Table 2

Oligonucleotide primers used for DNA amplification

Gene name

Forward/reverse

Primer


NRG1

Forward

5'-(CTCGGTCCGCCACCATGTTTTACCCATATAACTATAGTAAC)-3'

NRG1

Reverse

5'-(CTCGGACCGTTATTGTCCCTTTTTCAAATGTGTTC)-3'

PHO88

Forward

5'-(CGCGGTCCGCTACGTAGCCACCATGAATCCTCAAGTCAGTAACATC)-3'

PHO88

Reverse

5'-(CGCGGACCGTCATTCAGCCTTAACACCAGCG)-3'

SMF1

Forward

5'-(CGCGGTCCGGTTTAAACAGGCCACCATGGTGAACGTTGGTCCTTCTC)-3'

SMF1

Reverse

5'-(CGCGGACCGTTAACTGATATCACCATGAGACATG)-3'

SMF2

Forward

5'-(CGCGGTCCGCTACGTAGCCACCATGACGTCCCAAGAATATGAACC)-3'

SMF2

Reverse

5'-(CGCGGACCGTTAGAGGTGTACTTCTTTGCCCG)-3'

SMP1

Forward

5'-(CTCGGTCCGCCACCATGGGTAGAAGAAAAATTGAAATTGAACC)-3'

SMP1

Reverse

5'-(CTCGGACCGTTAATCTGGAGAGTTTGTCGAACTCG)-3'


Ruotolo et al. Genome Biology 2008 9:R67   doi:10.1186/gb-2008-9-4-r67

Open Data