Table 3

Primer sequences

Name

Direction

Sequence


hypo

Forward

GGTGCTGCCTTTTCTTTGCTATTT

scrB

Reverse

CCCAATAACCACATACCAAGACC

scrB (internal)

Forward

CCAACATGGCTGGATGAATGACCC

Reverse

CCTGAGCGCCTCCGTCTCTTTC


Keeling et al. Genome Biology 2013 14:R27   doi:10.1186/gb-2013-14-3-r27

Open Data