|
Resolution: standard / high Figure 1.
BACE1-AS and miR-485-5p competing for the same binding site in BACE1 mRNA. (a) Sequence information of miR-485-5p and its target site in BACE1 mRNA. Binding site in BACE1 mRNA has a strong affinity to the miR-485-5p (free energy = -26.3 using Microinspector;
-31.5 using RNA22; -22.8 using miRacle). The predicted target sequence AAGCTGTAGTCAAATCCATCAAGGCAGCCTCC
is found within exon 6 of BACE1. (b) The schematic shows the predicted target site for miR-485-5p, the BACE1-AS transcript and their relation to BACE1 mRNA. The binding site for miR-485-5p is located in the overlapping region of BACE1 and BACE1-AS. BACE1 exons are marked as E1 to E10. Both BACE1-AS and miR-485-5p have the potential to bind to exon 6 (E6) of BACE1 mRNA. (c) Over-expression of miR485-5p, but not vectors that over-express miR-17-3p, miR-652,
miR-593, or miR-183, nor control empty vector, leads to BACE1 protein reduction by
about 30% (**P-value < 0.01). Each treatment consists of 24 repeats and error bars represent standard
error of means. In this experiment, the miRNA-binding site was not artificially engineered;
rather, it is located in its usual place in the open reading frame of the BACE1 transcript. BACE1 protein level was measured by DiscoverRx technology.
Faghihi et al. Genome Biology 2010 11:R56 doi:10.1186/gb-2010-11-5-r56 |