Table 1

Primers used in the various reactions

Primer

Sequence 5'→'

RT primer (WTA)

TATAGAATTCGCGGCCGCTCGCGATAATACGACTCACTATAGGGCGTTTTTTTTTTTTTTTTTTTTTTTT

Tagging primer

TATAGAATTCGCGGCCGCTCGCGATTTTTTTTTTTTTTTTTTTTTTTT

Suppression primer

(NH2)-GTATAGAATTCGCGGCCGCTCGCGAT

TRSU

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T

TRSI-2

(5'-phosphate)GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTT*G

TRSI-4

(5'-phosphate)GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTT*G

TRSI-5

(5'-phosphate)GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTT*G

TRSI-6

(5'-phosphate)GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTT*G

TRSI-7

(5'-phosphate)GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTT*G

TRSI-12

(5'-phosphate)GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTT*G

TPC1

AATGATACGGCGACCACCGA*G

TPC2

CAAGCAGAAGACGGCATACGA*G

RT primer (qPCR)

TATAGAATTCGCGGCCGCTCGCGATAATACGACTCACTATAGGGCGTTTTTTTTTTTTTTTTTTTTTTTT


qPCR, quantiative PCR, WTA, whole-transcript amplification.

*Indicates phosphorothioate bonds

Sasagawa et al. Genome Biology 2013 14:R31   doi:10.1186/gb-2013-14-4-r31

Open Data