Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT1G01370_H3_A_thaliana.fasta (1 sequences, 1000 bp, 38.8% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-7|M00453 V$IRF7_01 IRF-7| 2.26 E2F|M00516 E2F V$E2F_03| 1.31 HiNF-D|HiNF-D| 0.632 HEX|Hexamer| 0.505 IRF-1|M00747 IRF1| 0.177 NEG|Negative element| -0.335 TBP|M00713 TBP F$TBP_Q6| -0.44 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.607 SPT10|Spt10p| -0.694 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -1.01 Oct-1|M00138 V$OCT1_04 Oct-1| -1.01 TATA_box|M00252 TATA V$TATA_01| -1.64 GC_box|M00255 GC box V$GC_01| -1.86 AACCCT_box|AACCCT S. pombe| -1.97 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT1G01370_H3_A_thaliana ref|NC_003070.5|chr1:1-30432563:143447-144446 Arabidopsis thaliana chromosome 1, complete sequence E2F|M00516 E2F V$E2F_03| 160 - 171 - tcgagcgggaaa 8.13 IRF-7|M00453 V$IRF7_01 IRF-7| 165 - 182 + cgggaaagtaaaagttcc 9.02 SPT10|Spt10p| 189 - 209 + atcttctaatcttttcgtatc 6.75 E2F|M00516 E2F V$E2F_03| 208 - 219 + tctagcgggaaa 6.04 E2F|M00516 E2F V$E2F_03| 208 - 219 - tctagcgggaaa 8.05 IRF-7|M00453 V$IRF7_01 IRF-7| 231 - 248 - gtgactttcataatcgca 6.17 IRF-1|M00747 IRF1| 260 - 266 + ttctctt 6.14 IRF-7|M00453 V$IRF7_01 IRF-7| 269 - 286 - ccgattttacgattcctc 6.63 IRF-1|M00747 IRF1| 395 - 401 + ttctctt 6.14 IRF-7|M00453 V$IRF7_01 IRF-7| 462 - 479 - ctagatttcgaatctgaa 6.65 IRF-7|M00453 V$IRF7_01 IRF-7| 468 - 485 + ttcgaatctgaaatttgt 8.68 IRF-7|M00453 V$IRF7_01 IRF-7| 605 - 622 + atcgaaattgaagacccc 7.39 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 621 - 631 + ccgacaaggag 6.74 HiNF-D|HiNF-D| 624 - 639 + acaaggagaggcggtg 7.57 TBP|M00713 TBP F$TBP_Q6| 670 - 678 + tttttatat 6.54 HEX|Hexamer| 681 - 686 - gaagtc 6.98 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT1G07660_H4_A_thaliana.fasta (1 sequences, 1000 bp, 37.1% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score HEX|Hexamer| 0.28 IRF-1|M00747 IRF1| -0.0731 TBP|M00713 TBP F$TBP_Q6| -0.569 NEG|Negative element| -0.635 HiNF-D|HiNF-D| -0.729 Oct-1|M00138 V$OCT1_04 Oct-1| -0.846 TATA_box|M00252 TATA V$TATA_01| -1.1 IRF-7|M00453 V$IRF7_01 IRF-7| -1.32 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -1.8 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.91 E2F|M00516 E2F V$E2F_03| -2.34 SPT10|Spt10p| -2.72 AACCCT_box|AACCCT S. pombe| -3.12 GC_box|M00255 GC box V$GC_01| -4.17 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT1G07660_H4_A_thaliana ref|NC_003070.5|chr1:1-30432563:2368210-2369209 Arabidopsis thaliana chromosome 1, complete sequence IRF-1|M00747 IRF1| 695 - 701 - aacagaa 6.51 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT1G07790_H2B_A_thaliana.fasta (1 sequences, 1000 bp, 35.5% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score TATA_box|M00252 TATA V$TATA_01| 1.55 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 0.777 IRF-7|M00453 V$IRF7_01 IRF-7| 0.694 IRF-1|M00747 IRF1| 0.547 HEX|Hexamer| 0.0905 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.0223 TBP|M00713 TBP F$TBP_Q6| -0.0104 HiNF-D|HiNF-D| -0.427 E2F|M00516 E2F V$E2F_03| -0.525 Oct-1|M00138 V$OCT1_04 Oct-1| -0.595 NEG|Negative element| -0.676 SPT10|Spt10p| -1.93 GC_box|M00255 GC box V$GC_01| -3.87 AACCCT_box|AACCCT S. pombe| -4.93 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT1G07790_H2B_A_thaliana ref|NC_003070.5|chr1:1-30432563:2412122-2413121 Arabidopsis thaliana chromosome 1, complete sequence TBP|M00713 TBP F$TBP_Q6| 241 - 249 + cacttatag 6.11 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 516 - 526 - ctcagtgacgg 6.79 TATA_box|M00252 TATA V$TATA_01| 572 - 586 - tatcgctttttatac 9.11 IRF-1|M00747 IRF1| 639 - 645 + ttcattt 6.83 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 646 - 657 + caggcccaatgg 6.06 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 668 - 679 + cacgaccattga 6.85 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 764 - 774 + taacgaatgag 6.34 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 807 - 818 + tctatccaatag 6.13 IRF-7|M00453 V$IRF7_01 IRF-7| 883 - 900 - atcaacttccttttcccg 8.17 E2F|M00516 E2F V$E2F_03| 894 - 905 - tttcccgagaaa 6.19 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 965 - 975 + ccgccgctgag 7.83 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT1G07820_H4_A_thaliana.fasta (1 sequences, 1000 bp, 39.6% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-7|M00453 V$IRF7_01 IRF-7| 1.28 IRF-1|M00747 IRF1| 0.825 HEX|Hexamer| 0.199 NEG|Negative element| 0.119 HiNF-D|HiNF-D| 0.08 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.00868 TBP|M00713 TBP F$TBP_Q6| -0.0738 E2F|M00516 E2F V$E2F_03| -0.116 SPT10|Spt10p| -0.552 TATA_box|M00252 TATA V$TATA_01| -0.624 Oct-1|M00138 V$OCT1_04 Oct-1| -0.739 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.54 AACCCT_box|AACCCT S. pombe| -2.96 GC_box|M00255 GC box V$GC_01| -4.67 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT1G07820_H4_A_thaliana ref|NC_003070.5|chr1:1-30432563:2421743-2422742 Arabidopsis thaliana chromosome 1, complete sequence HiNF-D|HiNF-D| 111 - 126 - cgaggcagctgctgct 6.12 E2F|M00516 E2F V$E2F_03| 142 - 153 - gatcgcgccgat 6.21 E2F|M00516 E2F V$E2F_03| 171 - 182 - cctcccgacaaa 6.11 NEG|Negative element| 214 - 228 - tcctttgagcttgca 6.19 IRF-1|M00747 IRF1| 261 - 267 - aagagaa 6.59 IRF-7|M00453 V$IRF7_01 IRF-7| 262 - 279 + agagaaatcgagattgga 6.08 SPT10|Spt10p| 456 - 476 + cctctctcaacgtttctccga 6.92 NEG|Negative element| 501 - 515 - aacttttagggccca 6.25 IRF-7|M00453 V$IRF7_01 IRF-7| 551 - 568 - ccaggtttcattttctct 8.59 IRF-1|M00747 IRF1| 557 - 563 + ttcattt 6.48 IRF-1|M00747 IRF1| 563 - 569 + ttctctt 6.88 IRF-7|M00453 V$IRF7_01 IRF-7| 604 - 621 + ttggaagacgaatgctgt 6.01 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 709 - 720 + tataaccattgg 6.16 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 714 - 725 - ccattggatcag 6.78 TATA_box|M00252 TATA V$TATA_01| 762 - 776 - cgcagttttatatat 6.35 TBP|M00713 TBP F$TBP_Q6| 766 - 774 + gttttatat 6.45 NEG|Negative element| 903 - 917 - gaaatctagcgtttc 6.42 IRF-1|M00747 IRF1| 915 - 921 + ttctgtt 6.25 IRF-1|M00747 IRF1| 948 - 954 + ttctgtt 6.25 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT1G08170_H2B_A_thaliana.fasta (1 sequences, 1000 bp, 39.2% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score TBP|M00713 TBP F$TBP_Q6| 1.02 NEG|Negative element| 0.973 E2F|M00516 E2F V$E2F_03| 0.49 TATA_box|M00252 TATA V$TATA_01| 0.332 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.013 IRF-7|M00453 V$IRF7_01 IRF-7| -0.0832 IRF-1|M00747 IRF1| -0.353 HiNF-D|HiNF-D| -0.365 HEX|Hexamer| -0.461 Oct-1|M00138 V$OCT1_04 Oct-1| -0.98 AACCCT_box|AACCCT S. pombe| -1.36 GC_box|M00255 GC box V$GC_01| -1.81 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.1 SPT10|Spt10p| -2.12 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT1G08170_H2B_A_thaliana ref|NC_003070.5|chr1:1-30432563:2563348-2564347 Arabidopsis thaliana chromosome 1, complete sequence TBP|M00713 TBP F$TBP_Q6| 83 - 91 + tctttatat 7.73 NEG|Negative element| 169 - 183 - gttttttagcgatca 7.34 NEG|Negative element| 184 - 198 - gataattagcggcca 7.99 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 191 - 202 + agcggccagtcc 6.49 IRF-7|M00453 