Open Access Research

RNA processing in the minimal organism Nanoarchaeum equitans

Lennart Randau

Max-Planck-Institute for Terrestrial Microbiology, Karl-von-Frisch Strasse 10, 35037 Marburg, Germany

Genome Biology 2012, 13:R63 doi:10.1186/gb-2012-13-7-r63

Published: 18 July 2012

Additional files

Additional file 1:

N. equitans mapped RNA reads. Illumina HiSeq2000 sequencing reads were mapped to the N. equitans reference genome (GenBank: NC_005213, 490885 bp). The excel file contains the read coverage for the entire genome mapping. The genome region 449944 to 449989 (AAAAAAAGAAGAAAGAAAAAAGAAAGAAATAAAAAA) causes poly-A mapping artifacts.

Format: XLSX Size: 6.9MB Download file

Open Data

Additional file 2:

N. equitans C/D box sRNAs and H/ACA sRNAs. This excel file contains detailed analysis of the C/D box sRNAs and H/ACA sRNAs. Indicated are genomic location, genomic context, termini, box C and box D structures and potential sites of action.

Format: XLSX Size: 17KB Download file

Open Data