURL

  56. Thacker C, Sheps JA, Rose AM: Caenorhabditis elegans dpy-5 is a cuticle procollagen processed by a proprotein convertase.

    Cell Mol Life Sci 2006, 63:1193-1204. PubMed Abstract | Publisher Full Text OpenURL

  57. Mello C, Fire A: DNA transformation.

    Methods Cell Biol 1995, 48:451-482. PubMed Abstract OpenURL

  58. Macrogen [http://www.macrogen.com/] webcite

  59. Protocol Online [http://www.protocol-online.org] webcite

  60. GeneChip Expression Analysis Technical Manual [http:/ / www.affymetrix.com/ support/ downloads/ manuals/ expression_analysis_manual.pdf] webcite

  61. Affymetrix Data Analysis Fundamentals Manual [http:/ / www.affymetrix.com/ support/ downloads/ manuals/ data_analysis_fundamentals_manual.p df] webcite

  62. Barrett T, Edgar R: Mining microarray data at NCBI's Gene Expression Omnibus (GEO).

    Methods Mol Biol 2006, 338:175-190. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  63. Fujii M, Matsumoto Y, Tanaka N, Miki K, Suzuki T, Ishii N, Ayusawa D: Mutations in chemosensory cilia cause resistance to paraquat in nematode Caenorhabditis elegans.

    J Biol Chem 2004, 279:20277-20282. PubMed Abstract | Publisher Full Text OpenURL

  64. Qin H, Rosenbaum JL, Barr MM: An autosomal recessive polycystic kidney disease gene homolog is involved in intraflagellar transport in C. elegans ciliated sensory neurons.

    Curr Biol 2001, 11:457-461. PubMed Abstract | Publisher Full Text OpenURL

  65. Schafer JC, Haycraft CJ, Thomas JH, Yoder BK, Swoboda P: XBX-1 encodes a dynein light intermediate chain required for retrograde intraflagellar transport and cilia assembly in Caenorhabditis elegans.

    Mol Biol Cell 2003, 14:2057-2070. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  66. Fujiwara M, Sengupta P, McIntire SL: Regulation of body size and behavioral state of C. elegans by sensory perception and the EGL-4 cGMP-dependent protein kinase.

    Neuron 2002, 36:1091-1102. PubMed Abstract | Publisher Full Text OpenURL

  67. Collet J, Spike CA, Lundquist EA, Shaw JE, Herman RK: Analysis of osm-6, a gene that affects sensory cilium structure and sensory neuron function in Caenorhabditis elegans.

    Genetics 1998, 148:187-200. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  68. Signor D, Wedaman KP, Orozco JT, Dwyer ND, Bargmann CI, Rose LS, Scholey JM: Role of a class DHC1b dynein in retrograde transport of IFT motors and IFT raft particles along cilia, but not dendrites, in chemosensory neurons of living Caenorhabditis elegans.

    J Cell Biol 1999, 147:519-530. PubMed Abstract | Publisher Full Text OpenURL

  69. Haycraft CJ, Swoboda P, Taulman PD, Thomas JH, Yoder BK: The C. elegans homolog of the murine cystic kidney disease gene Tg737 functions in a ciliogenic pathway and is disrupted in osm-5 mutant worms.

    Development 2001, 128:1493-1505. PubMed Abstract | Publisher Full Text OpenURL