V$IRF7_01 IRF-7| 205 - 222 - acatgtttcaaatttgta 6.9 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 309 - 320 - cgtttggtcaca 6.87 TATA_box|M00252 TATA V$TATA_01| 431 - 445 - taagcccatttatat 6.58 TATA_box|M00252 TATA V$TATA_01| 433 - 447 - agcccatttatatgc 6.15 TBP|M00713 TBP F$TBP_Q6| 437 - 445 + catttatat 7.47 TATA_box|M00252 TATA V$TATA_01| 624 - 638 - acgccctttttaaat 6.6 E2F|M00516 E2F V$E2F_03| 678 - 689 + tatggcgccgag 7.51 E2F|M00516 E2F V$E2F_03| 678 - 689 - tatggcgccgag 6.99 AACCCT_box|AACCCT S. pombe| 913 - 935 - accaccgttaagattccggtgga 6.08 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT1G08880_H2A_A_thaliana.fasta (1 sequences, 1000 bp, 34.7% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score HiNF-D|HiNF-D| 2.74 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 2.14 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1.75 IRF-1|M00747 IRF1| 0.431 HEX|Hexamer| 0.037 TBP|M00713 TBP F$TBP_Q6| -0.299 IRF-7|M00453 V$IRF7_01 IRF-7| -0.466 Oct-1|M00138 V$OCT1_04 Oct-1| -0.514 TATA_box|M00252 TATA V$TATA_01| -0.69 NEG|Negative element| -0.967 SPT10|Spt10p| -1.28 GC_box|M00255 GC box V$GC_01| -2.91 AACCCT_box|AACCCT S. pombe| -3.63 E2F|M00516 E2F V$E2F_03| -3.81 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT1G08880_H2A_A_thaliana ref|NC_003070.5|chr1:1-30432563:2847649-2848648 Arabidopsis thaliana chromosome 1, complete sequence IRF-7|M00453 V$IRF7_01 IRF-7| 108 - 125 + aaagaaaaggaaagagtg 6.06 HiNF-D|HiNF-D| 153 - 168 + aacgaaagagccagtg 7.47 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 158 - 169 + aagagccagtga 7.26 HiNF-D|HiNF-D| 165 - 180 + agtgacagcgacggag 10.2 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 361 - 371 - ctcattggtcg 9.66 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 362 - 373 - tcattggtcgtg 9.17 IRF-1|M00747 IRF1| 907 - 913 + ttctctt 6.88 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT1G09200_H3_A_thaliana.fasta (1 sequences, 1000 bp, 36% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-1|M00747 IRF1| 1.02 IRF-7|M00453 V$IRF7_01 IRF-7| 0.556 HEX|Hexamer| 0.465 NEG|Negative element| 0.0753 TBP|M00713 TBP F$TBP_Q6| -0.159 TATA_box|M00252 TATA V$TATA_01| -0.354 HiNF-D|HiNF-D| -0.522 E2F|M00516 E2F V$E2F_03| -0.56 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.652 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.665 Oct-1|M00138 V$OCT1_04 Oct-1| -0.798 GC_box|M00255 GC box V$GC_01| -1.74 SPT10|Spt10p| -3.02 AACCCT_box|AACCCT S. pombe| -4.35 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT1G09200_H3_A_thaliana ref|NC_003070.5|chr1:1-30432563:2972134-2973133 Arabidopsis thaliana chromosome 1, complete sequence IRF-1|M00747 IRF1| 105 - 111 + ttctctt 6.47 E2F|M00516 E2F V$E2F_03| 140 - 151 - atgtccgccaaa 6.63 IRF-7|M00453 V$IRF7_01 IRF-7| 300 - 317 - atgtctttcactttccaa 7.75 IRF-1|M00747 IRF1| 306 - 312 + ttcactt 7.4 IRF-1|M00747 IRF1| 352 - 358 + ttcactt 7.4 HiNF-D|HiNF-D| 431 - 446 + aacgctagagaacgaa 6.06 HEX|Hexamer| 519 - 524 - gaagtc 7.06 TATA_box|M00252 TATA V$TATA_01| 565 - 579 + gtatttaagcccaga 6.62 TBP|M00713 TBP F$TBP_Q6| 798 - 806 + ctcttatat 6.5 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 816 - 827 + aaaaaccaatga 6.52 NEG|Negative element| 895 - 909 + cagacgataaatatc 7.02 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT1G13370_H3_A_thaliana.fasta (1 sequences, 1000 bp, 35% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score HiNF-D|HiNF-D| 1.88 Oct-1|M00138 V$OCT1_04 Oct-1| 1.85 TBP|M00713 TBP F$TBP_Q6| 0.5 TATA_box|M00252 TATA V$TATA_01| 0.361 HEX|Hexamer| -0.184 IRF-1|M00747 IRF1| -0.25 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.419 E2F|M00516 E2F V$E2F_03| -0.613 IRF-7|M00453 V$IRF7_01 IRF-7| -0.699 NEG|Negative element| -0.904 GC_box|M00255 GC box V$GC_01| -1.95 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.09 SPT10|Spt10p| -3.33 AACCCT_box|AACCCT S. pombe| -3.49 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT1G13370_H3_A_thaliana ref|NC_003070.5|chr1:1-30432563:4588519-4589518 Arabidopsis thaliana chromosome 1, complete sequence Oct-1|M00138 V$OCT1_04 Oct-1| 17 - 39 + attttgatattcaaatttgacaa 6.07 HiNF-D|HiNF-D| 79 - 94 + agcaggagcgaccaag 8.39 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 85 - 96 + agcgaccaagaa 6.06 TATA_box|M00252 TATA V$TATA_01| 171 - 185 - gtgcagtctttatag 6.88 TBP|M00713 TBP F$TBP_Q6| 177 - 185 + tctttatag 6.26 HiNF-D|HiNF-D| 232 - 247 - gtccgtctcttcgccg 8.85 E2F|M00516 E2F V$E2F_03| 286 - 297 + tatggcgggtta 6.69 Oct-1|M00138 V$OCT1_04 Oct-1| 288 - 310 - tggcgggttatgcataaatgtca 8.1 Oct-1|M00138 V$OCT1_04 Oct-1| 289 - 311 + ggcgggttatgcataaatgtcaa 6.65 TBP|M00713 TBP F$TBP_Q6| 390 - 398 + ctcttatat 6.31 TATA_box|M00252 TATA V$TATA_01| 585 - 599 - tgggcctatttaaac 7.07 TBP|M00713 TBP F$TBP_Q6| 628 - 636 - atataaagc 6.39 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 729 - 740 + atggaccaataa 6.44 IRF-7|M00453 V$IRF7_01 IRF-7| 743 - 760 + atcgaaagcgcagatcgc 6.05 HiNF-D|HiNF-D| 748 - 763 + aagcgcagatcgccac 6.19 Oct-1|M00138 V$OCT1_04 Oct-1| 757 - 779 - tcgccacatatgcataatcttaa 8.76 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT1G19890.1_H3_A_thaliana.fasta (1 sequences, 1000 bp, 28.8% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score CCAAT_box|M00254 V$CAAT_01 CCAAT box| 2.39 IRF-1|M00747 IRF1| 1.18 HiNF-D|HiNF-D| 0.649 Oct-1|M00138 V$OCT1_04 Oct-1| 0.343 TATA_box|M00252 TATA V$TATA_01| 0.243 TBP|M00713 TBP F$TBP_Q6| 0.185 HEX|Hexamer| -0.253 NEG|Negative element| -0.471 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.02 IRF-7|M00453 V$IRF7_01 IRF-7| -1.5 E2F|M00516 E2F V$E2F_03| -2.57 GC_box|M00255 GC box V$GC_01| -3.57 SPT10|Spt10p| -3.87 AACCCT_box|AACCCT S. pombe| -4.8 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT1G19890.1_H3_A_thaliana ref|NC_003070.5|chr1:1-30432563:6904026-6905025 Arabidopsis thaliana chromosome 1, complete sequence TATA_box|M00252 TATA V$TATA_01| 62 - 76 + atataaaaagaggga 7.42 Oct-1|M00138 V$OCT1_04 Oct-1| 109 - 131 - accaagaatatacatatttcttt 6.4 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 153 - 164 - tcattgggtctt 6.14 IRF-1|M00747 IRF1| 366 - 372 - aagtgaa 7.48 TBP|M00713 TBP F$TBP_Q6| 488 - 496 - atataaatg 6.33 IRF-1|M00747 IRF1| 536 - 542 - aactgaa 6.83 Oct-1|M00138 V$OCT1_04 Oct-1| 545 - 567 + agacaagtatggaaaacaataga 6.99 HiNF-D|HiNF-D| 701 - 716 + aggcccactggcccag 7.18 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 705 - 716 - ccactggcccag 9.94 HiNF-D|HiNF-D| 709 - 724 + tggcccagagcgagac 6.33 HiNF-D|HiNF-D| 711 - 726 + gcccagagcgagacaa 6.5 NEG|Negative element| 782 - 796 - gactttgaggatctc 6.29 TBP|M00713 TBP F$TBP_Q6| 895 - 903 - atataagtg 6.51 IRF-1|M00747 IRF1| 899 - 905 - aagtgaa 7.48 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT1G19890.2_H3_A_thaliana.fasta (1 sequences, 1000 bp, 33.9% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score HiNF-D|HiNF-D| 1.73 IRF-1|M00747 IRF1| 1.38 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1.13 TBP|M00713 TBP F$TBP_Q6| 0.635 Oct-1|M00138 V$OCT1_04 Oct-1| -0.0716 HEX|Hexamer| -0.0825 TATA_box|M00252 TATA V$TATA_01| -0.312 NEG|Negative element| -0.613 IRF-7|M00453 V$IRF7_01 IRF-7| -0.731 SPT10|Spt10p| -1.73 