Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT1G01370_H3_A_thaliana.fasta (1 sequences, 1000 bp, 38.8% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-7|M00453 V$IRF7_01 IRF-7| 2.26 E2F|M00516 E2F V$E2F_03| 1.31 HiNF-D|HiNF-D| 0.632 HEX|Hexamer| 0.505 IRF-1|M00747 IRF1| 0.177 NEG|Negative element| -0.335 TBP|M00713 TBP F$TBP_Q6| -0.44 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.607 SPT10|Spt10p| -0.694 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -1.01 Oct-1|M00138 V$OCT1_04 Oct-1| -1.01 TATA_box|M00252 TATA V$TATA_01| -1.64 GC_box|M00255 GC box V$GC_01| -1.86 AACCCT_box|AACCCT S. pombe| -1.97 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT1G01370_H3_A_thaliana ref|NC_003070.5|chr1:1-30432563:143447-144446 Arabidopsis thaliana chromosome 1, complete sequence E2F|M00516 E2F V$E2F_03| 160 - 171 - tcgagcgggaaa 8.13 IRF-7|M00453 V$IRF7_01 IRF-7| 165 - 182 + cgggaaagtaaaagttcc 9.02 SPT10|Spt10p| 189 - 209 + atcttctaatcttttcgtatc 6.75 E2F|M00516 E2F V$E2F_03| 208 - 219 + tctagcgggaaa 6.04 E2F|M00516 E2F V$E2F_03| 208 - 219 - tctagcgggaaa 8.05 IRF-7|M00453 V$IRF7_01 IRF-7| 231 - 248 - gtgactttcataatcgca 6.17 IRF-1|M00747 IRF1| 260 - 266 + ttctctt 6.14 IRF-7|M00453 V$IRF7_01 IRF-7| 269 - 286 - ccgattttacgattcctc 6.63 IRF-1|M00747 IRF1| 395 - 401 + ttctctt 6.14 IRF-7|M00453 V$IRF7_01 IRF-7| 462 - 479 - ctagatttcgaatctgaa 6.65 IRF-7|M00453 V$IRF7_01 IRF-7| 468 - 485 + ttcgaatctgaaatttgt 8.68 IRF-7|M00453 V$IRF7_01 IRF-7| 605 - 622 + atcgaaattgaagacccc 7.39 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 621 - 631 + ccgacaaggag 6.74 HiNF-D|HiNF-D| 624 - 639 + acaaggagaggcggtg 7.57 TBP|M00713 TBP F$TBP_Q6| 670 - 678 + tttttatat 6.54 HEX|Hexamer| 681 - 686 - gaagtc 6.98 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT1G07660_H4_A_thaliana.fasta (1 sequences, 1000 bp, 37.1% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score HEX|Hexamer| 0.28 IRF-1|M00747 IRF1| -0.0731 TBP|M00713 TBP F$TBP_Q6| -0.569 NEG|Negative element| -0.635 HiNF-D|HiNF-D| -0.729 Oct-1|M00138 V$OCT1_04 Oct-1| -0.846 TATA_box|M00252 TATA V$TATA_01| -1.1 IRF-7|M00453 V$IRF7_01 IRF-7| -1.32 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -1.8 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.91 E2F|M00516 E2F V$E2F_03| -2.34 SPT10|Spt10p| -2.72 AACCCT_box|AACCCT S. pombe| -3.12 GC_box|M00255 GC box V$GC_01| -4.17 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT1G07660_H4_A_thaliana ref|NC_003070.5|chr1:1-30432563:2368210-2369209 Arabidopsis thaliana chromosome 1, complete sequence IRF-1|M00747 IRF1| 695 - 701 - aacagaa 6.51 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT1G07790_H2B_A_thaliana.fasta (1 sequences, 1000 bp, 35.5% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score TATA_box|M00252 TATA V$TATA_01| 1.55 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 0.777 IRF-7|M00453 V$IRF7_01 IRF-7| 0.694 IRF-1|M00747 IRF1| 0.547 HEX|Hexamer| 0.0905 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.0223 TBP|M00713 TBP F$TBP_Q6| -0.0104 HiNF-D|HiNF-D| -0.427 E2F|M00516 E2F V$E2F_03| -0.525 Oct-1|M00138 V$OCT1_04 Oct-1| -0.595 NEG|Negative element| -0.676 SPT10|Spt10p| -1.93 GC_box|M00255 GC box V$GC_01| -3.87 AACCCT_box|AACCCT S. pombe| -4.93 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT1G07790_H2B_A_thaliana ref|NC_003070.5|chr1:1-30432563:2412122-2413121 Arabidopsis thaliana chromosome 1, complete sequence TBP|M00713 TBP F$TBP_Q6| 241 - 249 + cacttatag 6.11 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 516 - 526 - ctcagtgacgg 6.79 TATA_box|M00252 TATA V$TATA_01| 572 - 586 - tatcgctttttatac 9.11 IRF-1|M00747 IRF1| 639 - 645 + ttcattt 6.83 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 646 - 657 + caggcccaatgg 6.06 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 668 - 679 + cacgaccattga 6.85 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 764 - 774 + taacgaatgag 6.34 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 807 - 818 + tctatccaatag 6.13 IRF-7|M00453 V$IRF7_01 IRF-7| 883 - 900 - atcaacttccttttcccg 8.17 E2F|M00516 E2F V$E2F_03| 894 - 905 - tttcccgagaaa 6.19 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 965 - 975 + ccgccgctgag 7.83 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT1G07820_H4_A_thaliana.fasta (1 sequences, 1000 bp, 39.6% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-7|M00453 V$IRF7_01 IRF-7| 1.28 IRF-1|M00747 IRF1| 0.825 HEX|Hexamer| 0.199 NEG|Negative element| 0.119 HiNF-D|HiNF-D| 0.08 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.00868 TBP|M00713 TBP F$TBP_Q6| -0.0738 E2F|M00516 E2F V$E2F_03| -0.116 SPT10|Spt10p| -0.552 TATA_box|M00252 TATA V$TATA_01| -0.624 Oct-1|M00138 V$OCT1_04 Oct-1| -0.739 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.54 AACCCT_box|AACCCT S. pombe| -2.96 GC_box|M00255 GC box V$GC_01| -4.67 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT1G07820_H4_A_thaliana ref|NC_003070.5|chr1:1-30432563:2421743-2422742 Arabidopsis thaliana chromosome 1, complete sequence HiNF-D|HiNF-D| 111 - 126 - cgaggcagctgctgct 6.12 E2F|M00516 E2F V$E2F_03| 142 - 153 - gatcgcgccgat 6.21 E2F|M00516 E2F V$E2F_03| 171 - 182 - cctcccgacaaa 6.11 NEG|Negative element| 214 - 228 - tcctttgagcttgca 6.19 IRF-1|M00747 IRF1| 261 - 267 - aagagaa 6.59 IRF-7|M00453 V$IRF7_01 IRF-7| 262 - 279 + agagaaatcgagattgga 6.08 SPT10|Spt10p| 456 - 476 + cctctctcaacgtttctccga 6.92 NEG|Negative element| 501 - 515 - aacttttagggccca 6.25 IRF-7|M00453 V$IRF7_01 IRF-7| 551 - 568 - ccaggtttcattttctct 8.59 IRF-1|M00747 IRF1| 557 - 563 + ttcattt 6.48 IRF-1|M00747 IRF1| 563 - 569 + ttctctt 6.88 IRF-7|M00453 V$IRF7_01 IRF-7| 604 - 621 + ttggaagacgaatgctgt 6.01 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 709 - 720 + tataaccattgg 6.16 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 714 - 725 - ccattggatcag 6.78 TATA_box|M00252 TATA V$TATA_01| 762 - 776 - cgcagttttatatat 6.35 TBP|M00713 TBP F$TBP_Q6| 766 - 774 + gttttatat 6.45 NEG|Negative element| 903 - 917 - gaaatctagcgtttc 6.42 IRF-1|M00747 IRF1| 915 - 921 + ttctgtt 6.25 IRF-1|M00747 IRF1| 948 - 954 + ttctgtt 6.25 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT1G08170_H2B_A_thaliana.fasta (1 sequences, 1000 bp, 39.2% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score TBP|M00713 TBP F$TBP_Q6| 1.02 NEG|Negative element| 0.973 E2F|M00516 E2F V$E2F_03| 0.49 TATA_box|M00252 TATA V$TATA_01| 0.332 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.013 IRF-7|M00453 V$IRF7_01 IRF-7| -0.0832 IRF-1|M00747 IRF1| -0.353 HiNF-D|HiNF-D| -0.365 HEX|Hexamer| -0.461 Oct-1|M00138 V$OCT1_04 Oct-1| -0.98 AACCCT_box|AACCCT S. pombe| -1.36 GC_box|M00255 GC box V$GC_01| -1.81 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.1 SPT10|Spt10p| -2.12 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT1G08170_H2B_A_thaliana ref|NC_003070.5|chr1:1-30432563:2563348-2564347 Arabidopsis thaliana chromosome 1, complete sequence TBP|M00713 TBP F$TBP_Q6| 83 - 91 + tctttatat 7.73 NEG|Negative element| 169 - 183 - gttttttagcgatca 7.34 NEG|Negative element| 184 - 198 - gataattagcggcca 7.99 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 191 - 202 + agcggccagtcc 6.49 IRF-7|M00453 V$IRF7_01 IRF-7| 205 - 222 - acatgtttcaaatttgta 6.9 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 309 - 320 - cgtttggtcaca 6.87 TATA_box|M00252 TATA V$TATA_01| 431 - 445 - taagcccatttatat 6.58 TATA_box|M00252 TATA V$TATA_01| 433 - 447 - agcccatttatatgc 6.15 TBP|M00713 TBP F$TBP_Q6| 437 - 445 + catttatat 7.47 TATA_box|M00252 TATA V$TATA_01| 624 - 638 - acgccctttttaaat 6.6 E2F|M00516 E2F V$E2F_03| 678 - 689 + tatggcgccgag 7.51 E2F|M00516 E2F V$E2F_03| 678 - 689 - tatggcgccgag 6.99 AACCCT_box|AACCCT S. pombe| 913 - 935 - accaccgttaagattccggtgga 6.08 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT1G08880_H2A_A_thaliana.fasta (1 sequences, 1000 bp, 34.7% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score HiNF-D|HiNF-D| 2.74 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 2.14 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1.75 IRF-1|M00747 IRF1| 0.431 HEX|Hexamer| 0.037 TBP|M00713 TBP F$TBP_Q6| -0.299 IRF-7|M00453 V$IRF7_01 IRF-7| -0.466 Oct-1|M00138 V$OCT1_04 Oct-1| -0.514 TATA_box|M00252 TATA V$TATA_01| -0.69 NEG|Negative element| -0.967 SPT10|Spt10p| -1.28 GC_box|M00255 GC box V$GC_01| -2.91 AACCCT_box|AACCCT S. pombe| -3.63 E2F|M00516 E2F V$E2F_03| -3.81 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT1G08880_H2A_A_thaliana ref|NC_003070.5|chr1:1-30432563:2847649-2848648 Arabidopsis thaliana chromosome 1, complete sequence IRF-7|M00453 V$IRF7_01 IRF-7| 108 - 125 + aaagaaaaggaaagagtg 6.06 HiNF-D|HiNF-D| 153 - 168 + aacgaaagagccagtg 7.47 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 158 - 169 + aagagccagtga 7.26 HiNF-D|HiNF-D| 165 - 180 + agtgacagcgacggag 10.2 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 361 - 371 - ctcattggtcg 9.66 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 362 - 373 - tcattggtcgtg 9.17 IRF-1|M00747 IRF1| 907 - 913 + ttctctt 6.88 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT1G09200_H3_A_thaliana.fasta (1 sequences, 1000 bp, 36% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-1|M00747 IRF1| 1.02 IRF-7|M00453 V$IRF7_01 IRF-7| 0.556 HEX|Hexamer| 0.465 NEG|Negative element| 0.0753 TBP|M00713 TBP F$TBP_Q6| -0.159 TATA_box|M00252 TATA V$TATA_01| -0.354 HiNF-D|HiNF-D| -0.522 E2F|M00516 E2F V$E2F_03| -0.56 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.652 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.665 Oct-1|M00138 V$OCT1_04 Oct-1| -0.798 GC_box|M00255 GC box V$GC_01| -1.74 SPT10|Spt10p| -3.02 AACCCT_box|AACCCT S. pombe| -4.35 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT1G09200_H3_A_thaliana ref|NC_003070.5|chr1:1-30432563:2972134-2973133 Arabidopsis thaliana chromosome 1, complete sequence IRF-1|M00747 IRF1| 105 - 111 + ttctctt 6.47 E2F|M00516 E2F V$E2F_03| 140 - 151 - atgtccgccaaa 6.63 IRF-7|M00453 V$IRF7_01 IRF-7| 300 - 317 - atgtctttcactttccaa 7.75 IRF-1|M00747 IRF1| 306 - 312 + ttcactt 7.4 IRF-1|M00747 IRF1| 352 - 358 + ttcactt 7.4 HiNF-D|HiNF-D| 431 - 446 + aacgctagagaacgaa 6.06 HEX|Hexamer| 519 - 524 - gaagtc 7.06 TATA_box|M00252 TATA V$TATA_01| 565 - 579 + gtatttaagcccaga 6.62 TBP|M00713 TBP F$TBP_Q6| 798 - 806 + ctcttatat 6.5 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 816 - 827 + aaaaaccaatga 6.52 NEG|Negative element| 895 - 909 + cagacgataaatatc 7.02 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT1G13370_H3_A_thaliana.fasta (1 sequences, 1000 bp, 35% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score HiNF-D|HiNF-D| 1.88 Oct-1|M00138 V$OCT1_04 Oct-1| 1.85 TBP|M00713 TBP F$TBP_Q6| 0.5 TATA_box|M00252 TATA V$TATA_01| 0.361 HEX|Hexamer| -0.184 IRF-1|M00747 IRF1| -0.25 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.419 E2F|M00516 E2F V$E2F_03| -0.613 IRF-7|M00453 V$IRF7_01 IRF-7| -0.699 NEG|Negative element| -0.904 GC_box|M00255 GC box V$GC_01| -1.95 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.09 SPT10|Spt10p| -3.33 AACCCT_box|AACCCT S. pombe| -3.49 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT1G13370_H3_A_thaliana ref|NC_003070.5|chr1:1-30432563:4588519-4589518 Arabidopsis thaliana chromosome 1, complete sequence Oct-1|M00138 V$OCT1_04 Oct-1| 17 - 39 + attttgatattcaaatttgacaa 6.07 HiNF-D|HiNF-D| 79 - 94 + agcaggagcgaccaag 8.39 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 85 - 96 + agcgaccaagaa 6.06 TATA_box|M00252 TATA V$TATA_01| 171 - 185 - gtgcagtctttatag 6.88 TBP|M00713 TBP F$TBP_Q6| 177 - 185 + tctttatag 6.26 HiNF-D|HiNF-D| 232 - 247 - gtccgtctcttcgccg 8.85 E2F|M00516 E2F V$E2F_03| 286 - 297 + tatggcgggtta 6.69 Oct-1|M00138 V$OCT1_04 Oct-1| 288 - 310 - tggcgggttatgcataaatgtca 8.1 Oct-1|M00138 V$OCT1_04 Oct-1| 289 - 311 + ggcgggttatgcataaatgtcaa 6.65 TBP|M00713 TBP F$TBP_Q6| 390 - 398 + ctcttatat 6.31 TATA_box|M00252 TATA V$TATA_01| 585 - 599 - tgggcctatttaaac 7.07 TBP|M00713 TBP F$TBP_Q6| 628 - 636 - atataaagc 6.39 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 729 - 740 + atggaccaataa 6.44 IRF-7|M00453 V$IRF7_01 IRF-7| 743 - 760 + atcgaaagcgcagatcgc 6.05 HiNF-D|HiNF-D| 748 - 763 + aagcgcagatcgccac 6.19 Oct-1|M00138 V$OCT1_04 Oct-1| 757 - 779 - tcgccacatatgcataatcttaa 8.76 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT1G19890.1_H3_A_thaliana.fasta (1 sequences, 1000 bp, 28.8% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score CCAAT_box|M00254 V$CAAT_01 CCAAT box| 2.39 IRF-1|M00747 IRF1| 1.18 HiNF-D|HiNF-D| 0.649 Oct-1|M00138 V$OCT1_04 Oct-1| 0.343 TATA_box|M00252 TATA V$TATA_01| 0.243 TBP|M00713 TBP F$TBP_Q6| 0.185 HEX|Hexamer| -0.253 NEG|Negative element| -0.471 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.02 IRF-7|M00453 V$IRF7_01 IRF-7| -1.5 E2F|M00516 E2F V$E2F_03| -2.57 GC_box|M00255 GC box V$GC_01| -3.57 SPT10|Spt10p| -3.87 AACCCT_box|AACCCT S. pombe| -4.8 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT1G19890.1_H3_A_thaliana ref|NC_003070.5|chr1:1-30432563:6904026-6905025 Arabidopsis thaliana chromosome 1, complete sequence TATA_box|M00252 TATA V$TATA_01| 62 - 76 + atataaaaagaggga 7.42 Oct-1|M00138 V$OCT1_04 Oct-1| 109 - 131 - accaagaatatacatatttcttt 6.4 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 153 - 164 - tcattgggtctt 6.14 IRF-1|M00747 IRF1| 366 - 372 - aagtgaa 7.48 TBP|M00713 TBP F$TBP_Q6| 488 - 496 - atataaatg 6.33 IRF-1|M00747 IRF1| 536 - 542 - aactgaa 6.83 Oct-1|M00138 V$OCT1_04 Oct-1| 545 - 567 + agacaagtatggaaaacaataga 6.99 HiNF-D|HiNF-D| 701 - 716 + aggcccactggcccag 7.18 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 705 - 716 - ccactggcccag 9.94 HiNF-D|HiNF-D| 709 - 724 + tggcccagagcgagac 6.33 HiNF-D|HiNF-D| 711 - 726 + gcccagagcgagacaa 6.5 NEG|Negative element| 782 - 796 - gactttgaggatctc 6.29 TBP|M00713 TBP F$TBP_Q6| 895 - 903 - atataagtg 6.51 IRF-1|M00747 IRF1| 899 - 905 - aagtgaa 7.48 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT1G19890.2_H3_A_thaliana.fasta (1 sequences, 1000 bp, 33.9% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score HiNF-D|HiNF-D| 1.73 IRF-1|M00747 IRF1| 1.38 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1.13 TBP|M00713 TBP F$TBP_Q6| 0.635 Oct-1|M00138 V$OCT1_04 Oct-1| -0.0716 HEX|Hexamer| -0.0825 TATA_box|M00252 TATA V$TATA_01| -0.312 NEG|Negative element| -0.613 IRF-7|M00453 V$IRF7_01 IRF-7| -0.731 SPT10|Spt10p| -1.73 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.77 E2F|M00516 E2F V$E2F_03| -2.21 GC_box|M00255 GC box V$GC_01| -3.93 AACCCT_box|AACCCT S. pombe| -4.09 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT1G19890.2_H3_A_thaliana ref|NC_003070.5|chr1:1-30432563:6904391-6905390 Arabidopsis thaliana chromosome 1, complete sequence IRF-1|M00747 IRF1| 1 - 7 - aagtgaa 7.45 TATA_box|M00252 TATA V$TATA_01| 59 - 73 - ttgatgtttttatac 6.31 TBP|M00713 TBP F$TBP_Q6| 123 - 131 - atataaatg 6.71 IRF-1|M00747 IRF1| 171 - 177 - aactgaa 6.8 Oct-1|M00138 V$OCT1_04 Oct-1| 180 - 202 + agacaagtatggaaaacaataga 6.79 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 340 - 351 - ccactggcccag 8.67 TBP|M00713 TBP F$TBP_Q6| 530 - 538 - atataagtg 6.68 IRF-1|M00747 IRF1| 534 - 540 - aagtgaa 7.45 TBP|M00713 TBP F$TBP_Q6| 709 - 717 + tctttatat 7.04 IRF-1|M00747 IRF1| 806 - 812 + ttctgtt 6.12 HiNF-D|HiNF-D| 869 - 884 - caccgtttccgtcctg 6.52 HiNF-D|HiNF-D| 886 - 901 - aaccgtcgctcttcgg 9.07 IRF-1|M00747 IRF1| 907 - 913 + ttctctt 6.76 IRF-1|M00747 IRF1| 914 - 920 + ttctctt 6.76 IRF-1|M00747 IRF1| 920 - 926 + ttctgtt 6.12 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT1G19890_H3_A_thaliana.fasta (1 sequences, 1000 bp, 36.7% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-1|M00747 IRF1| 1.17 HiNF-D|HiNF-D| 1.08 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.491 TBP|M00713 TBP F$TBP_Q6| 0.437 HEX|Hexamer| 0.218 Oct-1|M00138 V$OCT1_04 Oct-1| 0.0876 IRF-7|M00453 V$IRF7_01 IRF-7| -0.347 NEG|Negative element| -0.665 TATA_box|M00252 TATA V$TATA_01| -0.749 SPT10|Spt10p| -1.53 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.88 E2F|M00516 E2F V$E2F_03| -2.44 AACCCT_box|AACCCT S. pombe| -4.24 GC_box|M00255 GC box V$GC_01| -4.36 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT1G19890_H3_A_thaliana ref|NC_003070.5|chr1:1-30432563:6904542-6905541 Arabidopsis thaliana chromosome 1, complete sequence IRF-1|M00747 IRF1| 20 - 26 - aactgaa 6.94 Oct-1|M00138 V$OCT1_04 Oct-1| 29 - 51 + agacaagtatggaaaacaataga 7.36 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 189 - 200 - ccactggcccag 7.99 TBP|M00713 TBP F$TBP_Q6| 379 - 387 - atataagtg 6.94 IRF-1|M00747 IRF1| 383 - 389 - aagtgaa 7.69 TBP|M00713 TBP F$TBP_Q6| 558 - 566 + tctttatat 7.13 IRF-1|M00747 IRF1| 655 - 661 + ttctgtt 6.03 HiNF-D|HiNF-D| 735 - 750 - aaccgtcgctcttcgg 8.4 IRF-1|M00747 IRF1| 756 - 762 + ttctctt 6.58 IRF-1|M00747 IRF1| 763 - 769 + ttctctt 6.58 IRF-1|M00747 IRF1| 769 - 775 + ttctgtt 6.03 IRF-7|M00453 V$IRF7_01 IRF-7| 888 - 905 - cgcaaattgcctttccaa 6.19 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT1G51060_H2A_A_thaliana.fasta (1 sequences, 1000 bp, 31.6% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-7|M00453 V$IRF7_01 IRF-7| 0.934 IRF-1|M00747 IRF1| 0.688 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.378 TATA_box|M00252 TATA V$TATA_01| -0.0638 TBP|M00713 TBP F$TBP_Q6| -0.179 HEX|Hexamer| -0.252 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.464 Oct-1|M00138 V$OCT1_04 Oct-1| -0.529 HiNF-D|HiNF-D| -0.757 NEG|Negative element| -1.09 SPT10|Spt10p| -1.71 E2F|M00516 E2F V$E2F_03| -2.04 GC_box|M00255 GC box V$GC_01| -3.6 AACCCT_box|AACCCT S. pombe| -4.69 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT1G51060_H2A_A_thaliana ref|NC_003070.5|chr1:1-30432563:18929617-18930616 Arabidopsis thaliana chromosome 1, complete sequence IRF-1|M00747 IRF1| 160 - 166 + ttctctt 7.32 IRF-1|M00747 IRF1| 427 - 433 - aactgaa 6.47 IRF-7|M00453 V$IRF7_01 IRF-7| 526 - 543 + gggagattcgaaatttcc 7.86 IRF-7|M00453 V$IRF7_01 IRF-7| 669 - 