Additional file 1.N. equitans mapped RNA reads. Illumina HiSeq2000 sequencing reads were mapped to the N. equitans reference genome (GenBank: NC_005213, 490885 bp). The excel file contains the read coverage for the entire genome mapping. The genome region 449944 to 449989 (AAAAAAAGAAGAAAGAAAAAAGAAAGAAATAAAAAA) causes poly-A mapping artifacts. Format: XLSX Size: 6.9MB Download file Randau Genome Biology 2012 13:R63 doi:10.1186/gb-2012-13-7-r63 |