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.77 E2F|M00516 E2F V$E2F_03| -2.21 GC_box|M00255 GC box V$GC_01| -3.93 AACCCT_box|AACCCT S. pombe| -4.09 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT1G19890.2_H3_A_thaliana ref|NC_003070.5|chr1:1-30432563:6904391-6905390 Arabidopsis thaliana chromosome 1, complete sequence IRF-1|M00747 IRF1| 1 - 7 - aagtgaa 7.45 TATA_box|M00252 TATA V$TATA_01| 59 - 73 - ttgatgtttttatac 6.31 TBP|M00713 TBP F$TBP_Q6| 123 - 131 - atataaatg 6.71 IRF-1|M00747 IRF1| 171 - 177 - aactgaa 6.8 Oct-1|M00138 V$OCT1_04 Oct-1| 180 - 202 + agacaagtatggaaaacaataga 6.79 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 340 - 351 - ccactggcccag 8.67 TBP|M00713 TBP F$TBP_Q6| 530 - 538 - atataagtg 6.68 IRF-1|M00747 IRF1| 534 - 540 - aagtgaa 7.45 TBP|M00713 TBP F$TBP_Q6| 709 - 717 + tctttatat 7.04 IRF-1|M00747 IRF1| 806 - 812 + ttctgtt 6.12 HiNF-D|HiNF-D| 869 - 884 - caccgtttccgtcctg 6.52 HiNF-D|HiNF-D| 886 - 901 - aaccgtcgctcttcgg 9.07 IRF-1|M00747 IRF1| 907 - 913 + ttctctt 6.76 IRF-1|M00747 IRF1| 914 - 920 + ttctctt 6.76 IRF-1|M00747 IRF1| 920 - 926 + ttctgtt 6.12 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT1G19890_H3_A_thaliana.fasta (1 sequences, 1000 bp, 36.7% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-1|M00747 IRF1| 1.17 HiNF-D|HiNF-D| 1.08 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.491 TBP|M00713 TBP F$TBP_Q6| 0.437 HEX|Hexamer| 0.218 Oct-1|M00138 V$OCT1_04 Oct-1| 0.0876 IRF-7|M00453 V$IRF7_01 IRF-7| -0.347 NEG|Negative element| -0.665 TATA_box|M00252 TATA V$TATA_01| -0.749 SPT10|Spt10p| -1.53 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.88 E2F|M00516 E2F V$E2F_03| -2.44 AACCCT_box|AACCCT S. pombe| -4.24 GC_box|M00255 GC box V$GC_01| -4.36 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT1G19890_H3_A_thaliana ref|NC_003070.5|chr1:1-30432563:6904542-6905541 Arabidopsis thaliana chromosome 1, complete sequence IRF-1|M00747 IRF1| 20 - 26 - aactgaa 6.94 Oct-1|M00138 V$OCT1_04 Oct-1| 29 - 51 + agacaagtatggaaaacaataga 7.36 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 189 - 200 - ccactggcccag 7.99 TBP|M00713 TBP F$TBP_Q6| 379 - 387 - atataagtg 6.94 IRF-1|M00747 IRF1| 383 - 389 - aagtgaa 7.69 TBP|M00713 TBP F$TBP_Q6| 558 - 566 + tctttatat 7.13 IRF-1|M00747 IRF1| 655 - 661 + ttctgtt 6.03 HiNF-D|HiNF-D| 735 - 750 - aaccgtcgctcttcgg 8.4 IRF-1|M00747 IRF1| 756 - 762 + ttctctt 6.58 IRF-1|M00747 IRF1| 763 - 769 + ttctctt 6.58 IRF-1|M00747 IRF1| 769 - 775 + ttctgtt 6.03 IRF-7|M00453 V$IRF7_01 IRF-7| 888 - 905 - cgcaaattgcctttccaa 6.19 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT1G51060_H2A_A_thaliana.fasta (1 sequences, 1000 bp, 31.6% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-7|M00453 V$IRF7_01 IRF-7| 0.934 IRF-1|M00747 IRF1| 0.688 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.378 TATA_box|M00252 TATA V$TATA_01| -0.0638 TBP|M00713 TBP F$TBP_Q6| -0.179 HEX|Hexamer| -0.252 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.464 Oct-1|M00138 V$OCT1_04 Oct-1| -0.529 HiNF-D|HiNF-D| -0.757 NEG|Negative element| -1.09 SPT10|Spt10p| -1.71 E2F|M00516 E2F V$E2F_03| -2.04 GC_box|M00255 GC box V$GC_01| -3.6 AACCCT_box|AACCCT S. pombe| -4.69 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT1G51060_H2A_A_thaliana ref|NC_003070.5|chr1:1-30432563:18929617-18930616 Arabidopsis thaliana chromosome 1, complete sequence IRF-1|M00747 IRF1| 160 - 166 + ttctctt 7.32 IRF-1|M00747 IRF1| 427 - 433 - aactgaa 6.47 IRF-7|M00453 V$IRF7_01 IRF-7| 526 - 543 + gggagattcgaaatttcc 7.86 IRF-7|M00453 V$IRF7_01 IRF-7| 669 - 686 - cccggattcaatttttga 7.59 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 715 - 726 - cgtttgggccga 6.19 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 870 - 880 - cttattggtta 6.81 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 871 - 882 - ttattggttaag 7.75 TATA_box|M00252 TATA V$TATA_01| 897 - 911 + gtatataaactctgg 7.35 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT1G52740_H2A_A_thaliana.fasta (1 sequences, 1000 bp, 37.9% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score E2F|M00516 E2F V$E2F_03| 3.25 NEG|Negative element| 0.967 IRF-7|M00453 V$IRF7_01 IRF-7| 0.61 HiNF-D|HiNF-D| 0.514 HEX|Hexamer| 0.168 IRF-1|M00747 IRF1| 0.0958 Oct-1|M00138 V$OCT1_04 Oct-1| -0.0561 TBP|M00713 TBP F$TBP_Q6| -0.621 TATA_box|M00252 TATA V$TATA_01| -0.707 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.44 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -2.08 SPT10|Spt10p| -3.18 GC_box|M00255 GC box V$GC_01| -3.59 AACCCT_box|AACCCT S. pombe| -3.61 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT1G52740_H2A_A_thaliana ref|NC_003070.5|chr1:1-30432563:19648588-19649587 Arabidopsis thaliana chromosome 1, complete sequence NEG|Negative element| 62 - 76 - taaactgagcgtaca 8.15 TATA_box|M00252 TATA V$TATA_01| 72 - 86 + gtacaaaaagcctct 6.61 Oct-1|M00138 V$OCT1_04 Oct-1| 129 - 151 + gaatgattatacagagaaaacaa 6.62 HiNF-D|HiNF-D| 160 - 175 - ctccctctcttctttt 6.03 Oct-1|M00138 V$OCT1_04 Oct-1| 165 - 187 - tctcttcttttgaatcaaaacat 6.05 IRF-1|M00747 IRF1| 442 - 448 + ttctctt 6.27 NEG|Negative element| 474 - 488 - gatatttggcgggaa 6.33 E2F|M00516 E2F V$E2F_03| 478 - 489 + tttggcgggaaa 10.7 E2F|M00516 E2F V$E2F_03| 478 - 489 - tttggcgggaaa 8.88 HiNF-D|HiNF-D| 526 - 541 + aaacccagcggtagcg 6.68 HiNF-D|HiNF-D| 532 - 547 + agcggtagcgacaagg 6.84 IRF-7|M00453 V$IRF7_01 IRF-7| 645 - 662 + ttgggaatcgaaatggtc 7.61 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT1G54690_H2A_A_thaliana.fasta (1 sequences, 1000 bp, 34.1% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score AACCCT_box|AACCCT S. pombe| 1.89 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.982 HiNF-D|HiNF-D| 0.944 HEX|Hexamer| 0.00507 IRF-1|M00747 IRF1| -0.504 Oct-1|M00138 V$OCT1_04 Oct-1| -0.538 NEG|Negative element| -0.541 E2F|M00516 E2F V$E2F_03| -0.661 TBP|M00713 TBP F$TBP_Q6| -0.668 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.853 TATA_box|M00252 TATA V$TATA_01| -1.01 IRF-7|M00453 V$IRF7_01 IRF-7| -1.21 SPT10|Spt10p| -4.19 GC_box|M00255 GC box V$GC_01| -4.65 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT1G54690_H2A_A_thaliana ref|NC_003070.5|chr1:1-30432563:20418843-20419842 Arabidopsis thaliana chromosome 1, complete sequence AACCCT_box|AACCCT S. pombe| 673 - 695 - aaccgaattatagttttggtgca 7.39 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 827 - 838 + actaaccaatca 8.5 AACCCT_box|AACCCT S. pombe| 869 - 891 + gaaatcacaacctaaaccctaaa 9.32 HiNF-D|HiNF-D| 973 - 988 + agttccggcgccggca 6.15 HiNF-D|HiNF-D| 975 - 990 - ttccggcgccggcagt 7.96 E2F|M00516 E2F V$E2F_03| 976 - 987 + tccggcgccggc 6.06 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT1G75600_H3_A_thaliana.fasta (1 sequences, 1000 bp, 37.6% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score HiNF-D|HiNF-D| 1.29 SPT10|Spt10p| 0.909 HEX|Hexamer| 0.46 IRF-1|M00747 IRF1| 0.188 TBP|M00713 TBP F$TBP_Q6| 0.147 Oct-1|M00138 V$OCT1_04 Oct-1| -0.097 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.313 NEG|Negative element| -0.384 IRF-7|M00453 V$IRF7_01 IRF-7| -0.734 TATA_box|M00252 TATA V$TATA_01| -1.22 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.28 E2F|M00516 E2F V$E2F_03| -2.6 GC_box|M00255 