686 - cccggattcaatttttga 7.59 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 715 - 726 - cgtttgggccga 6.19 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 870 - 880 - cttattggtta 6.81 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 871 - 882 - ttattggttaag 7.75 TATA_box|M00252 TATA V$TATA_01| 897 - 911 + gtatataaactctgg 7.35 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT1G52740_H2A_A_thaliana.fasta (1 sequences, 1000 bp, 37.9% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score E2F|M00516 E2F V$E2F_03| 3.25 NEG|Negative element| 0.967 IRF-7|M00453 V$IRF7_01 IRF-7| 0.61 HiNF-D|HiNF-D| 0.514 HEX|Hexamer| 0.168 IRF-1|M00747 IRF1| 0.0958 Oct-1|M00138 V$OCT1_04 Oct-1| -0.0561 TBP|M00713 TBP F$TBP_Q6| -0.621 TATA_box|M00252 TATA V$TATA_01| -0.707 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.44 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -2.08 SPT10|Spt10p| -3.18 GC_box|M00255 GC box V$GC_01| -3.59 AACCCT_box|AACCCT S. pombe| -3.61 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT1G52740_H2A_A_thaliana ref|NC_003070.5|chr1:1-30432563:19648588-19649587 Arabidopsis thaliana chromosome 1, complete sequence NEG|Negative element| 62 - 76 - taaactgagcgtaca 8.15 TATA_box|M00252 TATA V$TATA_01| 72 - 86 + gtacaaaaagcctct 6.61 Oct-1|M00138 V$OCT1_04 Oct-1| 129 - 151 + gaatgattatacagagaaaacaa 6.62 HiNF-D|HiNF-D| 160 - 175 - ctccctctcttctttt 6.03 Oct-1|M00138 V$OCT1_04 Oct-1| 165 - 187 - tctcttcttttgaatcaaaacat 6.05 IRF-1|M00747 IRF1| 442 - 448 + ttctctt 6.27 NEG|Negative element| 474 - 488 - gatatttggcgggaa 6.33 E2F|M00516 E2F V$E2F_03| 478 - 489 + tttggcgggaaa 10.7 E2F|M00516 E2F V$E2F_03| 478 - 489 - tttggcgggaaa 8.88 HiNF-D|HiNF-D| 526 - 541 + aaacccagcggtagcg 6.68 HiNF-D|HiNF-D| 532 - 547 + agcggtagcgacaagg 6.84 IRF-7|M00453 V$IRF7_01 IRF-7| 645 - 662 + ttgggaatcgaaatggtc 7.61 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT1G54690_H2A_A_thaliana.fasta (1 sequences, 1000 bp, 34.1% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score AACCCT_box|AACCCT S. pombe| 1.89 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.982 HiNF-D|HiNF-D| 0.944 HEX|Hexamer| 0.00507 IRF-1|M00747 IRF1| -0.504 Oct-1|M00138 V$OCT1_04 Oct-1| -0.538 NEG|Negative element| -0.541 E2F|M00516 E2F V$E2F_03| -0.661 TBP|M00713 TBP F$TBP_Q6| -0.668 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.853 TATA_box|M00252 TATA V$TATA_01| -1.01 IRF-7|M00453 V$IRF7_01 IRF-7| -1.21 SPT10|Spt10p| -4.19 GC_box|M00255 GC box V$GC_01| -4.65 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT1G54690_H2A_A_thaliana ref|NC_003070.5|chr1:1-30432563:20418843-20419842 Arabidopsis thaliana chromosome 1, complete sequence AACCCT_box|AACCCT S. pombe| 673 - 695 - aaccgaattatagttttggtgca 7.39 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 827 - 838 + actaaccaatca 8.5 AACCCT_box|AACCCT S. pombe| 869 - 891 + gaaatcacaacctaaaccctaaa 9.32 HiNF-D|HiNF-D| 973 - 988 + agttccggcgccggca 6.15 HiNF-D|HiNF-D| 975 - 990 - ttccggcgccggcagt 7.96 E2F|M00516 E2F V$E2F_03| 976 - 987 + tccggcgccggc 6.06 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT1G75600_H3_A_thaliana.fasta (1 sequences, 1000 bp, 37.6% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score HiNF-D|HiNF-D| 1.29 SPT10|Spt10p| 0.909 HEX|Hexamer| 0.46 IRF-1|M00747 IRF1| 0.188 TBP|M00713 TBP F$TBP_Q6| 0.147 Oct-1|M00138 V$OCT1_04 Oct-1| -0.097 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.313 NEG|Negative element| -0.384 IRF-7|M00453 V$IRF7_01 IRF-7| -0.734 TATA_box|M00252 TATA V$TATA_01| -1.22 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.28 E2F|M00516 E2F V$E2F_03| -2.6 GC_box|M00255 GC box V$GC_01| -3.05 AACCCT_box|AACCCT S. pombe| -5.62 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT1G75600_H3_A_thaliana ref|NC_003070.5|chr1:1-30432563:28393753-28394752 Arabidopsis thaliana chromosome 1, complete sequence TBP|M00713 TBP F$TBP_Q6| 103 - 111 + tccttatat 6.67 TBP|M00713 TBP F$TBP_Q6| 114 - 122 + gttttatat 6.16 Oct-1|M00138 V$OCT1_04 Oct-1| 203 - 225 - gggaagaacttgcatatgtgttt 7.08 TBP|M00713 TBP F$TBP_Q6| 307 - 315 - atataagtc 6.05 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 377 - 388 + ttggaccaataa 6.39 IRF-1|M00747 IRF1| 551 - 557 + ttcactt 7.28 SPT10|Spt10p| 699 - 719 - gaggaaaagctccgaggactc 7.18 HiNF-D|HiNF-D| 700 - 715 + aggaaaagctccgagg 7.59 IRF-7|M00453 V$IRF7_01 IRF-7| 749 - 766 - cttagttttgaatttgta 6.31 SPT10|Spt10p| 826 - 846 - ggcgaggaaatctgcgccgac 7.95 HiNF-D|HiNF-D| 886 - 901 - aaccgtcgctcttcgg 8.08 SPT10|Spt10p| 894 - 914 + ctcttcggtaagtttcacgat 6.27 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT2G28720_H2B_A_thaliana.fasta (1 sequences, 1000 bp, 35.9% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 1.43 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.279 IRF-1|M00747 IRF1| 0.184 HEX|Hexamer| -0.0809 HiNF-D|HiNF-D| -0.27 TATA_box|M00252 TATA V$TATA_01| -0.507 Oct-1|M00138 V$OCT1_04 Oct-1| -0.561 IRF-7|M00453 V$IRF7_01 IRF-7| -0.582 E2F|M00516 E2F V$E2F_03| -0.789 TBP|M00713 TBP F$TBP_Q6| -0.962 NEG|Negative element| -1.23 SPT10|Spt10p| -1.59 GC_box|M00255 GC box V$GC_01| -4.54 AACCCT_box|AACCCT S. pombe| -4.87 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT2G28720_H2B_A_thaliana ref|NC_003071.3|chr2:1-19705359:12333217-12334216 Arabidopsis thaliana chromosome 2, complete sequence Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 408 - 418 + ccgacaatgag 8.95 HiNF-D|HiNF-D| 555 - 570 - gtccggacctagtccg 6.3 TATA_box|M00252 TATA V$TATA_01| 591 - 605 + atttataagcccagg 6.46 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 787 - 798 + ctcatccaatca 7.72 E2F|M00516 E2F V$E2F_03| 883 - 894 - tttcccgagaaa 6.19 IRF-1|M00747 IRF1| 968 - 974 - aagagaa 6.74 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT2G28740_H4_A_thaliana.fasta (1 sequences, 1000 bp, 30.7% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-1|M00747 IRF1| 0.838 NEG|Negative element| 0.322 TBP|M00713 TBP F$TBP_Q6| 0.00581 HEX|Hexamer| -0.281 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.455 TATA_box|M00252 TATA V$TATA_01| -0.693 Oct-1|M00138 V$OCT1_04 Oct-1| -0.846 HiNF-D|HiNF-D| -0.884 E2F|M00516 E2F V$E2F_03| -1.64 IRF-7|M00453 V$IRF7_01 IRF-7| -1.64 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -2.46 SPT10|Spt10p| -3.26 AACCCT_box|AACCCT S. pombe| -3.74 GC_box|M00255 GC box V$GC_01| -5.08 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT2G28740_H4_A_thaliana ref|NC_003071.3|chr2:1-19705359:12337031-12338030 Arabidopsis thaliana chromosome 2, complete sequence IRF-1|M00747 IRF1| 83 - 89 + ttcactt 7.42 NEG|Negative element| 247 - 261 + ttggagctcaagggc 7.4 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 253 - 263 - ctcaagggctt 6.91 IRF-1|M00747 IRF1| 279 - 285 + ttcagtt 7.12 TBP|M00713 TBP F$TBP_Q6| 495 - 503 + cccttatag 6.41 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT2G37470_H2B_A_thaliana.fasta (1 sequences, 1000 bp, 34.1% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-1|M00747 IRF1| 1.13 TBP|M00713 TBP F$TBP_Q6| -0.16 NEG|Negative element| -0.249 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.251 HEX|Hexamer| -0.265 Oct-1|M00138 V$OCT1_04 Oct-1| -0.266 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.591 TATA_box|M00252 TATA V$TATA_01| -0.827 IRF-7|M00453 V$IRF7_01 IRF-7| -1 HiNF-D|HiNF-D| -1.32 E2F|M00516 E2F V$E2F_03| -2.06 AACCCT_box|AACCCT S. pombe| -2.36 SPT10|Spt10p| -3.61 GC_box|M00255 GC box V$GC_01| -3.84 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT2G37470_H2B_A_thaliana ref|NC_003071.3|chr2:1-19705359:15742917-15743916 Arabidopsis thaliana chromosome 2, complete sequence IRF-1|M00747 IRF1| 160 - 166 - aagagaa 6.01 Oct-1|M00138 V$OCT1_04 Oct-1| 357 - 379 - acgcgatatttccagattcccac 6.54 IRF-1|M00747 IRF1| 527 - 533 + ttcactt 7.95 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 544 - 555 - tgaatggtccat 7.15 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 650 - 660 - ctcgttggcaa 6.72 IRF-1|M00747 IRF1| 678 - 684 - aagtgaa 7.27 NEG|Negative element| 707 - 721 - ggccttgagctataa 6.22 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT2G38810_H2A_A_thaliana.fasta (1 sequences, 1000 bp, 36.6% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1.63 Oct-1|M00138 V$OCT1_04 Oct-1| 1.59 IRF-1|M00747 IRF1| 0.839 NEG|Negative element| 0.458 HEX|Hexamer| 0.316 IRF-7|M00453 V$IRF7_01 IRF-7| -0.0858 TBP|M00713 TBP F$TBP_Q6| -0.188 HiNF-D|HiNF-D| -0.194 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.5 TATA_box|M00252 TATA V$TATA_01| -1.73 AACCCT_box|AACCCT S. pombe| -2.14 SPT10|Spt10p| -2.24 GC_box|M00255 GC box V$GC_01| -2.83 E2F|M00516 E2F V$E2F_03| -3.36 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT2G38810_H2A_A_thaliana ref|NC_003071.3|chr2:1-19705359:16226821-16227820 Arabidopsis thaliana chromosome 2, complete sequence IRF-7|M00453 V$IRF7_01 IRF-7| 96 - 113 + tgcgaagacgacggcagc 6.44 HEX|Hexamer| 141 - 146 - gaaatc 6.06 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 212 - 