Table 6

Primer sequences used for real-time PCR

Gene

Forward primer

Reverse primer


Car2

CTGACCACTCCGCCTCTG

AGCGTACGGAAATGAGACATC

Dcx

ACACCCTTGATGGAAAGCAG

AGGACCACAAGCAATGAACA

DIO2

GTAGCCTTTGAACGTGTGTGCA

TTCTCCAGCCAACTTCGGACT

Gabra6

TGGAAGCGGAGATTGTTGTG

CAGGCGTCGATTTTAAGATGG

Gfap

GCTGGAGGGCGAAGAAAAC

GGCCTTCTGACACGGATTTG

Hprt

GTTCTTTGCTGACCTGCTGGA

TCCCCCGTTGACTGATCATT

Mag

TCTCTACCCGGGATTGTCAC

AGGTCCAGTTCTGGGGATTC

Mal

CCTCAGTGCCTCAGTTCTGG

GTGACCACGTAGGCAAACAC

Mobp

CACGGATGAAAACCCAGTGAG

TCACGCTTGGAGTTGAGGAAG

Mog

GAATCTCCATCGGACTTTTGA

GGTCCAAGAACAGGCACAAT

Nnat

AGTAGACCTCGGCGAACCCT

CCCAGTAAATGCAGCATTCCA

Plp1

TGCGCTGATGCCAGAATGTA

GCGAAGTTGTAAGTGGCAGCA

Sox2

GCAGTTAAATTTAGGACCGTTACAA

TCTCATGTTTTCCTTTTGTACAATTT

Sox4

GGACAGCGACAAGATTCCGTT

TGCCCGACTTCACCTTCTTTC

Sox11

CAAGGTATTCCAGCTACTGGCC

CGGCTAGACTGCTATGCACACA

TN-C

GGCGTTAACTGGTTCCATTGG

ATTTATGCCCGCTTACGCCTG


Wong et al. Genome Biology 2007 8:R72   doi:10.1186/gb-2007-8-5-r72

Open Data