GC box V$GC_01| -3.05 AACCCT_box|AACCCT S. pombe| -5.62 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT1G75600_H3_A_thaliana ref|NC_003070.5|chr1:1-30432563:28393753-28394752 Arabidopsis thaliana chromosome 1, complete sequence TBP|M00713 TBP F$TBP_Q6| 103 - 111 + tccttatat 6.67 TBP|M00713 TBP F$TBP_Q6| 114 - 122 + gttttatat 6.16 Oct-1|M00138 V$OCT1_04 Oct-1| 203 - 225 - gggaagaacttgcatatgtgttt 7.08 TBP|M00713 TBP F$TBP_Q6| 307 - 315 - atataagtc 6.05 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 377 - 388 + ttggaccaataa 6.39 IRF-1|M00747 IRF1| 551 - 557 + ttcactt 7.28 SPT10|Spt10p| 699 - 719 - gaggaaaagctccgaggactc 7.18 HiNF-D|HiNF-D| 700 - 715 + aggaaaagctccgagg 7.59 IRF-7|M00453 V$IRF7_01 IRF-7| 749 - 766 - cttagttttgaatttgta 6.31 SPT10|Spt10p| 826 - 846 - ggcgaggaaatctgcgccgac 7.95 HiNF-D|HiNF-D| 886 - 901 - aaccgtcgctcttcgg 8.08 SPT10|Spt10p| 894 - 914 + ctcttcggtaagtttcacgat 6.27 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT2G28720_H2B_A_thaliana.fasta (1 sequences, 1000 bp, 35.9% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 1.43 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.279 IRF-1|M00747 IRF1| 0.184 HEX|Hexamer| -0.0809 HiNF-D|HiNF-D| -0.27 TATA_box|M00252 TATA V$TATA_01| -0.507 Oct-1|M00138 V$OCT1_04 Oct-1| -0.561 IRF-7|M00453 V$IRF7_01 IRF-7| -0.582 E2F|M00516 E2F V$E2F_03| -0.789 TBP|M00713 TBP F$TBP_Q6| -0.962 NEG|Negative element| -1.23 SPT10|Spt10p| -1.59 GC_box|M00255 GC box V$GC_01| -4.54 AACCCT_box|AACCCT S. pombe| -4.87 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT2G28720_H2B_A_thaliana ref|NC_003071.3|chr2:1-19705359:12333217-12334216 Arabidopsis thaliana chromosome 2, complete sequence Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 408 - 418 + ccgacaatgag 8.95 HiNF-D|HiNF-D| 555 - 570 - gtccggacctagtccg 6.3 TATA_box|M00252 TATA V$TATA_01| 591 - 605 + atttataagcccagg 6.46 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 787 - 798 + ctcatccaatca 7.72 E2F|M00516 E2F V$E2F_03| 883 - 894 - tttcccgagaaa 6.19 IRF-1|M00747 IRF1| 968 - 974 - aagagaa 6.74 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT2G28740_H4_A_thaliana.fasta (1 sequences, 1000 bp, 30.7% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-1|M00747 IRF1| 0.838 NEG|Negative element| 0.322 TBP|M00713 TBP F$TBP_Q6| 0.00581 HEX|Hexamer| -0.281 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.455 TATA_box|M00252 TATA V$TATA_01| -0.693 Oct-1|M00138 V$OCT1_04 Oct-1| -0.846 HiNF-D|HiNF-D| -0.884 E2F|M00516 E2F V$E2F_03| -1.64 IRF-7|M00453 V$IRF7_01 IRF-7| -1.64 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -2.46 SPT10|Spt10p| -3.26 AACCCT_box|AACCCT S. pombe| -3.74 GC_box|M00255 GC box V$GC_01| -5.08 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT2G28740_H4_A_thaliana ref|NC_003071.3|chr2:1-19705359:12337031-12338030 Arabidopsis thaliana chromosome 2, complete sequence IRF-1|M00747 IRF1| 83 - 89 + ttcactt 7.42 NEG|Negative element| 247 - 261 + ttggagctcaagggc 7.4 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 253 - 263 - ctcaagggctt 6.91 IRF-1|M00747 IRF1| 279 - 285 + ttcagtt 7.12 TBP|M00713 TBP F$TBP_Q6| 495 - 503 + cccttatag 6.41 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT2G37470_H2B_A_thaliana.fasta (1 sequences, 1000 bp, 34.1% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-1|M00747 IRF1| 1.13 TBP|M00713 TBP F$TBP_Q6| -0.16 NEG|Negative element| -0.249 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.251 HEX|Hexamer| -0.265 Oct-1|M00138 V$OCT1_04 Oct-1| -0.266 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.591 TATA_box|M00252 TATA V$TATA_01| -0.827 IRF-7|M00453 V$IRF7_01 IRF-7| -1 HiNF-D|HiNF-D| -1.32 E2F|M00516 E2F V$E2F_03| -2.06 AACCCT_box|AACCCT S. pombe| -2.36 SPT10|Spt10p| -3.61 GC_box|M00255 GC box V$GC_01| -3.84 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT2G37470_H2B_A_thaliana ref|NC_003071.3|chr2:1-19705359:15742917-15743916 Arabidopsis thaliana chromosome 2, complete sequence IRF-1|M00747 IRF1| 160 - 166 - aagagaa 6.01 Oct-1|M00138 V$OCT1_04 Oct-1| 357 - 379 - acgcgatatttccagattcccac 6.54 IRF-1|M00747 IRF1| 527 - 533 + ttcactt 7.95 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 544 - 555 - tgaatggtccat 7.15 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 650 - 660 - ctcgttggcaa 6.72 IRF-1|M00747 IRF1| 678 - 684 - aagtgaa 7.27 NEG|Negative element| 707 - 721 - ggccttgagctataa 6.22 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT2G38810_H2A_A_thaliana.fasta (1 sequences, 1000 bp, 36.6% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1.63 Oct-1|M00138 V$OCT1_04 Oct-1| 1.59 IRF-1|M00747 IRF1| 0.839 NEG|Negative element| 0.458 HEX|Hexamer| 0.316 IRF-7|M00453 V$IRF7_01 IRF-7| -0.0858 TBP|M00713 TBP F$TBP_Q6| -0.188 HiNF-D|HiNF-D| -0.194 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.5 TATA_box|M00252 TATA V$TATA_01| -1.73 AACCCT_box|AACCCT S. pombe| -2.14 SPT10|Spt10p| -2.24 GC_box|M00255 GC box V$GC_01| -2.83 E2F|M00516 E2F V$E2F_03| -3.36 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT2G38810_H2A_A_thaliana ref|NC_003071.3|chr2:1-19705359:16226821-16227820 Arabidopsis thaliana chromosome 2, complete sequence IRF-7|M00453 V$IRF7_01 IRF-7| 96 - 113 + tgcgaagacgacggcagc 6.44 HEX|Hexamer| 141 - 146 - gaaatc 6.06 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 212 - 223 - cgagtggctcgg 7.62 NEG|Negative element| 608 - 622 - gatactgagccttaa 7.7 IRF-7|M00453 V$IRF7_01 IRF-7| 658 - 675 + ctggaaatctaagccaaa 6.29 HEX|Hexamer| 661 - 666 - gaaatc 6.06 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 666 - 677 + ctaagccaaaca 8.97 TBP|M00713 TBP F$TBP_Q6| 757 - 765 + tacttatat 6.57 IRF-1|M00747 IRF1| 838 - 844 - aagtgaa 8.21 Oct-1|M00138 V$OCT1_04 Oct-1| 842 - 864 + gaatgatcaagcaaattaaagga 9.02 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT3G09480_H2B_A_thaliana.fasta (1 sequences, 1000 bp, 43.5% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-1|M00747 IRF1| 1 TATA_box|M00252 TATA V$TATA_01| 0.648 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.477 HEX|Hexamer| 0.353 TBP|M00713 TBP F$TBP_Q6| 0.346 IRF-7|M00453 V$IRF7_01 IRF-7| 0.308 HiNF-D|HiNF-D| 0.133 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.244 Oct-1|M00138 V$OCT1_04 Oct-1| -0.822 AACCCT_box|AACCCT S. pombe| -0.877 NEG|Negative element| -0.976 E2F|M00516 E2F V$E2F_03| -1.02 SPT10|Spt10p| -1.81 GC_box|M00255 GC box V$GC_01| -3.88 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT3G09480_H2B_A_thaliana ref|NC_003074.4|chr3:1-23470805:2915255-2916254 Arabidopsis thaliana chromosome 3, complete sequence AACCCT_box|AACCCT S. pombe| 23 - 45 - tttaggtttagagttgtaatact 6.63 IRF-1|M00747 IRF1| 122 - 128 + ttcactt 8.04 IRF-7|M00453 V$IRF7_01 IRF-7| 239 - 256 - cttaaatttgatttccgt 6.85 HiNF-D|HiNF-D| 340 - 355 - tcgcggcgcgtttgtt 6.27 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 480 - 490 - ctgattggtgt 6.78 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 497 - 508 - tgcttggtctct 6.26 IRF-1|M00747 IRF1| 660 - 666 - aagagaa 6.65 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 865 - 876 + aaaaaccaatca 7.8 TATA_box|M00252 TATA V$TATA_01| 889 - 903 - cacctctatatatat 7.28 TBP|M00713 TBP F$TBP_Q6| 893 - 901 + tctatatat 6.58 TATA_box|M00252 TATA V$TATA_01| 894 - 908 + ctatatatatctcgg 7.27 TBP|M00713 TBP F$TBP_Q6| 895 - 903 + tatatatat 6.49 IRF-7|M00453 V$IRF7_01 IRF-7| 953 - 970 + gcgaaatccgaattttat 6.06 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT3G20670_H2A_A_thaliana.fasta (1 sequences, 1000 bp, 28.9% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score E2F|M00516 E2F V$E2F_03| 1.23 GC_box|M00255 GC box V$GC_01| 0.947 TATA_box|M00252 TATA V$TATA_01| 0.764 Oct-1|M00138 V$OCT1_04 Oct-1| 0.52 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 0.00225 HiNF-D|HiNF-D| -0.171 TBP|M00713 TBP F$TBP_Q6| -0.177 HEX|Hexamer| -0.186 AACCCT_box|AACCCT S. pombe| -0.213 IRF-1|M00747 IRF1| -0.361 NEG|Negative element| -0.466 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.527 IRF-7|M00453 V$IRF7_01 IRF-7| -2.09 SPT10|Spt10p| -4.59 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT3G20670_H2A_A_thaliana ref|NC_003074.4|chr3:1-23470805:7228479-7229478 Arabidopsis thaliana chromosome 3, complete sequence TATA_box|M00252 TATA V$TATA_01| 89 - 103 + gtttaaaaggcgttc 7.53 E2F|M00516 E2F V$E2F_03| 113 - 124 + tttgacgcgaag 8.69 E2F|M00516 E2F V$E2F_03| 113 - 124 - tttgacgcgaag 6.45 NEG|Negative element| 114 - 128 + ttgacgcgaagaagg 6.46 GC_box|M00255 GC box V$GC_01| 123 - 136 + agaaggaggtggct 8.47 TATA_box|M00252 TATA V$TATA_01| 259 - 273 - gctctgcttatatat 6.84 AACCCT_box|AACCCT S. pombe| 748 - 770 + tcaatcccaattctaacaatgaa 7.36 Oct-1|M00138 V$OCT1_04 Oct-1| 778 - 800 + gtataaaaacgtaaattcaagcg 7.58 TATA_box|M00252 TATA V$TATA_01| 778 - 792 + gtataaaaacgtaaa 6.67 Oct-1|M00138 V$OCT1_04 Oct-1| 798 - 820 + gcgtgccaattataaaccgtcga 6.4 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 868 - 879 - ttattggataag 6.25 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 911 - 922 + aataaccaaaga 6.27 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 913 - 923 + taaccaaagag 7.45 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT3G27360_H3_A_thaliana.fasta (1 sequences, 1000 bp, 36.3% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score CCAAT_box|M00254 V$CAAT_01 CCAAT box| 2.27 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 1.28 HEX|Hexamer| 0.387 IRF-1|M00747 IRF1| -0.111 HiNF-D|HiNF-D| -0.253 Oct-1|M00138 V$OCT1_04 Oct-1| -0.356 TATA_box|M00252 TATA V$TATA_01| -0.409 TBP|M00713 TBP F$TBP_Q6| -0.643 NEG|Negative element| -0.757 IRF-7|M00453 V$IRF7_01 IRF-7| -2.11 SPT10|Spt10p| -3.09 E2F|M00516 E2F V$E2F_03| -3.23 AACCCT_box|AACCCT S. pombe| -3.65 GC_box|M00255 GC box V$GC_01| -4.52 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT3G27360_H3_A_thaliana ref|NC_003074.4|chr3:1-23470805:10131106-10132105 Arabidopsis thaliana chromosome 3, complete sequence Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 145 - 155 - ctctttggtta 7.17 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 146 - 157 - tctttggttact 7.23 HiNF-D|HiNF-D| 209 - 224 - tttccgagcttgcggg 6.29 HEX|Hexamer| 232 - 237 - gaagtc 6.94 Oct-1|M00138 V$OCT1_04 Oct-1| 458 - 480 + ttatgttcatgtatgtttgaaga 6.75 IRF-1|M00747 IRF1| 783 - 789 - aactgaa 6.69 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 799 - 809 - ctgattggtta 8.61 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 800 - 811 - tgattggttact 9.76 TATA_box|M00252 TATA V$TATA_01| 900 - 914 + gtataaaaaagcatc 6.92 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT3G45930_H4_A_thaliana.fasta (1 sequences, 1000 bp, 34.4% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score E2F|M00516 E2F V$E2F_03| 2.34 AACCCT_box|AACCCT S. pombe| 0.783 IRF-1|M00747 IRF1| 0.464 TBP|M00713 TBP F$TBP_Q6| 0.385 NEG|Negative element| 0.0638 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.242 HEX|Hexamer| -0.345 Oct-1|M00138 V$OCT1_04 Oct-1| -0.479 HiNF-D|HiNF-D| -0.625 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -1.2 TATA_box|M00252 TATA V$TATA_01| -1.45 IRF-7|M00453 V$IRF7_01 IRF-7| -1.51 SPT10|Spt10p| -2.65 GC_box|M00255 GC box V$GC_01| -4.96 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT3G45930_H4_A_thaliana ref|NC_003074.4|chr3:1-23470805:16893376-16894375 Arabidopsis thaliana chromosome 3, complete sequence Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 136 - 146 + aaaccaacgag 7.03 AACCCT_box|AACCCT S. pombe| 159 - 181 + cccgtgaaaaccctaacatagca 7.51 AACCCT_box|AACCCT S. pombe| 182 - 204 - gaatgggttacatttgtgatcaa 7.74 HiNF-D|HiNF-D| 256 - 271 - cacccactctgtctgg 6.11 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 318 - 329 + aacgaccaaaca 6.09 E2F|M00516 E2F V$E2F_03| 689 - 700 + tttggcgctata 9.91 NEG|Negative element| 690 - 704 + ttggcgctatattcc 6.72 IRF-1|M00747 IRF1| 741 - 747 + ttcactt 7.61 NEG|Negative element| 769 - 783 - aatattaagcgtcga 6.51 TBP|M00713 TBP F$TBP_Q6| 896 - 904 - atataaatg 6.79 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT3G45980_H2B_A_thaliana.fasta (1 sequences, 1000 bp, 32.7% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score Oct-1|M00138 V$OCT1_04 Oct-1| 2.17 E2F|M00516 E2F V$E2F_03| 1.3 IRF-1|M00747 IRF1| 1 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.847 SPT10|Spt10p| 0.534 HiNF-D|HiNF-D| 0.524 TBP|M00713 TBP F$TBP_Q6| 0.148 TATA_box|M00252 TATA V$TATA_01| 0.0539 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.333 HEX|Hexamer| -0.424 NEG|Negative element| -0.74 IRF-7|M00453 V$IRF7_01 IRF-7| -1.49 GC_box|M00255 GC box V$GC_01| -4.74 AACCCT_box|AACCCT S. pombe| -5.74 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT3G45980_H2B_A_thaliana ref|NC_003074.4|chr3:1-23470805:16908866-16909865 Arabidopsis thaliana chromosome 3, complete sequence IRF-1|M00747 IRF1| 34 - 40 + ttcagtt 6.97 IRF-1|M00747 IRF1| 41 - 47 + ttcactt 7.37 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 342 - 353 + tatagccaagca 7.74 Oct-1|M00138 V$OCT1_04 Oct-1| 367 - 389 + tcttgtttatgcaaatacaacaa 9.62 TBP|M00713 TBP F$TBP_Q6| 392 - 400 + tctttatat 6.77 IRF-1|M00747 IRF1| 465 - 471 + ttcagtt 6.97 Oct-1|M00138 V$OCT1_04 Oct-1| 557 - 579 - agttagttttttcataattgtat 6.25 Oct-1|M00138 V$OCT1_04 Oct-1| 661 - 683 + gagcgggaacggagattttaaca 6.56 E2F|M00516 E2F V$E2F_03| 682 - 693 - caccgcgctaaa 8.22 HiNF-D|HiNF-D| 713 - 728 - cgtcatcgatcccgct 6.43 TATA_box|M00252 TATA V$TATA_01| 735 - 749 + gtttataaaccgtcg 6.98 SPT10|Spt10p| 779 - 799 + cccatctcatcgatcctcgtc 6.4 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 807 - 818 + aataaccaatca 7.62 HiNF-D|HiNF-D| 933 - 948 + aacaatggcgccgaga 6.15 E2F|M00516 E2F V$E2F_03| 936 - 947 + aatggcgccgag 6.6 E2F|M00516 E2F V$E2F_03| 936 - 947 - aatggcgccgag 6.94 SPT10|Spt10p| 939 - 959 - ggcgccgagagcagagaagaa 7.85 E2F|M00516 E2F V$E2F_03| 958 - 969 - aagcccgcggag 6.5 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 977 - 987 + cagccgccgag 6.95 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT3G46030_H2B_A_thaliana.fasta (1 sequences, 1000 bp, 37.9% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score HiNF-D|HiNF-D| 0.871 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.433 Oct-1|M00138 V$OCT1_04 Oct-1| 0.339 IRF-1|M00747 IRF1| 0.266 IRF-7|M00453 V$IRF7_01 IRF-7| 0.189 NEG|Negative element| 0.0932 TATA_box|M00252 TATA V$TATA_01| -0.00326 HEX|Hexamer| -0.0746 TBP|M00713 TBP F$TBP_Q6| -0.112 