223 - cgagtggctcgg 7.62 NEG|Negative element| 608 - 622 - gatactgagccttaa 7.7 IRF-7|M00453 V$IRF7_01 IRF-7| 658 - 675 + ctggaaatctaagccaaa 6.29 HEX|Hexamer| 661 - 666 - gaaatc 6.06 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 666 - 677 + ctaagccaaaca 8.97 TBP|M00713 TBP F$TBP_Q6| 757 - 765 + tacttatat 6.57 IRF-1|M00747 IRF1| 838 - 844 - aagtgaa 8.21 Oct-1|M00138 V$OCT1_04 Oct-1| 842 - 864 + gaatgatcaagcaaattaaagga 9.02 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT3G09480_H2B_A_thaliana.fasta (1 sequences, 1000 bp, 43.5% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-1|M00747 IRF1| 1 TATA_box|M00252 TATA V$TATA_01| 0.648 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.477 HEX|Hexamer| 0.353 TBP|M00713 TBP F$TBP_Q6| 0.346 IRF-7|M00453 V$IRF7_01 IRF-7| 0.308 HiNF-D|HiNF-D| 0.133 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.244 Oct-1|M00138 V$OCT1_04 Oct-1| -0.822 AACCCT_box|AACCCT S. pombe| -0.877 NEG|Negative element| -0.976 E2F|M00516 E2F V$E2F_03| -1.02 SPT10|Spt10p| -1.81 GC_box|M00255 GC box V$GC_01| -3.88 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT3G09480_H2B_A_thaliana ref|NC_003074.4|chr3:1-23470805:2915255-2916254 Arabidopsis thaliana chromosome 3, complete sequence AACCCT_box|AACCCT S. pombe| 23 - 45 - tttaggtttagagttgtaatact 6.63 IRF-1|M00747 IRF1| 122 - 128 + ttcactt 8.04 IRF-7|M00453 V$IRF7_01 IRF-7| 239 - 256 - cttaaatttgatttccgt 6.85 HiNF-D|HiNF-D| 340 - 355 - tcgcggcgcgtttgtt 6.27 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 480 - 490 - ctgattggtgt 6.78 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 497 - 508 - tgcttggtctct 6.26 IRF-1|M00747 IRF1| 660 - 666 - aagagaa 6.65 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 865 - 876 + aaaaaccaatca 7.8 TATA_box|M00252 TATA V$TATA_01| 889 - 903 - cacctctatatatat 7.28 TBP|M00713 TBP F$TBP_Q6| 893 - 901 + tctatatat 6.58 TATA_box|M00252 TATA V$TATA_01| 894 - 908 + ctatatatatctcgg 7.27 TBP|M00713 TBP F$TBP_Q6| 895 - 903 + tatatatat 6.49 IRF-7|M00453 V$IRF7_01 IRF-7| 953 - 970 + gcgaaatccgaattttat 6.06 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT3G20670_H2A_A_thaliana.fasta (1 sequences, 1000 bp, 28.9% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score E2F|M00516 E2F V$E2F_03| 1.23 GC_box|M00255 GC box V$GC_01| 0.947 TATA_box|M00252 TATA V$TATA_01| 0.764 Oct-1|M00138 V$OCT1_04 Oct-1| 0.52 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 0.00225 HiNF-D|HiNF-D| -0.171 TBP|M00713 TBP F$TBP_Q6| -0.177 HEX|Hexamer| -0.186 AACCCT_box|AACCCT S. pombe| -0.213 IRF-1|M00747 IRF1| -0.361 NEG|Negative element| -0.466 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.527 IRF-7|M00453 V$IRF7_01 IRF-7| -2.09 SPT10|Spt10p| -4.59 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT3G20670_H2A_A_thaliana ref|NC_003074.4|chr3:1-23470805:7228479-7229478 Arabidopsis thaliana chromosome 3, complete sequence TATA_box|M00252 TATA V$TATA_01| 89 - 103 + gtttaaaaggcgttc 7.53 E2F|M00516 E2F V$E2F_03| 113 - 124 + tttgacgcgaag 8.69 E2F|M00516 E2F V$E2F_03| 113 - 124 - tttgacgcgaag 6.45 NEG|Negative element| 114 - 128 + ttgacgcgaagaagg 6.46 GC_box|M00255 GC box V$GC_01| 123 - 136 + agaaggaggtggct 8.47 TATA_box|M00252 TATA V$TATA_01| 259 - 273 - gctctgcttatatat 6.84 AACCCT_box|AACCCT S. pombe| 748 - 770 + tcaatcccaattctaacaatgaa 7.36 Oct-1|M00138 V$OCT1_04 Oct-1| 778 - 800 + gtataaaaacgtaaattcaagcg 7.58 TATA_box|M00252 TATA V$TATA_01| 778 - 792 + gtataaaaacgtaaa 6.67 Oct-1|M00138 V$OCT1_04 Oct-1| 798 - 820 + gcgtgccaattataaaccgtcga 6.4 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 868 - 879 - ttattggataag 6.25 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 911 - 922 + aataaccaaaga 6.27 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 913 - 923 + taaccaaagag 7.45 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT3G27360_H3_A_thaliana.fasta (1 sequences, 1000 bp, 36.3% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score CCAAT_box|M00254 V$CAAT_01 CCAAT box| 2.27 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 1.28 HEX|Hexamer| 0.387 IRF-1|M00747 IRF1| -0.111 HiNF-D|HiNF-D| -0.253 Oct-1|M00138 V$OCT1_04 Oct-1| -0.356 TATA_box|M00252 TATA V$TATA_01| -0.409 TBP|M00713 TBP F$TBP_Q6| -0.643 NEG|Negative element| -0.757 IRF-7|M00453 V$IRF7_01 IRF-7| -2.11 SPT10|Spt10p| -3.09 E2F|M00516 E2F V$E2F_03| -3.23 AACCCT_box|AACCCT S. pombe| -3.65 GC_box|M00255 GC box V$GC_01| -4.52 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT3G27360_H3_A_thaliana ref|NC_003074.4|chr3:1-23470805:10131106-10132105 Arabidopsis thaliana chromosome 3, complete sequence Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 145 - 155 - ctctttggtta 7.17 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 146 - 157 - tctttggttact 7.23 HiNF-D|HiNF-D| 209 - 224 - tttccgagcttgcggg 6.29 HEX|Hexamer| 232 - 237 - gaagtc 6.94 Oct-1|M00138 V$OCT1_04 Oct-1| 458 - 480 + ttatgttcatgtatgtttgaaga 6.75 IRF-1|M00747 IRF1| 783 - 789 - aactgaa 6.69 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 799 - 809 - ctgattggtta 8.61 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 800 - 811 - tgattggttact 9.76 TATA_box|M00252 TATA V$TATA_01| 900 - 914 + gtataaaaaagcatc 6.92 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT3G45930_H4_A_thaliana.fasta (1 sequences, 1000 bp, 34.4% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score E2F|M00516 E2F V$E2F_03| 2.34 AACCCT_box|AACCCT S. pombe| 0.783 IRF-1|M00747 IRF1| 0.464 TBP|M00713 TBP F$TBP_Q6| 0.385 NEG|Negative element| 0.0638 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.242 HEX|Hexamer| -0.345 Oct-1|M00138 V$OCT1_04 Oct-1| -0.479 HiNF-D|HiNF-D| -0.625 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -1.2 TATA_box|M00252 TATA V$TATA_01| -1.45 IRF-7|M00453 V$IRF7_01 IRF-7| -1.51 SPT10|Spt10p| -2.65 GC_box|M00255 GC box V$GC_01| -4.96 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT3G45930_H4_A_thaliana ref|NC_003074.4|chr3:1-23470805:16893376-16894375 Arabidopsis thaliana chromosome 3, complete sequence Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 136 - 146 + aaaccaacgag 7.03 AACCCT_box|AACCCT S. pombe| 159 - 181 + cccgtgaaaaccctaacatagca 7.51 AACCCT_box|AACCCT S. pombe| 182 - 204 - gaatgggttacatttgtgatcaa 7.74 HiNF-D|HiNF-D| 256 - 271 - cacccactctgtctgg 6.11 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 318 - 329 + aacgaccaaaca 6.09 E2F|M00516 E2F V$E2F_03| 689 - 700 + tttggcgctata 9.91 NEG|Negative element| 690 - 704 + ttggcgctatattcc 6.72 IRF-1|M00747 IRF1| 741 - 747 + ttcactt 7.61 NEG|Negative element| 769 - 783 - aatattaagcgtcga 6.51 TBP|M00713 TBP F$TBP_Q6| 896 - 904 - atataaatg 6.79 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT3G45980_H2B_A_thaliana.fasta (1 sequences, 1000 bp, 32.7% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score Oct-1|M00138 V$OCT1_04 Oct-1| 2.17 E2F|M00516 E2F V$E2F_03| 1.3 IRF-1|M00747 IRF1| 1 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.847 SPT10|Spt10p| 0.534 HiNF-D|HiNF-D| 0.524 TBP|M00713 TBP F$TBP_Q6| 0.148 TATA_box|M00252 TATA V$TATA_01| 0.0539 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.333 HEX|Hexamer| -0.424 NEG|Negative element| -0.74 IRF-7|M00453 V$IRF7_01 IRF-7| -1.49 GC_box|M00255 GC box V$GC_01| -4.74 AACCCT_box|AACCCT S. pombe| -5.74 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT3G45980_H2B_A_thaliana ref|NC_003074.4|chr3:1-23470805:16908866-16909865 Arabidopsis thaliana chromosome 3, complete sequence IRF-1|M00747 IRF1| 34 - 40 + ttcagtt 6.97 IRF-1|M00747 IRF1| 41 - 47 + ttcactt 7.37 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 342 - 353 + tatagccaagca 7.74 Oct-1|M00138 V$OCT1_04 Oct-1| 367 - 389 + tcttgtttatgcaaatacaacaa 9.62 TBP|M00713 TBP F$TBP_Q6| 392 - 400 + tctttatat 6.77 IRF-1|M00747 IRF1| 465 - 471 + ttcagtt 6.97 Oct-1|M00138 V$OCT1_04 Oct-1| 557 - 579 - agttagttttttcataattgtat 6.25 Oct-1|M00138 V$OCT1_04 Oct-1| 661 - 683 + gagcgggaacggagattttaaca 6.56 E2F|M00516 E2F V$E2F_03| 682 - 693 - caccgcgctaaa 8.22 HiNF-D|HiNF-D| 713 - 728 - cgtcatcgatcccgct 6.43 TATA_box|M00252 TATA V$TATA_01| 735 - 749 + gtttataaaccgtcg 6.98 SPT10|Spt10p| 779 - 799 + cccatctcatcgatcctcgtc 6.4 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 807 - 818 + aataaccaatca 7.62 HiNF-D|HiNF-D| 933 - 948 + aacaatggcgccgaga 6.15 E2F|M00516 E2F V$E2F_03| 936 - 947 + aatggcgccgag 6.6 E2F|M00516 E2F V$E2F_03| 936 - 947 - aatggcgccgag 6.94 SPT10|Spt10p| 939 - 959 - ggcgccgagagcagagaagaa 7.85 E2F|M00516 E2F V$E2F_03| 958 - 969 - aagcccgcggag 6.5 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 977 - 987 + cagccgccgag 6.95 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT3G46030_H2B_A_thaliana.fasta (1 sequences, 1000 bp, 37.9% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score HiNF-D|HiNF-D| 0.871 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.433 Oct-1|M00138 V$OCT1_04 Oct-1| 0.339 IRF-1|M00747 IRF1| 0.266 IRF-7|M00453 V$IRF7_01 IRF-7| 0.189 NEG|Negative element| 0.0932 TATA_box|M00252 