Table 2

Newly identified microRNAs
Family Mature microRNA Sequence Length Abundancea
5163 Bdi-miR5163b-3p UAGAUAUUUCAGGUUGUGUGGA 22 36,348
5181 Bdi-miR5181e CGACACUUACUGUGGCUCGGA 21 277
5185 Bdi-miR5185l-3p.2 UGGAGAUUGACUUAGAAGCGG 21 360
7731 Bdi-miR7731 AACAAGGGAUGCACAUACUUUGAG 24 836
7738 Bdi-miR7738-3p GUGCUUGACAGACGACUCUGG 21 446
7754 Bdi-miR7754-3p UUCUCUCGGCUAAGGAACUGC 21 392
9480 Bdi-miR9480ab UAUGUGAGGGUGGUAACUGAA 21 1,645
9481 Bdi-miR9481a UCAGUCGGAUUUCUCACCUUCGAA 24 384
Bdi-miR9481b UCAGUCGGAUUUCUCACCUUC 21 73
9482 Bdi-miR9482 CCUUUGGGGAAGAAGGGAAAC 21 339
9483 Bdi-miR9483ab UUGAACUGUUUCCUCUGAAGUUCC 24 317
9484 Bdi-miR9484 UAGUGCAGGGAGAAGUCGGUC 21 259
9485 Bdi-miR9485 UUAUGACGUGUAGGAGUUGCA 21 260
9486 Bdi-miR9486a AUGCUUUCAAGGGAUUAGAGGUUC 24 254
Bdi-miR9486a.2 UCUAAUGGCUGAAAUGGGAAG 21 183
Bdi-miR9486b UAAGUGAUUAGAGGUUCCAGU 21 121
9487 Bdi-miR9487 CCUUGUUCGAUUGCAAGAUGA 21 174
9488 Bdi-miR9488 UGAGGGCUAGGCUUUUAUGUAA 22 161
9489 Bdi-miR9489 UCAGCUCCACGGACUUGGUGA 21 144
9490 Bdi-miR9490 AGGCCACACCCUAAUGGUCGUGCG 24 111
9491 Bdi-miR9491 UGGUAUGUUACCUCUGAUCAG 21 69
9492 Bdi-miR9492 UAUCUACUCUGUCAUGGUAUC 21 60
9493 Bdi-miR9493 AAGAAUUAUGAAACGAAGGGAGUA 24 60
9494 Bdi-miR9494 UUCAUCACCUUCGUCUCCGUC 21 56
9495 Bdi-miR9495 UGAAAAAUGCCUCUGGACGUG 21 55
9496 Bdi-miR9496 CUGGUUGGGCUUAGAUGGGUCC 22 44
9497 Bdi-miR9497 UUUCUGAAUACAUGGUGUAUC 21 35
9498 Bdi-miR9498 GACCGUCAAGUGGUUGUUGAG 21 23
9499 Bdi-miR9499 CCCUCGUCGACGCGGCAGCUC 21 86

aAbundance is from the sum of TP2M values from all libraries.

TP2M, transcripts per 2 million.

Jeong et al.

Jeong et al. Genome Biology 2013 14:R145   doi:10.1186/gb-2013-14-12-r145

Open Data