Genome Biology

official impact factor 6.89

Open Access Highly Access Research

Genomic mapping of Suppressor of Hairy-wing binding sites in Drosophila

Boris Adryan1,2, Gertrud Woerfel1, Ian Birch-Machin1, Shan Gao3, Marie Quick1, Lisa Meadows3, Steven Russell3 and Robert White1*

Author Affiliations

1 Department of Physiology, Development and Neuroscience, University of Cambridge, Downing Street, Cambridge CB2 3DY, UK

2 Theoretical and Computational Biology Group, MRC Laboratory of Molecular Biology, Hills Road, Cambridge CB2 0QH, UK

3 Department of Genetics, University of Cambridge, Downing Street, Cambridge CB2 3EH, UK

For all author emails, please log on.

Genome Biology 2007, 8:R167 doi:10.1186/gb-2007-8-8-r167

Published: 16 August 2007

Additional files

Additional data file 1:

Provided is a table listing the ChIP-array results, showing the array ID number, fragment ID, and the values for the mean enrichment, P value, and t-value derived by CyberT from the embryo, brain, and wing ChIP-array data.

Format: XLS Size: 888KB Download file

This file can be viewed with: Microsoft Excel Viewer

Open Data

Additional data file 2:

Provided is a document containing the Su(Hw) position specific weight matrix.

Format: PDF Size: 17KB Download file

This file can be viewed with: Adobe Acrobat Reader

Open Data

Additional data file 3:

Provided is a table listing the Patser data, showing fragment ID and the associated Patser matches to the Su(Hw) position specific weight matrix, with details of strand, sequence of match, match Patser score, match Patser P value as ln(P), and chromosome and nucleotide coordinates in Drosophila genome release 3.1.

Format: XLS Size: 110KB Download file

This file can be viewed with: Microsoft Excel Viewer

Open Data

Additional data file 4:

Provided is a figure showing the validation ChIP assays to test prediction of binding sites outside the Adh region. We selected eight sites across the genome with good matches to the weight matrix (Patser P values ranged from e-16.3 to e-21.5) and that did not match the consensus (CT)(AT)GC(AC)TACTT(ACT)(CT) presented by Ramos and coworkers [22]. The specific immunopurification used 1 μl rabbit anti-Su(Hw) and the control used 1 μl normal rabbit serum, each in a 300 μl reaction using chromatin from Drosophila embryos. ChIP enrichment was assayed using PCR with specific primers, as described previously [26]. Six out of the eight test sites (sites 1 to 6) exhibited clear enrichment, and a further site site (site 7) exhibited weak evidence for enrichment. The primers used were as follows: 1A-2 (see Materials and Methods); 1, tttgctcaatgcaaagcact and gaatgaactgccgtccaact; 2, ccgatcctgcaagagaaaaa and tcaaccgagtacgagtgtgc; 3, ggcctaccgcaaaattcat and gggcaactcattaggcagtc; 4, tgctgtttcttcgagggagt and atgctttggttgcccattac; 5, catgtacgatctgcggaatg and cgcactccaagtgaagaaca; 6, caacattcgccattgcatac and ccacaaatccgctttcaaat; 7, caggccaaaaggcagttcta and tcagagattcgtggcagttg; and 8, cacactcgaagcgtgtgaat and aagtgtgtttgccagtgtgc.

Format: PDF Size: 39KB Download file

This file can be viewed with: Adobe Acrobat Reader

Open Data

Additional data file 5:

Provided is a table listing gene expression changes in total third instar larvae, showing CyberT results for 838 genes with better than 1.7-fold (P ≤ 10-2) in the following: su(Hw)/Df (su(Hw)v, P [CaS X/K5.3]/Df(3R)ED5644), Su(Hw)/+(su(Hw)v, P [CaS X/K5.3]/+), and Df/+ (Df(3R)ED5644/+). FlyBaseID, Flybase gene identifier; FlyBAse_sym = gene symbol; GeneID, FlyBase annotation symbol; ID, array unique identifier; Mn, mean log ratio of replicates; #obs, slides passing QC filters; p = P value; SD, standard deviation; t, t-statistic.

Format: XLS Size: 278KB Download file

This file can be viewed with: Microsoft Excel Viewer

Open Data

Additional data file 6:

Presented is a table listing gene expression changes in wing discs showing CyberT results for 89 genes with better than 1.7-fold (P ≤ 10-2) in the following: su(Hw)/Df (su(Hw)v, P [CaS X/K5.3]/Df(3R)ED5644), Su(Hw)/+ (su(Hw)v, P [CaS X/K5.3]/+), and Df/+ (Df(3R)ED5644/+). Column headings are as for Additional data file 5.

Format: XLS Size: 36KB Download file

This file can be viewed with: Microsoft Excel Viewer

Open Data

Additional data file 7:

Presented is a table listing gene expression changes in total third instar larvae showing CyberT results for the 229 genes in the Adh region: su(Hw)/Df (su(Hw)v, P [CaS X/K5.3]/Df(3R)ED5644), Su(Hw)/+ (su(Hw)v, P [CaS X/K5.3]/+), and Df/+ (Df(3R)ED5644/+). Column headings are as for Additional data file 5.

Format: XLS Size: 80KB Download file

This file can be viewed with: Microsoft Excel Viewer

Open Data

Additional data file 8:

Presented is a table listing gene expression changes in wing imaginal discs showing CyberT results for the 229 genes in the Adh region: su(Hw)/Df (su(Hw)v, P [CaS X/K5.3]/Df(3R)ED5644), Su(Hw)/+ (su(Hw)v, P [CaS X/K5.3]/+), and Df/+ (Df(3R)ED5644/+). Column headings are as for Additional data file 5.

Format: XLS Size: 79KB Download file

This file can be viewed with: Microsoft Excel Viewer

Open Data

Additional data file 9:

Provided are genome browser annotation tracks with coordinates in Drosophila genome, release 3.1.

Format: PDF Size: 31KB Download file

This file can be viewed with: Adobe Acrobat Reader

Open Data