TATA V$TATA_01| -0.00326 HEX|Hexamer| -0.0746 TBP|M00713 TBP F$TBP_Q6| -0.112 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.79 AACCCT_box|AACCCT S. pombe| -1.26 SPT10|Spt10p| -1.37 E2F|M00516 E2F V$E2F_03| -1.74 GC_box|M00255 GC box V$GC_01| -1.91 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT3G46030_H2B_A_thaliana ref|NC_003074.4|chr3:1-23470805:16924988-16925987 Arabidopsis thaliana chromosome 3, complete sequence IRF-7|M00453 V$IRF7_01 IRF-7| 198 - 215 - aacgaattcgattcccta 7.56 HiNF-D|HiNF-D| 329 - 344 + tagaggagagatggag 6.9 HiNF-D|HiNF-D| 379 - 394 - agccgccgctccgacg 6.48 HiNF-D|HiNF-D| 398 - 413 - cttgctcgcttggcct 7.27 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 404 - 415 - cgcttggccttg 7.39 NEG|Negative element| 443 - 457 - tatttttagggtttt 6.27 NEG|Negative element| 451 - 465 - gggttttcgctttta 6.25 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 552 - 563 + tgtaaccaaaca 6.45 IRF-1|M00747 IRF1| 590 - 596 + ttctctt 6.98 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 695 - 706 - ttaatggcccat 6.1 NEG|Negative element| 727 - 741 + tagccgttcactgcc 6.39 Oct-1|M00138 V$OCT1_04 Oct-1| 746 - 768 + acggatttattctaatctaacgg 7.51 TATA_box|M00252 TATA V$TATA_01| 834 - 848 - tggtcatatatatac 6.07 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT3G46320_H4_A_thaliana.fasta (1 sequences, 1000 bp, 34.2% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score E2F|M00516 E2F V$E2F_03| 2.32 TBP|M00713 TBP F$TBP_Q6| 0.967 AACCCT_box|AACCCT S. pombe| 0.819 IRF-1|M00747 IRF1| 0.428 NEG|Negative element| 0.0787 Oct-1|M00138 V$OCT1_04 Oct-1| -0.118 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.19 HEX|Hexamer| -0.337 HiNF-D|HiNF-D| -0.613 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -1.18 TATA_box|M00252 TATA V$TATA_01| -1.35 IRF-7|M00453 V$IRF7_01 IRF-7| -1.45 SPT10|Spt10p| -2.58 GC_box|M00255 GC box V$GC_01| -4.97 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT3G46320_H4_A_thaliana ref|NC_003074.4|chr3:1-23470805:17031339-17032338 Arabidopsis thaliana chromosome 3, complete sequence Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 122 - 132 + aaaccaacgag 7.11 AACCCT_box|AACCCT S. pombe| 145 - 167 + cccgtgaaaaccctaacatagca 7.58 AACCCT_box|AACCCT S. pombe| 168 - 190 - gaatgggttacatttgtgatcaa 7.75 HiNF-D|HiNF-D| 242 - 257 - cacccactctgtctgg 6.1 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 304 - 315 + aacgaccaaaca 6.17 E2F|M00516 E2F V$E2F_03| 689 - 700 + tttggcgctata 9.88 NEG|Negative element| 690 - 704 + ttggcgctatattcc 6.68 Oct-1|M00138 V$OCT1_04 Oct-1| 721 - 743 - atttgaaattttcataaactttc 6.22 IRF-1|M00747 IRF1| 741 - 747 + ttcactt 7.56 NEG|Negative element| 769 - 783 - aatattaagcgtcga 6.54 TBP|M00713 TBP F$TBP_Q6| 896 - 904 - atataaatg 6.79 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT3G53650_H2B_A_thaliana.fasta (1 sequences, 1000 bp, 41.4% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score TATA_box|M00252 TATA V$TATA_01| 1.1 TBP|M00713 TBP F$TBP_Q6| 1.1 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.906 HEX|Hexamer| 0.427 Oct-1|M00138 V$OCT1_04 Oct-1| 0.313 IRF-1|M00747 IRF1| 0.303 AACCCT_box|AACCCT S. pombe| 0.209 HiNF-D|HiNF-D| 0.0527 IRF-7|M00453 V$IRF7_01 IRF-7| -0.188 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.62 NEG|Negative element| -0.98 E2F|M00516 E2F V$E2F_03| -2.09 GC_box|M00255 GC box V$GC_01| -2.62 SPT10|Spt10p| -3.07 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT3G53650_H2B_A_thaliana ref|NC_003074.4|chr3:1-23470805:19899343-19900342 Arabidopsis thaliana chromosome 3, complete sequence TATA_box|M00252 TATA V$TATA_01| 100 - 114 - tatggctttttaaag 6.73 TATA_box|M00252 TATA V$TATA_01| 162 - 176 - ccaccacttttatag 7.94 TBP|M00713 TBP F$TBP_Q6| 168 - 176 + cttttatag 6.27 HEX|Hexamer| 500 - 505 + gacttc 6.53 AACCCT_box|AACCCT S. pombe| 603 - 625 - attagggttagggttcgattttc 7.73 IRF-7|M00453 V$IRF7_01 IRF-7| 610 - 627 - ttagggttcgattttctc 6.6 HiNF-D|HiNF-D| 625 - 640 - ctcccgcgctctctct 6.44 HEX|Hexamer| 657 - 662 + gacttc 6.53 TBP|M00713 TBP F$TBP_Q6| 682 - 690 - atataaaaa 7.96 Oct-1|M00138 V$OCT1_04 Oct-1| 696 - 718 + gtcggcatcggcaaattaaaagg 7.28 IRF-1|M00747 IRF1| 778 - 784 - aagagga 6.15 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 862 - 873 + ggtaaccaatga 8.47 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 864 - 874 + taaccaatgaa 6.59 TATA_box|M00252 TATA V$TATA_01| 890 - 904 + ctatataaacaaatg 7.13 TBP|M00713 TBP F$TBP_Q6| 892 - 900 - atataaaca 6.83 IRF-1|M00747 IRF1| 944 - 950 - aagtgat 6.16 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT3G53730_H4_A_thaliana.fasta (1 sequences, 1000 bp, 34.7% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score HiNF-D|HiNF-D| 1.75 IRF-1|M00747 IRF1| 1.05 GC_box|M00255 GC box V$GC_01| 0.37 HEX|Hexamer| 0.366 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.114 Oct-1|M00138 V$OCT1_04 Oct-1| -0.462 NEG|Negative element| -0.857 IRF-7|M00453 V$IRF7_01 IRF-7| -0.912 TBP|M00713 TBP F$TBP_Q6| -0.945 SPT10|Spt10p| -0.957 TATA_box|M00252 TATA V$TATA_01| -1.23 E2F|M00516 E2F V$E2F_03| -1.71 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.12 AACCCT_box|AACCCT S. pombe| -2.6 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT3G53730_H4_A_thaliana ref|NC_003074.4|chr3:1-23470805:19923948-19924947 Arabidopsis thaliana chromosome 3, complete sequence HiNF-D|HiNF-D| 7 - 22 - acgcaggtctggcggt 6.1 HiNF-D|HiNF-D| 11 - 26 + aggtctggcggtggtg 8.49 HiNF-D|HiNF-D| 13 - 28 - gtctggcggtggtggt 7.68 GC_box|M00255 GC box V$GC_01| 16 - 29 + tggcggtggtggtg 7.13 IRF-1|M00747 IRF1| 44 - 50 - aagtgaa 7.85 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 176 - 187 + tgagaccagtga 7.06 HEX|Hexamer| 364 - 369 - gaagtc 7.18 IRF-1|M00747 IRF1| 390 - 396 + ttctctt 6.49 HiNF-D|HiNF-D| 672 - 687 - tcccagagcgctcctt 7.2 HiNF-D|HiNF-D| 736 - 751 + aggcataatgacgcgg 6.01 SPT10|Spt10p| 794 - 814 - cacgcggatagatgataacga 6.38 GC_box|M00255 GC box V$GC_01| 874 - 887 - gcactcctcctctt 6.83 HiNF-D|HiNF-D| 877 - 892 - ctcctcctcttctcgt 6.27 IRF-1|M00747 IRF1| 921 - 927 + ttcattt 6.03 IRF-7|M00453 V$IRF7_01 IRF-7| 974 - 991 - ttcgaatttaatttccca 6.18 IRF-1|M00747 IRF1| 991 - 997 - aagagaa 6.8 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT3G54560_H2A_A_thaliana.fasta (1 sequences, 1000 bp, 36.4% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 1.42 E2F|M00516 E2F V$E2F_03| 0.898 Oct-1|M00138 V$OCT1_04 Oct-1| 0.575 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.497 HiNF-D|HiNF-D| -0.0603 HEX|Hexamer| -0.147 IRF-1|M00747 IRF1| -0.161 IRF-7|M00453 V$IRF7_01 IRF-7| -0.322 TBP|M00713 TBP F$TBP_Q6| -0.466 NEG|Negative element| -1.11 TATA_box|M00252 TATA V$TATA_01| -1.18 GC_box|M00255 GC box V$GC_01| -2.51 SPT10|Spt10p| -3.26 AACCCT_box|AACCCT S. pombe| -4.13 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT3G54560_H2A_A_thaliana ref|NC_003074.4|chr3:1-23470805:20207146-20208145 Arabidopsis thaliana chromosome 3, complete sequence E2F|M00516 E2F V$E2F_03| 2 - 13 - ttaaccgccaaa 8.24 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 6 - 16 + ccgccaaagcg 8.01 IRF-7|M00453 V$IRF7_01 IRF-7| 7 - 24 + cgccaaagcgtaggtttc 6.1 Oct-1|M00138 V$OCT1_04 Oct-1| 36 - 58 + ttgaaaatatttaaaaactccca 6.13 TBP|M00713 TBP F$TBP_Q6| 44 - 52 - atttaaaaa 6.04 E2F|M00516 E2F V$E2F_03| 52 - 63 - actcccaccaaa 6.22 Oct-1|M00138 V$OCT1_04 Oct-1| 659 - 681 + caatgtttgtgctaattatacaa 6.22 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 696 - 706 - ctcactggttg 8.5 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 697 - 708 - tcactggttgct 6.74 Oct-1|M00138 V$OCT1_04 Oct-1| 948 - 970 + gcatagccatacaagtagagaga 6.78 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 949 - 960 + catagccataca 7.53 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT4G13570_H2A_A_thaliana.fasta (1 sequences, 1000 bp, 32.6% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score HEX|Hexamer| 0.326 Oct-1|M00138 V$OCT1_04 Oct-1| 0.182 IRF-1|M00747 IRF1| -0.0957 TBP|M00713 TBP F$TBP_Q6| -0.259 HiNF-D|HiNF-D| -0.914 TATA_box|M00252 TATA V$TATA_01| -1.04 NEG|Negative element| -1.44 IRF-7|M00453 V$IRF7_01 IRF-7| -1.58 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.76 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -2.23 GC_box|M00255 GC box V$GC_01| -3.01 E2F|M00516 E2F V$E2F_03| -3.04 SPT10|Spt10p| -4.67 AACCCT_box|AACCCT S. pombe| -5.01 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT4G13570_H2A_A_thaliana ref|NC_003075.3|chr4:1-18585042:7884392-7885391 Arabidopsis thaliana chromosome 4, complete sequence Oct-1|M00138 V$OCT1_04 Oct-1| 32 - 54 - tctatgaagtaacatacacattc 6.12 HEX|Hexamer| 222 - 227 - gaagtc 7.04 Oct-1|M00138 V$OCT1_04 Oct-1| 597 - 619 - tcatataatttgactaaataaac 6.16 TBP|M00713 TBP F$TBP_Q6| 737 - 745 - ctataaatg 6.07 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT4G27230.1_H2A_A_thaliana.fasta (1 sequences, 1000 bp, 38.5% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-1|M00747 IRF1| 1.35 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1.35 