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.79 AACCCT_box|AACCCT S. pombe| -1.26 SPT10|Spt10p| -1.37 E2F|M00516 E2F V$E2F_03| -1.74 GC_box|M00255 GC box V$GC_01| -1.91 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT3G46030_H2B_A_thaliana ref|NC_003074.4|chr3:1-23470805:16924988-16925987 Arabidopsis thaliana chromosome 3, complete sequence IRF-7|M00453 V$IRF7_01 IRF-7| 198 - 215 - aacgaattcgattcccta 7.56 HiNF-D|HiNF-D| 329 - 344 + tagaggagagatggag 6.9 HiNF-D|HiNF-D| 379 - 394 - agccgccgctccgacg 6.48 HiNF-D|HiNF-D| 398 - 413 - cttgctcgcttggcct 7.27 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 404 - 415 - cgcttggccttg 7.39 NEG|Negative element| 443 - 457 - tatttttagggtttt 6.27 NEG|Negative element| 451 - 465 - gggttttcgctttta 6.25 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 552 - 563 + tgtaaccaaaca 6.45 IRF-1|M00747 IRF1| 590 - 596 + ttctctt 6.98 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 695 - 706 - ttaatggcccat 6.1 NEG|Negative element| 727 - 741 + tagccgttcactgcc 6.39 Oct-1|M00138 V$OCT1_04 Oct-1| 746 - 768 + acggatttattctaatctaacgg 7.51 TATA_box|M00252 TATA V$TATA_01| 834 - 848 - tggtcatatatatac 6.07 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT3G46320_H4_A_thaliana.fasta (1 sequences, 1000 bp, 34.2% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score E2F|M00516 E2F V$E2F_03| 2.32 TBP|M00713 TBP F$TBP_Q6| 0.967 AACCCT_box|AACCCT S. pombe| 0.819 IRF-1|M00747 IRF1| 0.428 NEG|Negative element| 0.0787 Oct-1|M00138 V$OCT1_04 Oct-1| -0.118 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.19 HEX|Hexamer| -0.337 HiNF-D|HiNF-D| -0.613 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -1.18 TATA_box|M00252 TATA V$TATA_01| -1.35 IRF-7|M00453 V$IRF7_01 IRF-7| -1.45 SPT10|Spt10p| -2.58 GC_box|M00255 GC box V$GC_01| -4.97 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT3G46320_H4_A_thaliana ref|NC_003074.4|chr3:1-23470805:17031339-17032338 Arabidopsis thaliana chromosome 3, complete sequence Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 122 - 132 + aaaccaacgag 7.11 AACCCT_box|AACCCT S. pombe| 145 - 167 + cccgtgaaaaccctaacatagca 7.58 AACCCT_box|AACCCT S. pombe| 168 - 190 - gaatgggttacatttgtgatcaa 7.75 HiNF-D|HiNF-D| 242 - 257 - cacccactctgtctgg 6.1 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 304 - 315 + aacgaccaaaca 6.17 E2F|M00516 E2F V$E2F_03| 689 - 700 + tttggcgctata 9.88 NEG|Negative element| 690 - 704 + ttggcgctatattcc 6.68 Oct-1|M00138 V$OCT1_04 Oct-1| 721 - 743 - atttgaaattttcataaactttc 6.22 IRF-1|M00747 IRF1| 741 - 747 + ttcactt 7.56 NEG|Negative element| 769 - 783 - aatattaagcgtcga 6.54 TBP|M00713 TBP F$TBP_Q6| 896 - 904 - atataaatg 6.79 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT3G53650_H2B_A_thaliana.fasta (1 sequences, 1000 bp, 41.4% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score TATA_box|M00252 TATA V$TATA_01| 1.1 TBP|M00713 TBP F$TBP_Q6| 1.1 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.906 HEX|Hexamer| 0.427 Oct-1|M00138 V$OCT1_04 Oct-1| 0.313 IRF-1|M00747 IRF1| 0.303 AACCCT_box|AACCCT S. pombe| 0.209 HiNF-D|HiNF-D| 0.0527 IRF-7|M00453 V$IRF7_01 IRF-7| -0.188 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.62 NEG|Negative element| -0.98 E2F|M00516 E2F V$E2F_03| -2.09 GC_box|M00255 GC box V$GC_01| -2.62 SPT10|Spt10p| -3.07 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT3G53650_H2B_A_thaliana ref|NC_003074.4|chr3:1-23470805:19899343-19900342 Arabidopsis thaliana chromosome 3, complete sequence TATA_box|M00252 TATA V$TATA_01| 100 - 114 - tatggctttttaaag 6.73 TATA_box|M00252 TATA V$TATA_01| 162 - 176 - ccaccacttttatag 7.94 TBP|M00713 TBP F$TBP_Q6| 168 - 176 + cttttatag 6.27 HEX|Hexamer| 500 - 505 + gacttc 6.53 AACCCT_box|AACCCT S. pombe| 603 - 625 - attagggttagggttcgattttc 7.73 IRF-7|M00453 V$IRF7_01 IRF-7| 610 - 627 - ttagggttcgattttctc 6.6 HiNF-D|HiNF-D| 625 - 640 - ctcccgcgctctctct 6.44 HEX|Hexamer| 657 - 662 + gacttc 6.53 TBP|M00713 TBP F$TBP_Q6| 682 - 690 - atataaaaa 7.96 Oct-1|M00138 V$OCT1_04 Oct-1| 696 - 718 + gtcggcatcggcaaattaaaagg 7.28 IRF-1|M00747 IRF1| 778 - 784 - aagagga 6.15 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 862 - 873 + ggtaaccaatga 8.47 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 864 - 874 + taaccaatgaa 6.59 TATA_box|M00252 TATA V$TATA_01| 890 - 904 + ctatataaacaaatg 7.13 TBP|M00713 TBP F$TBP_Q6| 892 - 900 - atataaaca 6.83 IRF-1|M00747 IRF1| 944 - 950 - aagtgat 6.16 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT3G53730_H4_A_thaliana.fasta (1 sequences, 1000 bp, 34.7% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score HiNF-D|HiNF-D| 1.75 IRF-1|M00747 IRF1| 1.05 GC_box|M00255 GC box V$GC_01| 0.37 HEX|Hexamer| 0.366 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.114 Oct-1|M00138 V$OCT1_04 Oct-1| -0.462 NEG|Negative element| -0.857 IRF-7|M00453 V$IRF7_01 IRF-7| -0.912 TBP|M00713 TBP F$TBP_Q6| -0.945 SPT10|Spt10p| -0.957 TATA_box|M00252 TATA V$TATA_01| -1.23 E2F|M00516 E2F V$E2F_03| -1.71 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.12 AACCCT_box|AACCCT S. pombe| -2.6 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT3G53730_H4_A_thaliana ref|NC_003074.4|chr3:1-23470805:19923948-19924947 Arabidopsis thaliana chromosome 3, complete sequence HiNF-D|HiNF-D| 7 - 22 - acgcaggtctggcggt 6.1 HiNF-D|HiNF-D| 11 - 26 + aggtctggcggtggtg 8.49 HiNF-D|HiNF-D| 13 - 28 - gtctggcggtggtggt 7.68 GC_box|M00255 GC box V$GC_01| 16 - 29 + tggcggtggtggtg 7.13 IRF-1|M00747 IRF1| 44 - 50 - aagtgaa 7.85 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 176 - 187 + tgagaccagtga 7.06 HEX|Hexamer| 364 - 369 - gaagtc 7.18 IRF-1|M00747 IRF1| 390 - 396 + ttctctt 6.49 HiNF-D|HiNF-D| 672 - 687 - tcccagagcgctcctt 7.2 HiNF-D|HiNF-D| 736 - 751 + aggcataatgacgcgg 6.01 SPT10|Spt10p| 794 - 814 - cacgcggatagatgataacga 6.38 GC_box|M00255 GC box V$GC_01| 874 - 887 - gcactcctcctctt 6.83 HiNF-D|HiNF-D| 877 - 892 - ctcctcctcttctcgt 6.27 IRF-1|M00747 IRF1| 921 - 927 + ttcattt 6.03 IRF-7|M00453 V$IRF7_01 IRF-7| 974 - 991 - ttcgaatttaatttccca 6.18 IRF-1|M00747 IRF1| 991 - 997 - aagagaa 6.8 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT3G54560_H2A_A_thaliana.fasta (1 sequences, 1000 bp, 36.4% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 1.42 E2F|M00516 E2F V$E2F_03| 0.898 Oct-1|M00138 V$OCT1_04 Oct-1| 0.575 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.497 HiNF-D|HiNF-D| -0.0603 HEX|Hexamer| -0.147 IRF-1|M00747 IRF1| -0.161 IRF-7|M00453 V$IRF7_01 IRF-7| -0.322 TBP|M00713 TBP F$TBP_Q6| -0.466 NEG|Negative element| -1.11 TATA_box|M00252 TATA V$TATA_01| -1.18 GC_box|M00255 GC box V$GC_01| -2.51 SPT10|Spt10p| -3.26 AACCCT_box|AACCCT S. pombe| -4.13 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT3G54560_H2A_A_thaliana ref|NC_003074.4|chr3:1-23470805:20207146-20208145 Arabidopsis thaliana chromosome 3, complete sequence E2F|M00516 E2F V$E2F_03| 2 - 13 - ttaaccgccaaa 8.24 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 6 - 16 + ccgccaaagcg 8.01 IRF-7|M00453 V$IRF7_01 IRF-7| 7 - 24 + cgccaaagcgtaggtttc 6.1 Oct-1|M00138 V$OCT1_04 Oct-1| 36 - 58 + ttgaaaatatttaaaaactccca 6.13 TBP|M00713 TBP F$TBP_Q6| 44 - 52 - atttaaaaa 6.04 E2F|M00516 E2F V$E2F_03| 52 - 63 - actcccaccaaa 6.22 Oct-1|M00138 V$OCT1_04 Oct-1| 659 - 681 + caatgtttgtgctaattatacaa 6.22 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 696 - 706 - ctcactggttg 8.5 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 697 - 708 - tcactggttgct 6.74 Oct-1|M00138 V$OCT1_04 Oct-1| 948 - 970 + gcatagccatacaagtagagaga 6.78 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 949 - 960 + catagccataca 7.53 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT4G13570_H2A_A_thaliana.fasta (1 sequences, 1000 bp, 32.6% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score HEX|Hexamer| 0.326 Oct-1|M00138 V$OCT1_04 Oct-1| 0.182 IRF-1|M00747 IRF1| -0.0957 TBP|M00713 TBP F$TBP_Q6| -0.259 HiNF-D|HiNF-D| -0.914 TATA_box|M00252 TATA V$TATA_01| -1.04 NEG|Negative element| -1.44 IRF-7|M00453 V$IRF7_01 IRF-7| -1.58 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.76 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -2.23 GC_box|M00255 GC box V$GC_01| -3.01 E2F|M00516 E2F V$E2F_03| -3.04 SPT10|Spt10p| -4.67 AACCCT_box|AACCCT S. pombe| -5.01 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT4G13570_H2A_A_thaliana ref|NC_003075.3|chr4:1-18585042:7884392-7885391 Arabidopsis thaliana chromosome 4, complete sequence Oct-1|M00138 V$OCT1_04 Oct-1| 32 - 54 - tctatgaagtaacatacacattc 6.12 HEX|Hexamer| 222 - 227 - gaagtc 7.04 Oct-1|M00138 V$OCT1_04 Oct-1| 597 - 619 - tcatataatttgactaaataaac 6.16 TBP|M00713 TBP F$TBP_Q6| 737 - 745 - ctataaatg 6.07 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT4G27230.1_H2A_A_thaliana.fasta (1 sequences, 1000 bp, 38.5% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-1|M00747 IRF1| 1.35 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1.35 HiNF-D|HiNF-D| 0.832 IRF-7|M00453 V$IRF7_01 IRF-7| 0.555 HEX|Hexamer| 0.287 TBP|M00713 TBP F$TBP_Q6| -0.318 NEG|Negative element| -0.711 Oct-1|M00138 V$OCT1_04 Oct-1| -0.926 E2F|M00516 E2F V$E2F_03| -1.02 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.12 TATA_box|M00252 TATA V$TATA_01| -1.22 GC_box|M00255 GC box V$GC_01| -1.67 SPT10|Spt10p| -2.39 AACCCT_box|AACCCT S. pombe| -3.06 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT4G27230.1_H2A_A_thaliana ref|NC_003075.3|chr4:1-18585042:13637727-13638726 Arabidopsis thaliana chromosome 4, complete sequence IRF-1|M00747 IRF1| 6 - 12 - aagtgaa 8.06 TBP|M00713 TBP F$TBP_Q6| 65 - 73 - aaataaaaa 6.42 HiNF-D|HiNF-D| 145 - 160 + aaggacaaagcaggtg 6.11 IRF-7|M00453 V$IRF7_01 IRF-7| 165 - 182 + cacgaatctcaaatcacg 6.29 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 239 - 250 - tcattggtcaga 8.84 HEX|Hexamer| 437 - 442 - gaagtc 6.98 IRF-7|M00453 V$IRF7_01 IRF-7| 463 - 480 - ctgggcttcaattccctg 7.36 HiNF-D|HiNF-D| 533 - 548 + tgccggagctccggtc 6.87 HiNF-D|HiNF-D| 533 - 548 - tgccggagctccggtc 7.42 IRF-7|M00453 V$IRF7_01 IRF-7| 903 - 920 + ctcaaattcgaaaaatgt 6.25 IRF-1|M00747 IRF1| 926 - 932 + ttcactt 7.38 IRF-7|M00453 V$IRF7_01 IRF-7| 965 - 982 + ttgggaactgaatttggt 6.21 IRF-1|M00747 IRF1| 970 - 976 - aactgaa 7.54 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT4G27230.2_H2A_A_thaliana.fasta (1 sequences, 1000 bp, 32.8% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1.81 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 1.72 IRF-1|M00747 IRF1| 0.585 HiNF-D|HiNF-D| 0.0152 E2F|M00516 E2F V$E2F_03| -0.261 HEX|Hexamer| -0.264 TBP|M00713 TBP F$TBP_Q6| -0.964 Oct-1|M00138 V$OCT1_04 Oct-1| -0.989 NEG|Negative element| -1.05 IRF-7|M00453 V$IRF7_01 IRF-7| -1.12 TATA_box|M00252 TATA V$TATA_01| -1.56 GC_box|M00255 GC box V$GC_01| -1.67 SPT10|Spt10p| -2.88 AACCCT_box|AACCCT S. pombe| -3.68 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT4G27230.2_H2A_A_thaliana ref|NC_003075.3|chr4:1-18585042:13638331-13639330 Arabidopsis thaliana chromosome 4, complete sequence Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 269 - 279 - ctcattgggtt 9.29 IRF-1|M00747 IRF1| 610 - 616 - aagtgaa 7.84 HiNF-D|HiNF-D| 749 - 764 + aaggacaaagcaggtg 6.55 E2F|M00516 E2F V$E2F_03| 762 - 773 + gtgggcgcacga 7.05 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 843 - 854 - tcattggtcaga 9.35 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT4G40030.1_H3_A_thaliana.fasta (1 sequences, 1000 bp, 36.5% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score AACCCT_box|AACCCT S. pombe| 0.544 HiNF-D|HiNF-D| -0.183 IRF-1|M00747 IRF1| -0.473 TBP|M00713 TBP F$TBP_Q6| -0.501 NEG|Negative element| -0.584 HEX|Hexamer| -0.596 Oct-1|M00138 V$OCT1_04 Oct-1| -0.681 IRF-7|M00453 V$IRF7_01 IRF-7| -0.731 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -1.6 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.86 TATA_box|M00252 TATA V$TATA_01| -2.08 SPT10|Spt10p| -2.3 GC_box|M00255 GC box V$GC_01| -2.64 E2F|M00516 E2F V$E2F_03| -2.9 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT4G40030.1_H3_A_thaliana ref|NC_003075.3|chr4:1-18585042:18556260-18557259 Arabidopsis thaliana chromosome 4, complete sequence TBP|M00713 TBP F$TBP_Q6| 515 - 523 - aaataaagg 6.28 AACCCT_box|AACCCT S. pombe| 738 - 760 - atctggattagggttttaagtgg 8.08 HiNF-D|HiNF-D| 861 - 876 + aagcaaaccgctcgta 6.41 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT4G40030.2_H3_A_thaliana.fasta (1 sequences, 1000 bp, 35.4% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score AACCCT_box|AACCCT S. pombe| 0.254 TBP|M00713 TBP F$TBP_Q6| -0.219 Oct-1|M00138 V$OCT1_04 Oct-1| -0.255 IRF-7|M00453 V$IRF7_01 IRF-7| -0.324 IRF-1|M00747 IRF1| -0.35 HEX|Hexamer| -0.521 NEG|Negative element| -0.556 HiNF-D|HiNF-D| -0.694 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -1.69 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.83 TATA_box|M00252 TATA V$TATA_01| -1.93 GC_box|M00255 GC box V$GC_01| -2.31 E2F|M00516 E2F V$E2F_03| -2.82 SPT10|Spt10p| -3.17 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT4G40030.2_H3_A_thaliana ref|NC_003075.3|chr4:1-18585042:18556411-18557410 Arabidopsis thaliana chromosome 4, complete sequence IRF-7|M00453 V$IRF7_01 IRF-7| 503 - 520 + aaacaaaacaaaagtcag 6.59 TBP|M00713 TBP F$TBP_Q6| 666 - 674 - aaataaagg 6.48 AACCCT_box|AACCCT S. pombe| 889 - 911 - atctggattagggttttaagtgg 7.79 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT4G40030_H3_A_thaliana.fasta (1 sequences, 1000 bp, 38% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score AACCCT_box|AACCCT S. pombe| 0.504 HiNF-D|HiNF-D| -0.267 TBP|M00713 TBP F$TBP_Q6| -0.445 HEX|Hexamer| -0.45 Oct-1|M00138 V$OCT1_04 Oct-1| -0.592 IRF-1|M00747 IRF1| -0.607 NEG|Negative element| -0.655 IRF-7|M00453 V$IRF7_01 IRF-7| -0.675 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -1.59 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.02 TATA_box|M00252 TATA V$TATA_01| -2.1 SPT10|Spt10p| -2.31 GC_box|M00255 GC box V$GC_01| -2.94 E2F|M00516 E2F V$E2F_03| -3.04 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT4G40030_H3_A_thaliana ref|NC_003075.3|chr4:1-18585042:18556094-18557093 Arabidopsis thaliana chromosome 4, complete sequence IRF-7|M00453 V$IRF7_01 IRF-7| 186 - 203 + aaacaaaacaaaagtcag 6.01 TBP|M00713 TBP F$TBP_Q6| 349 - 357 - aaataaagg 6.36 AACCCT_box|AACCCT S. pombe| 572 - 594 - atctggattagggttttaagtgg 8.05 HiNF-D|HiNF-D| 695 - 710 + aagcaaaccgctcgta 6.28 