Table 1

Primers used for determination of mRNA expression levels by Q-RT-PCR

Gene

Forward primer

Reverse primer


Mouse

Gapdh

TGCACCACCAACTGCTTAG

GATGCAGGGATGATGTTC

Oct4 (Pou5f1)

CCAATCAGCTTGGGCTAGAG

CCTGGGAAAGGTGTCCTGTA

Pecam

GTCATGGCCATGGTCGAGTA

CTCCTCGGCGATCTTGCTGAA

Lyve-1

AGGAGCCCTCTCCTTACTGC

ACCTGGAAGCCTGTCTCTGA

vWF

GCCAAAGATCTGGAACAGTGT

GATGGAGAGGTTACACATCTC

F2

CAGCTATGAGGAGGCCTTTG

TCACACCCAGATCCATAGCA

Tat

TTAAGTCCAATGCGGACCTC

GCTCTGTGAATTCCACGTCA

Afp

GCCCTACAGACCATGAAACAAG

GTGAAACAGACTTCCTGGTCCT

Ttr

CTTTGCCTCTGGGAAGACC

CAGAGTCGTTGGCTGTGAAA

Foxa2

CCCGGGACTTAACTGTAACG

TCATGTTGCTCACGGAAGAG

Hnf4a

GGTCAAGCTACGAGGACAGC

ATGTACTTGGCCCACTCGAC

Sox7

CTTCAGGGGACAAGAGTTCG

CCATGACTTTCCCAGCATCT

Sox17

CACAACGCAGAGCTAAGCAA

TTGTAGTTGGGGTGGTCCTG

Myocd

CTGTGTGGAGTCCTCAGGTCAAACC

GATGTGTTGCGGGCTCTTCAG

Pdgra

ACGTTCAAGACCAGCGAGTT

CCTCCAGCATGGTGATACCT

Pdgfrb

CACCTTCTCCAGTGTGCTGA

GGAGTCCATAGGGAGGAAGC

Tek

AAGCATGCCCATCTGGTTAC

GCCTGCCTTCTTTCTCACAC

Fbx15

GGCCTTGAATGGAGAACTGA

TCAAACCACCCTAGGTCTGC

Dnmt3l

CCTGGTGAAGAACTGCCTTC

GCAAAGTGAGCTGCACAGAG

Rex1

CCTGCACACAGAAGAAAGCA

TCAGTCTGTCGAGGGCTCTT

Dppa5

CAGTCGCTGGTGCTGAAATA

TCCATTTAGCCCGAATCTTG

Eras

CCCTGCTTGTCCATGAGATT

TGGTAACTTGGTCGGAGAGG

Utf1

GGCCATACCTTCGAATCCTC

GGTTTGGTCGAAGGAACCTC

Tdgf1

GCATCCTACGAGGGAGTTGA

CACTGTGCTTGGCTGAAGAA

Tcl1

TTCCTCTCTGGGTGTTCAGG

ATCCCACACATTCCCTTTCA

Ecat1

GAATGCCTGGAAGATCCAAA

AAATCTCAGCTCGCCTTTCA

Nanog

GAGTGTGGGTCTTCCTGGTC

GAGGCAGGTCTTCAGAGGAA

Gdf3

CGCAGGACTTATGCTACGTG

CTGGGCCATGGTCAACTT

Fgf4

CCGACGAGTGTAAATTCAAAGAA

GGAAGTGGGTTACCTTCATGG

Sox2

ACCAGCTCGCAGACCTACAT

AGTGGGAGGAAGAGGTAACCA

Sox1

CACAACTCGGAGATCAGCAA

TGTAATCCGGGTGTTCCTTC

Pax6

TCAGACCTCCTCATACTCGTGCA

TGTAGGTATCATAACTCCGCCCA

Rat

Gapdh

TGCACCACCAACTGCTTAG

GATGCAGGGATGATGTTC

Oct4 (Pou5f1)

CTGTAACCGGCGCCAGAA

TGCATGGGAGAGCCCAGA

Vecad

GGCCAACGAATTGGATTCTA

GTTTACTGGCACCACGTCCT

Flt-1

TGGCCAGAGGCATGGAGT

TCGCAAATCTTCACCACATTG

Flk-1

CCAAGCTCAGCACACAAAAA

CCAACCACTCTGGGAACTGT

vWF

CCCACCGGATGGCTAGGTATT

GAGGCGGATCTGTTTGAGGTT

Afp

ACCTGACAGGGAAGATGGTG

GCAGTGGTTGATACCGGAGT

Alb

CTGGGAGTGTGCAGATATCAGAGT

GAGAAGGTCACCAAGTGCTGTAGT

Tat

AACCTCAGCACCAATGTTCC

TCTTCAGAGCACCCTGGACT

Ttr

CAGCAGTGGTGCTGTAGGAGTA

GGGTAGAACTGGACACCAAATC

Sox2

AACCCCAAGATGCACAACTC

CCGGGAAGCGTGTACTTATC

Otx1

GTTCGCAAAGACTCGCTACC

CCGGAGACGACTTCTTCTTG

Blbp

CCAGCTGGGAGAAGAGTTTG

TTTCTTTGCCATCCCACTTC

Pax6

GTCCATCTTTGCTTGGGAAA

TAGCCAGGTTGCGAAGAACT


Ulloa-Montoya et al. Genome Biology 2007 8:R163   doi:10.1186/gb-2007-8-8-r163

Open Data