HiNF-D|HiNF-D| 0.832 IRF-7|M00453 V$IRF7_01 IRF-7| 0.555 HEX|Hexamer| 0.287 TBP|M00713 TBP F$TBP_Q6| -0.318 NEG|Negative element| -0.711 Oct-1|M00138 V$OCT1_04 Oct-1| -0.926 E2F|M00516 E2F V$E2F_03| -1.02 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.12 TATA_box|M00252 TATA V$TATA_01| -1.22 GC_box|M00255 GC box V$GC_01| -1.67 SPT10|Spt10p| -2.39 AACCCT_box|AACCCT S. pombe| -3.06 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT4G27230.1_H2A_A_thaliana ref|NC_003075.3|chr4:1-18585042:13637727-13638726 Arabidopsis thaliana chromosome 4, complete sequence IRF-1|M00747 IRF1| 6 - 12 - aagtgaa 8.06 TBP|M00713 TBP F$TBP_Q6| 65 - 73 - aaataaaaa 6.42 HiNF-D|HiNF-D| 145 - 160 + aaggacaaagcaggtg 6.11 IRF-7|M00453 V$IRF7_01 IRF-7| 165 - 182 + cacgaatctcaaatcacg 6.29 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 239 - 250 - tcattggtcaga 8.84 HEX|Hexamer| 437 - 442 - gaagtc 6.98 IRF-7|M00453 V$IRF7_01 IRF-7| 463 - 480 - ctgggcttcaattccctg 7.36 HiNF-D|HiNF-D| 533 - 548 + tgccggagctccggtc 6.87 HiNF-D|HiNF-D| 533 - 548 - tgccggagctccggtc 7.42 IRF-7|M00453 V$IRF7_01 IRF-7| 903 - 920 + ctcaaattcgaaaaatgt 6.25 IRF-1|M00747 IRF1| 926 - 932 + ttcactt 7.38 IRF-7|M00453 V$IRF7_01 IRF-7| 965 - 982 + ttgggaactgaatttggt 6.21 IRF-1|M00747 IRF1| 970 - 976 - aactgaa 7.54 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT4G27230.2_H2A_A_thaliana.fasta (1 sequences, 1000 bp, 32.8% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1.81 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 1.72 IRF-1|M00747 IRF1| 0.585 HiNF-D|HiNF-D| 0.0152 E2F|M00516 E2F V$E2F_03| -0.261 HEX|Hexamer| -0.264 TBP|M00713 TBP F$TBP_Q6| -0.964 Oct-1|M00138 V$OCT1_04 Oct-1| -0.989 NEG|Negative element| -1.05 IRF-7|M00453 V$IRF7_01 IRF-7| -1.12 TATA_box|M00252 TATA V$TATA_01| -1.56 GC_box|M00255 GC box V$GC_01| -1.67 SPT10|Spt10p| -2.88 AACCCT_box|AACCCT S. pombe| -3.68 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT4G27230.2_H2A_A_thaliana ref|NC_003075.3|chr4:1-18585042:13638331-13639330 Arabidopsis thaliana chromosome 4, complete sequence Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 269 - 279 - ctcattgggtt 9.29 IRF-1|M00747 IRF1| 610 - 616 - aagtgaa 7.84 HiNF-D|HiNF-D| 749 - 764 + aaggacaaagcaggtg 6.55 E2F|M00516 E2F V$E2F_03| 762 - 773 + gtgggcgcacga 7.05 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 843 - 854 - tcattggtcaga 9.35 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT4G40030.1_H3_A_thaliana.fasta (1 sequences, 1000 bp, 36.5% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score AACCCT_box|AACCCT S. pombe| 0.544 HiNF-D|HiNF-D| -0.183 IRF-1|M00747 IRF1| -0.473 TBP|M00713 TBP F$TBP_Q6| -0.501 NEG|Negative element| -0.584 HEX|Hexamer| -0.596 Oct-1|M00138 V$OCT1_04 Oct-1| -0.681 IRF-7|M00453 V$IRF7_01 IRF-7| -0.731 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -1.6 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.86 TATA_box|M00252 TATA V$TATA_01| -2.08 SPT10|Spt10p| -2.3 GC_box|M00255 GC box V$GC_01| -2.64 E2F|M00516 E2F V$E2F_03| -2.9 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT4G40030.1_H3_A_thaliana ref|NC_003075.3|chr4:1-18585042:18556260-18557259 Arabidopsis thaliana chromosome 4, complete sequence TBP|M00713 TBP F$TBP_Q6| 515 - 523 - aaataaagg 6.28 AACCCT_box|AACCCT S. pombe| 738 - 760 - atctggattagggttttaagtgg 8.08 HiNF-D|HiNF-D| 861 - 876 + aagcaaaccgctcgta 6.41 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT4G40030.2_H3_A_thaliana.fasta (1 sequences, 1000 bp, 35.4% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score AACCCT_box|AACCCT S. pombe| 0.254 TBP|M00713 TBP F$TBP_Q6| -0.219 Oct-1|M00138 V$OCT1_04 Oct-1| -0.255 IRF-7|M00453 V$IRF7_01 IRF-7| -0.324 IRF-1|M00747 IRF1| -0.35 HEX|Hexamer| -0.521 NEG|Negative element| -0.556 HiNF-D|HiNF-D| -0.694 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -1.69 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.83 TATA_box|M00252 TATA V$TATA_01| -1.93 GC_box|M00255 GC box V$GC_01| -2.31 E2F|M00516 E2F V$E2F_03| -2.82 SPT10|Spt10p| -3.17 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT4G40030.2_H3_A_thaliana ref|NC_003075.3|chr4:1-18585042:18556411-18557410 Arabidopsis thaliana chromosome 4, complete sequence IRF-7|M00453 V$IRF7_01 IRF-7| 503 - 520 + aaacaaaacaaaagtcag 6.59 TBP|M00713 TBP F$TBP_Q6| 666 - 674 - aaataaagg 6.48 AACCCT_box|AACCCT S. pombe| 889 - 911 - atctggattagggttttaagtgg 7.79 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT4G40030_H3_A_thaliana.fasta (1 sequences, 1000 bp, 38% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score AACCCT_box|AACCCT S. pombe| 0.504 HiNF-D|HiNF-D| -0.267 TBP|M00713 TBP F$TBP_Q6| -0.445 HEX|Hexamer| -0.45 Oct-1|M00138 V$OCT1_04 Oct-1| -0.592 IRF-1|M00747 IRF1| -0.607 NEG|Negative element| -0.655 IRF-7|M00453 V$IRF7_01 IRF-7| -0.675 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -1.59 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.02 TATA_box|M00252 TATA V$TATA_01| -2.1 SPT10|Spt10p| -2.31 GC_box|M00255 GC box V$GC_01| -2.94 E2F|M00516 E2F V$E2F_03| -3.04 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT4G40030_H3_A_thaliana ref|NC_003075.3|chr4:1-18585042:18556094-18557093 Arabidopsis thaliana chromosome 4, complete sequence IRF-7|M00453 V$IRF7_01 IRF-7| 186 - 203 + aaacaaaacaaaagtcag 6.01 TBP|M00713 TBP F$TBP_Q6| 349 - 357 - aaataaagg 6.36 AACCCT_box|AACCCT S. pombe| 572 - 594 - atctggattagggttttaagtgg 8.05 HiNF-D|HiNF-D| 695 - 710 + aagcaaaccgctcgta 6.28 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT4G40040.1_H3_A_thaliana.fasta (1 sequences, 1000 bp, 37.8% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-7|M00453 V$IRF7_01 IRF-7| 1.29 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.653 TATA_box|M00252 TATA V$TATA_01| 0.409 HEX|Hexamer| -0.116 NEG|Negative element| -0.361 TBP|M00713 TBP F$TBP_Q6| -0.408 Oct-1|M00138 V$OCT1_04 Oct-1| -0.533 HiNF-D|HiNF-D| -0.868 IRF-1|M00747 IRF1| -0.873 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.11 SPT10|Spt10p| -1.58 E2F|M00516 E2F V$E2F_03| -2.24 AACCCT_box|AACCCT S. pombe| -3.38 GC_box|M00255 GC box V$GC_01| -4.49 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT4G40040.1_H3_A_thaliana ref|NC_003075.3|chr4:1-18585042:18558230-18559229 Arabidopsis thaliana chromosome 4, complete sequence CCAAT_box|M00254 V$CAAT_01 CCAAT box| 292 - 303 + ttcagccaatag 7.92 NEG|Negative element| 435 - 449 + taatcgataaaaacc 6.32 TATA_box|M00252 TATA V$TATA_01| 439 - 453 + cgataaaaaccgtcc 7.83 TBP|M00713 TBP F$TBP_Q6| 458 - 466 - atataaatc 6.56 IRF-7|M00453 V$IRF7_01 IRF-7| 532 - 549 - atctttttcgaattcgga 8.28 IRF-7|M00453 V$IRF7_01 IRF-7| 552 - 569 - tcaagtttgaaattcgga 7.63 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT4G40040.2_H3_A_thaliana.fasta (1 sequences, 1000 bp, 38.8% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-7|M00453 V$IRF7_01 IRF-7| 1.27 TATA_box|M00252 TATA V$TATA_01| 0.529 HEX|Hexamer| 0.00568 HiNF-D|HiNF-D| -0.105 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.128 TBP|M00713 TBP F$TBP_Q6| -0.203 NEG|Negative element| -0.232 Oct-1|M00138 V$OCT1_04 Oct-1| -0.412 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.585 IRF-1|M00747 IRF1| -0.78 SPT10|Spt10p| -2 E2F|M00516 E2F V$E2F_03| -2.64 GC_box|M00255 GC box V$GC_01| -3.43 AACCCT_box|AACCCT S. pombe| -3.68 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT4G40040.2_H3_A_thaliana ref|NC_003075.3|chr4:1-18585042:18557802-18558801 Arabidopsis thaliana chromosome 4, complete sequence NEG|Negative element| 7 - 21 + taatcgataaaaacc 6.65 TATA_box|M00252 TATA V$TATA_01| 11 - 25 + cgataaaaaccgtcc 7.97 TBP|M00713 TBP F$TBP_Q6| 30 - 38 - atataaatc 6.78 Oct-1|M00138 V$OCT1_04 Oct-1| 59 - 81 - taaattaatatcaatagccgtac 6.32 IRF-7|M00453 V$IRF7_01 IRF-7| 104 - 121 - atctttttcgaattcgga 8.21 IRF-7|M00453 V$IRF7_01 IRF-7| 124 - 141 - tcaagtttgaaattcgga 7.73 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 705 - 715 - ctaattggtgg 6.65 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 748 - 759 + accaaccactgg 7.07 HiNF-D|HiNF-D| 773 - 788 - ccccatcgttaccgtc 6.48 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT5G02560_H2A_A_thaliana.fasta (1 sequences, 1000 bp, 32.2% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-1|M00747 IRF1| 0.955 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.633 NEG|Negative element| 0.0653 HiNF-D|HiNF-D| -0.0451 HEX|Hexamer| -0.202 TBP|M00713 TBP F$TBP_Q6| -0.38 Oct-1|M00138 V$OCT1_04 Oct-1| -0.383 IRF-7|M00453 V$IRF7_01 IRF-7| -0.978 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.09 TATA_box|M00252 TATA V$TATA_01| -2.28 E2F|M00516 E2F V$E2F_03| -2.47 SPT10|Spt10p| -2.62 GC_box|M00255 GC box V$GC_01| -4.72 AACCCT_box|AACCCT S. pombe| -4.8 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT5G02560_H2A_A_thaliana ref|NC_003076.4|chr5:1-26992728:574478-575477 Arabidopsis thaliana chromosome 5, complete sequence NEG|Negative element| 6 - 20 - tgcatttagtggaaa 6.82 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 