Table 3

Primers and PCR conditions

PigEST name

Gene symbol

Oligo sequence (5' to 3')

Amplicon length

Tm (°C)


Ss1.1-rhlv24b_a21.5

Troponin

CCAGAGTCCCCAGGATA

TGAGCAGGGCTTTATTTGCATTC

100

63

Ss1.1-rcst01_n6.5

Pepsinogen A precursor

TACTGCTGCTCAGCTTG

GTGTCCTTCAGCTTGCCATTCTT

106

60

Ss1.1-rcst21_l12.5

Pepsinogen C

TCCTGGTCCTTTTTGACACCTAGAGGACTTGCTGGGGTTG

108

60

Ss1.1-rhyp08c_e13.5.5

Myelin basic protein

GCAGGGCATAGAGATGGTGTCCCGACCCTGTTAGGAAGAT

100

60

Ss1.1-Liv1-LVRM1E040203.5.5

Fetuin B

GCCCTGTGTTTCAAATCCTGAGGAGCCACAAGGACAGCTA

100

60

Ss1.1-rnlu1830b_g11.5

SP-C

TGTACATCTAGGAAACATCAGATTCTTTGGTGGTAGAAGCC

201

60

Ss1.1-rill310b_f20.5

Gastrotropin

TGAACAGCCCCAACTACCACTCATGCCAGCTTCTTGCTTA

110

60

Ss1.1-rduo424b_g21.5

Vitamin D-dependent calcium binding protein

TGAGTGCCCAAAAGTCTCCTCAGTTGCTTCAGCTCCTCCT

153

60


Table of the used primers and their corresponding polymerase chain reaction (PCR) conditions for the eight selected genes for which quantitative PCR (qPCR) was carried out. The column 'PigEST name' indicates the name of contig. 'Gene name' is the gene name of the selected genes according to UniProt match. 'Oligo sequence (5' to 3')' is the oligonucleotide sequences used in the qPCR experiment. 'Amplicon length' is the length of the amplified product in the qPCR. 'Tm' indicates the annealing temperature used in the qPCR.

Gorodkin et al. Genome Biology 2007 8:R45   doi:10.1186/gb-2007-8-4-r45

Open Data