Table 6 |
||||||||
|
Location of 17 putative small-scale aberrations identified in MCF7 clones |
||||||||
|
Aberration position and size |
PCR validation |
|||||||
|
|
|
|||||||
|
Chr. |
Start (bp) |
End (bp) |
Size (bp) |
Affected/all clones |
Sampled clone* |
Reaction† |
Primers |
Products (bp) |
|
|
||||||||
|
1 |
54,737,944 |
54,742,444 |
4,500 |
1/1 |
M0025G14 |
|||
|
2 |
15,468,892 |
15,471,992 |
3,100 |
1/1 |
M0015O22 |
D |
GGGGCCCTTTAGTGCCTTAG AATTGCCAAGTCAGAGGCAG |
4,686 5,251 (+565) |
|
2 |
110,086,572 |
110,101,972 |
15,400 |
1/1 |
M0006P20 |
|||
|
3 |
63,591,911 |
63,594,011 |
2,100 |
2/5 |
M0118E13 |
|||
|
3 |
159,597,920 |
159,602,020 |
4,100 |
1/1 |
M0012G17 |
B |
TACTTACGGCAGAGGTTGGG TCTGATTTTGGAGCTTTTGG |
6,411 6,017 (-394) |
|
4 |
13,455,944 |
13,464,544 |
8,600 |
1/1 |
M0004J18 |
|||
|
5 |
177,652,902 |
177,661,002 |
8,100 |
1/1 |
M0019C11 |
|||
|
10 |
45,658,295 |
45,662,695 |
4,400 |
1/1 |
M0021J21 |
|||
|
18 |
13,660,940 |
13,670,040 |
9,100 |
1/1 |
M0040N18 |
|||
|
19 |
46,075,421 |
46,081,021 |
5,600 |
1/1 |
M0005H04 |
|||
|
20 |
8,877,965 |
8,903,965 |
26,000 |
1/1 |
M0013M22 |
A |
CTTGGGTTGGGAACTGAAAG CCTCTTCTGGGACTGCTGAC |
28,006 4,925 (-23,081) |
|
20 |
39,042,929 |
39,047,029 |
4,100 |
1/1 |
M0011K13 |
|||
|
20 |
48,823,455 |
48,827,555 |
4,100 |
3/21 |
M0107O02 |
|||
|
20 |
51,886,035 |
51,891,935 |
5,900 |
1/1 |
M0089C13 |
|||
|
20 |
52,157,503 |
52,161,003 |
3,500 |
1/1 |
M0004L22 |
|||
|
20 |
59,158,037 |
59,163,037 |
5,000 |
1/2 |
M0141F19 |
|||
|
X |
97,281,472 |
97,287,472 |
6,000 |
1/1 |
M0018J12 |
C |
CCCACCAATGGATTACAACC CTTGAACCTGGGAAGCAGAG |
7,828 4,971 (-2,857) |
|
|
||||||||
|
Four aberrations were tested with PCR using the primers shown here. The expected primer products based on inter-primer distance on the reference genome are shown in bold, with the observed product sizes shown below. *See Additional data file 2. †See Figure 7. |
||||||||
|
Krzywinski et al. Genome Biology 2007 8:R224 doi:10.1186/gb-2007-8-10-r224 |
||||||||