443 - 454 + agtgtccagtga 7.27 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 464 - 475 + agtgtccaatag 6.4 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 512 - 523 + agcatccaagca 6.6 Oct-1|M00138 V$OCT1_04 Oct-1| 532 - 554 - aagtttcatttgcattatattca 6.38 IRF-1|M00747 IRF1| 785 - 791 + ttcactt 7.52 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 951 - 962 + tcaagccatgga 6.05 IRF-1|M00747 IRF1| 974 - 980 - aagtgaa 7.55 HiNF-D|HiNF-D| 979 - 994 + aagaaaggagccgctg 7.14 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT5G02570_H2B_A_thaliana.fasta (1 sequences, 1000 bp, 31.6% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score Oct-1|M00138 V$OCT1_04 Oct-1| 0.833 IRF-7|M00453 V$IRF7_01 IRF-7| 0.557 E2F|M00516 E2F V$E2F_03| 0.494 TATA_box|M00252 TATA V$TATA_01| 0.392 NEG|Negative element| 0.106 HEX|Hexamer| -0.0549 HiNF-D|HiNF-D| -0.109 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.181 AACCCT_box|AACCCT S. pombe| -0.303 TBP|M00713 TBP F$TBP_Q6| -0.527 IRF-1|M00747 IRF1| -0.541 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.799 SPT10|Spt10p| -1.58 GC_box|M00255 GC box V$GC_01| -2.29 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT5G02570_H2B_A_thaliana ref|NC_003076.4|chr5:1-26992728:577117-578116 Arabidopsis thaliana chromosome 5, complete sequence AACCCT_box|AACCCT S. pombe| 72 - 94 - tccttgggaaggctttggttgga 7.14 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 163 - 173 - cacattagctg 7.17 Oct-1|M00138 V$OCT1_04 Oct-1| 279 - 301 - acgtatcttttgcatgtgaataa 7.82 Oct-1|M00138 V$OCT1_04 Oct-1| 374 - 396 + tgttgttcatgcatatatatacc 6.38 HiNF-D|HiNF-D| 787 - 802 - cgccgactttagcgtt 6.99 NEG|Negative element| 790 - 804 - cgactttagcgttaa 6.88 IRF-7|M00453 V$IRF7_01 IRF-7| 905 - 922 + ttcaaaaccgaaaccctc 8.08 TATA_box|M00252 TATA V$TATA_01| 973 - 987 + ggattaatggcgccg 7.56 E2F|M00516 E2F V$E2F_03| 978 - 989 + aatggcgccgaa 6.04 E2F|M00516 E2F V$E2F_03| 978 - 989 - aatggcgccgaa 7.92 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT5G10390_H3_A_thaliana.fasta (1 sequences, 1000 bp, 34.2% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score E2F|M00516 E2F V$E2F_03| 2.55 TATA_box|M00252 TATA V$TATA_01| 0.891 IRF-7|M00453 V$IRF7_01 IRF-7| 0.816 Oct-1|M00138 V$OCT1_04 Oct-1| 0.0865 HEX|Hexamer| 0.0784 NEG|Negative element| -0.366 IRF-1|M00747 IRF1| -0.575 GC_box|M00255 GC box V$GC_01| -0.594 TBP|M00713 TBP F$TBP_Q6| -0.82 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.832 HiNF-D|HiNF-D| -0.889 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.09 AACCCT_box|AACCCT S. pombe| -2.93 SPT10|Spt10p| -3.02 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT5G10390_H3_A_thaliana ref|NC_003076.4|chr5:1-26992728:3269476-3270475 Arabidopsis thaliana chromosome 5, complete sequence CCAAT_box|M00254 V$CAAT_01 CCAAT box| 61 - 72 - tcaatggatatg 6.06 Oct-1|M00138 V$OCT1_04 Oct-1| 193 - 215 - tctgtcgatctccatatttctgc 6.53 IRF-7|M00453 V$IRF7_01 IRF-7| 614 - 631 - aaaattttcgatttggcg 7.44 E2F|M00516 E2F V$E2F_03| 625 - 636 + tttggcgcctaa 9.78 E2F|M00516 E2F V$E2F_03| 625 - 636 - tttggcgcctaa 7.4 TATA_box|M00252 TATA V$TATA_01| 760 - 774 - cacacggatttatac 7.45 E2F|M00516 E2F V$E2F_03| 829 - 840 - tttccctccaaa 6.1 GC_box|M00255 GC box V$GC_01| 846 - 859 - aactccctcccatg 6.93 E2F|M00516 E2F V$E2F_03| 870 - 881 - ctcaccgccaaa 8.59 TATA_box|M00252 TATA V$TATA_01| 891 - 905 + ccataaaagcagtcc 7.99 IRF-7|M00453 V$IRF7_01 IRF-7| 929 - 946 - caaaatttctcattcgca 7.12 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT5G10400_H3_A_thaliana.fasta (1 sequences, 1000 bp, 28.9% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-7|M00453 V$IRF7_01 IRF-7| 1.21 TATA_box|M00252 TATA V$TATA_01| 0.774 TBP|M00713 TBP F$TBP_Q6| 0.277 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 0.231 HEX|Hexamer| 0.0601 IRF-1|M00747 IRF1| -0.147 NEG|Negative element| -0.214 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.263 Oct-1|M00138 V$OCT1_04 Oct-1| -0.608 HiNF-D|HiNF-D| -0.654 SPT10|Spt10p| -1.51 GC_box|M00255 GC box V$GC_01| -2.07 E2F|M00516 E2F V$E2F_03| -3.32 AACCCT_box|AACCCT S. pombe| -5.01 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT5G10400_H3_A_thaliana ref|NC_003076.4|chr5:1-26992728:3270889-3271888 Arabidopsis thaliana chromosome 5, complete sequence IRF-7|M00453 V$IRF7_01 IRF-7| 19 - 36 - gtttgattcgctttccat 7.11 IRF-7|M00453 V$IRF7_01 IRF-7| 25 - 42 - ttcgctttccattttctt 7.14 IRF-7|M00453 V$IRF7_01 IRF-7| 73 - 90 - gtgagtttccttttgcaa 7.98 TBP|M00713 TBP F$TBP_Q6| 505 - 513 - atataagta 6.2 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 789 - 799 - cttattggtta 6.15 NEG|Negative element| 809 - 823 - gacgcggatcgtaaa 6.3 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 847 - 858 + ataagccaaaca 6.52 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 849 - 859 + aagccaaacag 7.52 TATA_box|M00252 TATA V$TATA_01| 901 - 915 + gtataaaaaagcctc 8.27 SPT10|Spt10p| 943 - 963 + gcattctcaccgaatcaaatc 6.05 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT5G10980_H3_A_thaliana.fasta (1 sequences, 1000 bp, 36.1% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score NEG|Negative element| 0.615 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.555 Oct-1|M00138 V$OCT1_04 Oct-1| 0.199 HiNF-D|HiNF-D| 0.147 IRF-1|M00747 IRF1| 0.136 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 0.119 IRF-7|M00453 V$IRF7_01 IRF-7| 0.0658 HEX|Hexamer| -0.0941 TBP|M00713 TBP F$TBP_Q6| -0.117 TATA_box|M00252 TATA V$TATA_01| -1.32 GC_box|M00255 GC box V$GC_01| -1.34 E2F|M00516 E2F V$E2F_03| -2.5 AACCCT_box|AACCCT S. pombe| -3.52 SPT10|Spt10p| -3.73 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT5G10980_H3_A_thaliana ref|NC_003076.4|chr5:1-26992728:3473350-3474349 Arabidopsis thaliana chromosome 5, complete sequence Oct-1|M00138 V$OCT1_04 Oct-1| 35 - 57 + ttttgtgcattcaaatttaggct 7.32 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 58 - 69 - tcaatggccata 7.58 IRF-1|M00747 IRF1| 240 - 246 + ttctgtt 6.4 IRF-7|M00453 V$IRF7_01 IRF-7| 378 - 395 + taccaaaccgaattttaa 6.72 HiNF-D|HiNF-D| 479 - 494 + gatcggagcggccgta 6.44 NEG|Negative element| 533 - 547 + cgaactctcaatgcc 7.72 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 739 - 750 + ttaaaccaatca 6.81 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 741 - 751 + aaaccaatcag 7.46 HiNF-D|HiNF-D| 747 - 762 + atcagaagcgaggacg 6.43 IRF-7|M00453 V$IRF7_01 IRF-7| 811 - 828 + cgaaaatgtgaagattgg 6.08 IRF-7|M00453 V$IRF7_01 IRF-7| 914 - 931 + caagaaaacaaaactcgc 6.2 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT5G12910_H3_A_thaliana.fasta (1 sequences, 1000 bp, 31% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.729 IRF-1|M00747 IRF1| 0.253 TBP|M00713 TBP F$TBP_Q6| 0.142 NEG|Negative element| -0.0294 TATA_box|M00252 TATA V$TATA_01| -0.044 HiNF-D|HiNF-D| -0.275 IRF-7|M00453 V$IRF7_01 IRF-7| -0.499 HEX|Hexamer| -0.562 Oct-1|M00138 V$OCT1_04 Oct-1| -0.795 SPT10|Spt10p| -0.948 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.01 E2F|M00516 E2F V$E2F_03| -1.9 GC_box|M00255 GC box V$GC_01| -3.33 AACCCT_box|AACCCT S. pombe| -3.9 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT5G12910_H3_A_thaliana ref|NC_003076.4|chr5:1-26992728:4076166-4077165 Arabidopsis thaliana chromosome 5, complete sequence IRF-1|M00747 IRF1| 72 - 78 + ttcactt 7.21 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 144 - 155 + ccgggccataca 8.22 TATA_box|M00252 TATA V$TATA_01| 144 - 158 - ccgggccatacatgc 6.94 IRF-7|M00453 V$IRF7_01 IRF-7| 285 - 302 + gtgcaaactgacgatggg 6.64 SPT10|Spt10p| 640 - 660 - cagttgacacagtcgcaacgg 6.6 HiNF-D|HiNF-D| 647 - 662 + cacagtcgcaacggaa 6.02 NEG|Negative element| 668 - 682 - gatctcaagcgttga 6.02 HiNF-D|HiNF-D| 800 - 815 + cagcaaacctatggtc 6.21 TATA_box|M00252 TATA V$TATA_01| 810 - 824 - atggtctatatatag 6.09 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT5G22880_H2B_A_thaliana.fasta (1 sequences, 1000 bp, 32.5% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score SPT10|Spt10p| 1.62 IRF-1|M00747 IRF1| 0.438 TBP|M00713 TBP F$TBP_Q6| 0.218 Oct-1|M00138 V$OCT1_04 Oct-1| 0.171 HiNF-D|HiNF-D| -0.0836 HEX|Hexamer| -0.281 TATA_box|M00252 TATA V$TATA_01| -0.529 IRF-7|M00453 V$IRF7_01 IRF-7| -0.781 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.963 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1 NEG|Negative element| -1.11 AACCCT_box|AACCCT S. pombe| -1.34 E2F|M00516 E2F V$E2F_03| -1.65 GC_box|M00255 GC box V$GC_01| -3.78 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT5G22880_H2B_A_thaliana ref|NC_003076.4|chr5:1-26992728:7652510-7653509 Arabidopsis thaliana chromosome 5, complete sequence HiNF-D|HiNF-D| 35 - 50 - ctccctctcttttttt 6.48 AACCCT_box|AACCCT S. pombe| 158 - 180 - caaatgattttggttctgatggg 6.21 TBP|M00713 TBP F$TBP_Q6| 315 - 323 - atataagaa 6.02 TATA_box|M00252 TATA V$TATA_01| 432 - 446 + ctataaaaagttggt 6.74 Oct-1|M00138 V$OCT1_04 Oct-1| 443 - 465 - tggttatttttgaagaattttga 6.53 IRF-1|M00747 IRF1| 499 - 505 + ttcattt 6.11 