Table 3

Primer sequences

Locus

Forward

Reverse

Tann


Replication timing/ChIP

Gbe

GGTGCAGATCATCCCCTTGA

TTACCCGACGGCGAAAG

60

α-Globin

CCACAAGCTGCGTGTGGAT

ATGCCGCCTGCCAGGT

60

Oct4

GGGTGAGAAGGCGAAGTCTGAA

GTGAGCCGTCTTTCCACCAGG

55

Nanog

CCCTCTGAGTTTGACCGGTGA

CAAGCTAGGATGTTAGGTCTCCCTG

60

Esg1

AAAGACGAACACAGAGTCAAACACC

CACCTGCTCGATGTGAGACATTC

60

Zfp57

TGCAAGATAAGAACGAGGAGCAGGAG

CCTTTGCGGCTTTGTGGATTTGTG

60

Rex1

TTTGCGGGAATCCAGCAGT

CGTCCCATCGCCACTCTAGAC

55

Sox2

CCATCCACCCTTATGTATCCAAG

CGAAGGAAGTGGGTAAACAGCAC

55

Nkx2.9

AAGTGCGAGGCGCTCG

TGGCACCTTCCGGACTTG

60

Sox3

TGCCCAGATGGCTTCCTATT

ACCCGGACATTCTCCGCT

60

Mage a2

TTGGTGGACAGGGAAGCTAGGGGA

CGCTCCAGAACAAAATGGCGCAGA

60

Ebf

AGATCTGGTTGAAGCCCTGTATGG

CATGTCACATCTCAGATCCTGTGTTCT

60

Mash1

CCAGGCTGGAGCAAGGGA

CGGTTGGCTTCGGGAGC

55

β-Globin

GGTGAACTTTACTGCTGAGGAAAAG

TCACCACCAACCTCTTCAACAT

60

Myf5

GGAGATCCGTGCGTTAAGAATCC

CGGTAGCAAGACATTAAAGTTCCGTA

55

Math1

CCCTCACTCAGGTCGCCTG

CGTGCGAGGAGCCAATCA

55

Sox1

ACAAGAGGAGGCAGCGAACC

TCGCAGGTGGAAAGTTTCTCC

55

Msx1

ACAGAAAGAAATAGCACAGACCATAAGA

TTCTACCAAGTTCCAGAGGGACTTT

55

Frg1

AAGGAGCCTATATCCATGCACTGGAC

GCCTCCCTGCCATTGCTTGT

60

Slc7a2

GACAAGGAACAGGGCGAGAAG

CTTTCCTCATCCTGGGCTTGAGTA

60

Msr1

GCCACCAATGCCCTAGAATTTC

GGCAGGCTCTCACTAGGAAGC

60

Loc2

ACTAGCAACTGGACATAAGAGTACACTACC

ATTACATATGGTGTCTGGAAGCCAG

60

Adam 26

CCTTGAACAACGCCCTTTTGTG

GCAAGCTCCCAAAACAGGTGT

60

Loc4

TAAGGTAGGCAGTGAGAGACATCCA

GGTGTAAGAAGGTTAGAACTAA

60

X141

GGGTCATAAAACGCTTTTCCAGGAA

TAGCACTGGAGATCAGATTGACGCCT

60

Minor satellite

TGATATACACTGTTCTACAAATCCCGTTTC

ATCAATGAGTTACAATGAGAAACATGGAAA

55

Major satellite

GACGACTTGAAAAATGACGAAATC

CATATTCCAGGTCCTTCAGTGTGC

55

rDNA

CCTGTGAATTCTCTGAACTC

CCTAAACTGCTGACAGGGTG

60

IAP

TTGATAGTTGTGTTTTAAGTGGTAAATAAA

AAAACACCACAAACCAAAATCTTCTAC

60

LINE 1

TTTGGGACACAATGAAAGCA

CTGCCGTCTACTCCTCTTGG

60

SINE B1

GTGGCGCACGCCTTTAATC

GACAGGGTTTCTCTGTGTAG

60

Gene expression

Mage a2

GAAGATCTCAGGAGTGTCAGGACTG

TCAGCCATTATGACTGTCCTAGGTAA

60

Ubc

AGGAGGCTGATGAAGAGCTTGA

TGGTTTGAATGGATACTCTGCTGGA

60

Oct4

CCCAAGGTGATCCTCTTCTGCTT

GAGAAGGTGGAACCAACTCCCG

60

CpG methylation assay

Major sat

GACGACTTGAAAAATGACGAAATC

CATATTCCAGGTCCTTCAGTGTGC

55

Sox2

TGGACTGCGAACTGGAGAAGG

CGCCCGGAGTCTAGCTCTAAATATT

60


IAP, intracisternal A particle. Tann, annealing temperature.

Jørgensen et al. Genome Biology 2007 8:R169   doi:10.1186/gb-2007-8-8-r169

Open Data