Email updates

Keep up to date with the latest news and content from Genome Biology and BioMed Central.

Open Access Research

RNA processing in the minimal organism Nanoarchaeum equitans

Lennart Randau

Author Affiliations

Max-Planck-Institute for Terrestrial Microbiology, Karl-von-Frisch Strasse 10, 35037 Marburg, Germany

Genome Biology 2012, 13:R63  doi:10.1186/gb-2012-13-7-r63

Published: 18 July 2012

Additional files

Additional file 1:

N. equitans mapped RNA reads. Illumina HiSeq2000 sequencing reads were mapped to the N. equitans reference genome (GenBank: NC_005213, 490885 bp). The excel file contains the read coverage for the entire genome mapping. The genome region 449944 to 449989 (AAAAAAAGAAGAAAGAAAAAAGAAAGAAATAAAAAA) causes poly-A mapping artifacts.

Format: XLSX Size: 6.9MB Download file

Open Data

Additional file 2:

N. equitans C/D box sRNAs and H/ACA sRNAs. This excel file contains detailed analysis of the C/D box sRNAs and H/ACA sRNAs. Indicated are genomic location, genomic context, termini, box C and box D structures and potential sites of action.

Format: XLSX Size: 17KB Download file

Open Data