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 749 - 760 + accatccattca 6.39 IRF-1|M00747 IRF1| 844 - 850 + ttctctt 6.75 TBP|M00713 TBP F$TBP_Q6| 846 - 854 + ctcttatat 6.54 SPT10|Spt10p| 964 - 984 - gcggagaagaaaccggcagag 9.19 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT5G27670_H2A_A_thaliana.fasta (1 sequences, 1000 bp, 37.5% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 1.5 IRF-1|M00747 IRF1| 0.796 HiNF-D|HiNF-D| 0.636 HEX|Hexamer| 0.255 Oct-1|M00138 V$OCT1_04 Oct-1| 0.206 IRF-7|M00453 V$IRF7_01 IRF-7| -0.3 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.562 NEG|Negative element| -0.661 TBP|M00713 TBP F$TBP_Q6| -0.689 E2F|M00516 E2F V$E2F_03| -1.21 TATA_box|M00252 TATA V$TATA_01| -1.29 AACCCT_box|AACCCT S. pombe| -2.07 SPT10|Spt10p| -3.41 GC_box|M00255 GC box V$GC_01| -3.62 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT5G27670_H2A_A_thaliana ref|NC_003076.4|chr5:1-26992728:9793332-9794331 Arabidopsis thaliana chromosome 5, complete sequence IRF-1|M00747 IRF1| 7 - 13 - aagagaa 6.79 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 62 - 72 + catccatggag 6.07 HiNF-D|HiNF-D| 230 - 245 + aggcatagataccgcg 7.96 IRF-1|M00747 IRF1| 291 - 297 - aagagaa 6.79 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 397 - 408 + tgcagccattaa 6.82 IRF-1|M00747 IRF1| 418 - 424 + ttcattt 6.19 HEX|Hexamer| 746 - 751 - gaagtc 6.98 Oct-1|M00138 V$OCT1_04 Oct-1| 834 - 856 - acgtggtatatacatacacgtcg 7.02 IRF-7|M00453 V$IRF7_01 IRF-7| 872 - 889 + aagcaaatcgtaaaccgc 6.21 Oct-1|M00138 V$OCT1_04 Oct-1| 927 - 949 - tagattcatttgtattttctttt 6.11 IRF-1|M00747 IRF1| 931 - 937 + ttcattt 6.19 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 988 - 998 + aagccaacgag 8.96 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT5G54640_H2A_A_thaliana.fasta (1 sequences, 1000 bp, 33% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score CCAAT_box|M00254 V$CAAT_01 CCAAT box| 2.15 GC_box|M00255 GC box V$GC_01| 0.951 HEX|Hexamer| 0.343 TBP|M00713 TBP F$TBP_Q6| 0.302 HiNF-D|HiNF-D| 0.0858 IRF-1|M00747 IRF1| -0.02 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.0472 IRF-7|M00453 V$IRF7_01 IRF-7| -0.379 E2F|M00516 E2F V$E2F_03| -0.483 NEG|Negative element| -0.791 Oct-1|M00138 V$OCT1_04 Oct-1| -0.817 TATA_box|M00252 TATA V$TATA_01| -0.828 SPT10|Spt10p| -3.13 AACCCT_box|AACCCT S. pombe| -3.16 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT5G54640_H2A_A_thaliana ref|NC_003076.4|chr5:1-26992728:22212767-22213766 Arabidopsis thaliana chromosome 5, complete sequence HEX|Hexamer| 3 - 8 + gacttc 7.03 GC_box|M00255 GC box V$GC_01| 146 - 159 + agtaggtgtgggtg 8.2 IRF-7|M00453 V$IRF7_01 IRF-7| 200 - 217 + ttagaaattgaattttga 6.63 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 305 - 315 - cacattgactg 7.09 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 310 - 321 - tgactggtctgc 6.73 GC_box|M00255 GC box V$GC_01| 313 - 326 - ctggtctgccccaa 6.9 IRF-1|M00747 IRF1| 416 - 422 + ttctctt 6.54 TBP|M00713 TBP F$TBP_Q6| 452 - 460 + tttttatat 6.28 TBP|M00713 TBP F$TBP_Q6| 486 - 494 + tatttatat 6.4 HiNF-D|HiNF-D| 601 - 616 - tttcttcgctggggtt 6.06 E2F|M00516 E2F V$E2F_03| 615 - 626 + tttggtgggcga 6.97 HiNF-D|HiNF-D| 787 - 802 + agttcaagcggtggga 6.08 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 818 - 829 + cgtagccattca 9.63 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 879 - 890 - ttattggtcaaa 6.76 HiNF-D|HiNF-D| 970 - 985 - tgcgctctttgtgggt 6.04 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT5G59690_H4_A_thaliana.fasta (1 sequences, 1000 bp, 34.5% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score E2F|M00516 E2F V$E2F_03| 1.53 Oct-1|M00138 V$OCT1_04 Oct-1| -0.0137 HEX|Hexamer| -0.155 IRF-7|M00453 V$IRF7_01 IRF-7| -0.166 NEG|Negative element| -0.307 TBP|M00713 TBP F$TBP_Q6| -0.32 IRF-1|M00747 IRF1| -0.592 TATA_box|M00252 TATA V$TATA_01| -0.61 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.891 AACCCT_box|AACCCT S. pombe| -1.31 HiNF-D|HiNF-D| -1.4 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -2.02 GC_box|M00255 GC box V$GC_01| -2.48 SPT10|Spt10p| -3.35 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT5G59690_H4_A_thaliana ref|NC_003076.4|chr5:1-26992728:24067876-24068875 Arabidopsis thaliana chromosome 5, complete sequence IRF-7|M00453 V$IRF7_01 IRF-7| 649 - 666 - cgcaattttattttccga 7.1 E2F|M00516 E2F V$E2F_03| 700 - 711 + tgtggcgccaca 8.41 E2F|M00516 E2F V$E2F_03| 700 - 711 - tgtggcgccaca 8.41 AACCCT_box|AACCCT S. pombe| 738 - 760 + gctatcactgccatcacgcggat 6.23 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT5G59870_H2A_A_thaliana.fasta (1 sequences, 1000 bp, 30.1% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1.53 IRF-1|M00747 IRF1| 1.04 Oct-1|M00138 V$OCT1_04 Oct-1| 0.694 HiNF-D|HiNF-D| 0.178 TBP|M00713 TBP F$TBP_Q6| 0.0616 HEX|Hexamer| -0.197 NEG|Negative element| -0.304 TATA_box|M00252 TATA V$TATA_01| -0.457 IRF-7|M00453 V$IRF7_01 IRF-7| -0.521 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.905 E2F|M00516 E2F V$E2F_03| -1.02 AACCCT_box|AACCCT S. pombe| -1.56 SPT10|Spt10p| -2.79 GC_box|M00255 GC box V$GC_01| -4.24 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT5G59870_H2A_A_thaliana ref|NC_003076.4|chr5:1-26992728:24133337-24134336 Arabidopsis thaliana chromosome 5, complete sequence Oct-1|M00138 V$OCT1_04 Oct-1| 65 - 87 + taacgagcatgtaaaactaacca 7.77 IRF-1|M00747 IRF1| 125 - 131 + ttcactt 7.22 TBP|M00713 TBP F$TBP_Q6| 286 - 294 + ctcttatat 6.14 Oct-1|M00138 V$OCT1_04 Oct-1| 335 - 357 - taattgggtttgcataagttttg 6.47 IRF-1|M00747 IRF1| 432 - 438 + ttctctt 6.3 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 754 - 765 - tgattggttaat 9.1 TATA_box|M00252 TATA V$TATA_01| 862 - 876 + ctataaatatcacag 6.19 NEG|Negative element| 932 - 946 + taaactctcaatttc 6.01 HiNF-D|HiNF-D| 957 - 972 + aaccgtagcaatggaa 7.01 IRF-7|M00453 V$IRF7_01 IRF-7| 978 - 995 + cggaaaagtgaagaaagc 6.49 IRF-1|M00747 IRF1| 983 - 989 - aagtgaa 7.87 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT5G59910_H2B_A_thaliana.fasta (1 sequences, 1000 bp, 44.6% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1.37 IRF-7|M00453 V$IRF7_01 IRF-7| 0.996 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 0.255 TBP|M00713 TBP F$TBP_Q6| 0.242 E2F|M00516 E2F V$E2F_03| -0.00331 IRF-1|M00747 IRF1| -0.0625 HEX|Hexamer| -0.231 HiNF-D|HiNF-D| -0.291 TATA_box|M00252 TATA V$TATA_01| -0.54 Oct-1|M00138 V$OCT1_04 Oct-1| -0.683 NEG|Negative element| -0.838 AACCCT_box|AACCCT S. pombe| -2.1 SPT10|Spt10p| -2.29 GC_box|M00255 GC box V$GC_01| -3.75 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT5G59910_H2B_A_thaliana ref|NC_003076.4|chr5:1-26992728:24143496-24144495 Arabidopsis thaliana chromosome 5, complete sequence IRF-7|M00453 V$IRF7_01 IRF-7| 156 - 173 + gaggaaattgaaaaacct 7.11 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 193 - 204 - tcaatggttcca 6.63 IRF-1|M00747 IRF1| 296 - 302 + ttctttt 6.57 IRF-7|M00453 V$IRF7_01 IRF-7| 389 - 406 + tgcgaaaatgagagcttg 6.74 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 534 - 544 - ctcactggtta 7.27 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 535 - 546 - tcactggttata 7.26 IRF-7|M00453 V$IRF7_01 IRF-7| 607 - 624 + gcgggaatggaaaatttc 7.75 IRF-7|M00453 V$IRF7_01 IRF-7| 608 - 625 + cgggaatggaaaatttca 6.21 E2F|M00516 E2F V$E2F_03| 629 - 640 - gatagcgccaat 6.29 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 672 - 683 + tgtatccaataa 6.69 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 674 - 684 + tatccaataag 6.47 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 796 - 807 + tgtatccaatca 8.31 TATA_box|M00252 TATA V$TATA_01| 824 - 838 + ctatataaaagcaat 6.06 TBP|M00713 TBP F$TBP_Q6| 826 - 834 - atataaaag 7.41 E2F|M00516 E2F V$E2F_03| 936 - 947 - aatggcgccgaa 6.38 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT5G59970_H4_A_thaliana.fasta (1 sequences, 1000 bp, 41% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score HiNF-D|HiNF-D| 2.32 TBP|M00713 TBP F$TBP_Q6| 1.03 TATA_box|M00252 TATA V$TATA_01| 0.505 IRF-7|M00453 V$IRF7_01 IRF-7| 0.401 E2F|M00516 E2F V$E2F_03| 0.255 HEX|Hexamer| 0.0675 NEG|Negative element| -0.0582 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.274 IRF-1|M00747 IRF1| -0.287 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.803 SPT10|Spt10p| -1.09 Oct-1|M00138 V$OCT1_04 Oct-1| -1.12 AACCCT_box|AACCCT S. pombe| -1.78 GC_box|M00255 GC box V$GC_01| -3.07 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT5G59970_H4_A_thaliana ref|NC_003076.4|chr5:1-26992728:24163889-24164888 Arabidopsis thaliana chromosome 5, complete sequence Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 346 - 356 - ctccatggctt 6.46 HiNF-D|HiNF-D| 346 - 361 - ctccatggctttcgtg 8.65 E2F|M00516 E2F V$E2F_03| 382 - 393 + tttcccgccggc 7.66 IRF-7|M00453 V$IRF7_01 IRF-7| 385 - 402 - cccgccggcgatttcctt 6.7 HiNF-D|HiNF-D| 387 - 402 - cgccggcgatttcctt 9.47 NEG|Negative element| 415 - 429 + tggcggctcattgta 6.3 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 421 - 431 - ctcattgtac