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT4G40040.1_H3_A_thaliana.fasta (1 sequences, 1000 bp, 37.8% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-7|M00453 V$IRF7_01 IRF-7| 1.29 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.653 TATA_box|M00252 TATA V$TATA_01| 0.409 HEX|Hexamer| -0.116 NEG|Negative element| -0.361 TBP|M00713 TBP F$TBP_Q6| -0.408 Oct-1|M00138 V$OCT1_04 Oct-1| -0.533 HiNF-D|HiNF-D| -0.868 IRF-1|M00747 IRF1| -0.873 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.11 SPT10|Spt10p| -1.58 E2F|M00516 E2F V$E2F_03| -2.24 AACCCT_box|AACCCT S. pombe| -3.38 GC_box|M00255 GC box V$GC_01| -4.49 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT4G40040.1_H3_A_thaliana ref|NC_003075.3|chr4:1-18585042:18558230-18559229 Arabidopsis thaliana chromosome 4, complete sequence CCAAT_box|M00254 V$CAAT_01 CCAAT box| 292 - 303 + ttcagccaatag 7.92 NEG|Negative element| 435 - 449 + taatcgataaaaacc 6.32 TATA_box|M00252 TATA V$TATA_01| 439 - 453 + cgataaaaaccgtcc 7.83 TBP|M00713 TBP F$TBP_Q6| 458 - 466 - atataaatc 6.56 IRF-7|M00453 V$IRF7_01 IRF-7| 532 - 549 - atctttttcgaattcgga 8.28 IRF-7|M00453 V$IRF7_01 IRF-7| 552 - 569 - tcaagtttgaaattcgga 7.63 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT4G40040.2_H3_A_thaliana.fasta (1 sequences, 1000 bp, 38.8% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-7|M00453 V$IRF7_01 IRF-7| 1.27 TATA_box|M00252 TATA V$TATA_01| 0.529 HEX|Hexamer| 0.00568 HiNF-D|HiNF-D| -0.105 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.128 TBP|M00713 TBP F$TBP_Q6| -0.203 NEG|Negative element| -0.232 Oct-1|M00138 V$OCT1_04 Oct-1| -0.412 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.585 IRF-1|M00747 IRF1| -0.78 SPT10|Spt10p| -2 E2F|M00516 E2F V$E2F_03| -2.64 GC_box|M00255 GC box V$GC_01| -3.43 AACCCT_box|AACCCT S. pombe| -3.68 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT4G40040.2_H3_A_thaliana ref|NC_003075.3|chr4:1-18585042:18557802-18558801 Arabidopsis thaliana chromosome 4, complete sequence NEG|Negative element| 7 - 21 + taatcgataaaaacc 6.65 TATA_box|M00252 TATA V$TATA_01| 11 - 25 + cgataaaaaccgtcc 7.97 TBP|M00713 TBP F$TBP_Q6| 30 - 38 - atataaatc 6.78 Oct-1|M00138 V$OCT1_04 Oct-1| 59 - 81 - taaattaatatcaatagccgtac 6.32 IRF-7|M00453 V$IRF7_01 IRF-7| 104 - 121 - atctttttcgaattcgga 8.21 IRF-7|M00453 V$IRF7_01 IRF-7| 124 - 141 - tcaagtttgaaattcgga 7.73 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 705 - 715 - ctaattggtgg 6.65 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 748 - 759 + accaaccactgg 7.07 HiNF-D|HiNF-D| 773 - 788 - ccccatcgttaccgtc 6.48 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT5G02560_H2A_A_thaliana.fasta (1 sequences, 1000 bp, 32.2% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-1|M00747 IRF1| 0.955 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.633 NEG|Negative element| 0.0653 HiNF-D|HiNF-D| -0.0451 HEX|Hexamer| -0.202 TBP|M00713 TBP F$TBP_Q6| -0.38 Oct-1|M00138 V$OCT1_04 Oct-1| -0.383 IRF-7|M00453 V$IRF7_01 IRF-7| -0.978 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.09 TATA_box|M00252 TATA V$TATA_01| -2.28 E2F|M00516 E2F V$E2F_03| -2.47 SPT10|Spt10p| -2.62 GC_box|M00255 GC box V$GC_01| -4.72 AACCCT_box|AACCCT S. pombe| -4.8 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT5G02560_H2A_A_thaliana ref|NC_003076.4|chr5:1-26992728:574478-575477 Arabidopsis thaliana chromosome 5, complete sequence NEG|Negative element| 6 - 20 - tgcatttagtggaaa 6.82 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 443 - 454 + agtgtccagtga 7.27 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 464 - 475 + agtgtccaatag 6.4 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 512 - 523 + agcatccaagca 6.6 Oct-1|M00138 V$OCT1_04 Oct-1| 532 - 554 - aagtttcatttgcattatattca 6.38 IRF-1|M00747 IRF1| 785 - 791 + ttcactt 7.52 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 951 - 962 + tcaagccatgga 6.05 IRF-1|M00747 IRF1| 974 - 980 - aagtgaa 7.55 HiNF-D|HiNF-D| 979 - 994 + aagaaaggagccgctg 7.14 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT5G02570_H2B_A_thaliana.fasta (1 sequences, 1000 bp, 31.6% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score Oct-1|M00138 V$OCT1_04 Oct-1| 0.833 IRF-7|M00453 V$IRF7_01 IRF-7| 0.557 E2F|M00516 E2F V$E2F_03| 0.494 TATA_box|M00252 TATA V$TATA_01| 0.392 NEG|Negative element| 0.106 HEX|Hexamer| -0.0549 HiNF-D|HiNF-D| -0.109 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.181 AACCCT_box|AACCCT S. pombe| -0.303 TBP|M00713 TBP F$TBP_Q6| -0.527 IRF-1|M00747 IRF1| -0.541 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.799 SPT10|Spt10p| -1.58 GC_box|M00255 GC box V$GC_01| -2.29 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT5G02570_H2B_A_thaliana ref|NC_003076.4|chr5:1-26992728:577117-578116 Arabidopsis thaliana chromosome 5, complete sequence AACCCT_box|AACCCT S. pombe| 72 - 94 - tccttgggaaggctttggttgga 7.14 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 163 - 173 - cacattagctg 7.17 Oct-1|M00138 V$OCT1_04 Oct-1| 279 - 301 - acgtatcttttgcatgtgaataa 7.82 Oct-1|M00138 V$OCT1_04 Oct-1| 374 - 396 + tgttgttcatgcatatatatacc 6.38 HiNF-D|HiNF-D| 787 - 802 - cgccgactttagcgtt 6.99 NEG|Negative element| 790 - 804 - cgactttagcgttaa 6.88 IRF-7|M00453 V$IRF7_01 IRF-7| 905 - 922 + ttcaaaaccgaaaccctc 8.08 TATA_box|M00252 TATA V$TATA_01| 973 - 987 + ggattaatggcgccg 7.56 E2F|M00516 E2F V$E2F_03| 978 - 989 + aatggcgccgaa 6.04 E2F|M00516 E2F V$E2F_03| 978 - 989 - aatggcgccgaa 7.92 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT5G10390_H3_A_thaliana.fasta (1 sequences, 1000 bp, 34.2% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score E2F|M00516 E2F V$E2F_03| 2.55 TATA_box|M00252 TATA V$TATA_01| 0.891 IRF-7|M00453 V$IRF7_01 IRF-7| 0.816 Oct-1|M00138 V$OCT1_04 Oct-1| 0.0865 HEX|Hexamer| 0.0784 NEG|Negative element| -0.366 IRF-1|M00747 IRF1| -0.575 GC_box|M00255 GC box V$GC_01| -0.594 TBP|M00713 TBP F$TBP_Q6| -0.82 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.832 HiNF-D|HiNF-D| -0.889 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.09 AACCCT_box|AACCCT S. pombe| -2.93 SPT10|Spt10p| -3.02 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT5G10390_H3_A_thaliana ref|NC_003076.4|chr5:1-26992728:3269476-3270475 Arabidopsis thaliana chromosome 5, complete sequence CCAAT_box|M00254 V$CAAT_01 CCAAT box| 61 - 72 - tcaatggatatg 6.06 Oct-1|M00138 V$OCT1_04 Oct-1| 193 - 215 - tctgtcgatctccatatttctgc 6.53 IRF-7|M00453 V$IRF7_01 IRF-7| 614 - 631 - aaaattttcgatttggcg 7.44 E2F|M00516 E2F V$E2F_03| 625 - 636 + tttggcgcctaa 9.78 E2F|M00516 E2F V$E2F_03| 625 - 636 - tttggcgcctaa 7.4 TATA_box|M00252 TATA V$TATA_01| 760 - 774 - cacacggatttatac 7.45 E2F|M00516 E2F V$E2F_03| 829 - 840 - tttccctccaaa 6.1 GC_box|M00255 GC box V$GC_01| 846 - 859 - aactccctcccatg 6.93 E2F|M00516 E2F V$E2F_03| 870 - 881 - ctcaccgccaaa 8.59 TATA_box|M00252 TATA V$TATA_01| 891 - 905 + ccataaaagcagtcc 7.99 IRF-7|M00453 V$IRF7_01 IRF-7| 929 - 946 - caaaatttctcattcgca 7.12 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT5G10400_H3_A_thaliana.fasta (1 sequences, 1000 bp, 28.9% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-7|M00453 V$IRF7_01 IRF-7| 1.21 TATA_box|M00252 TATA V$TATA_01| 0.774 TBP|M00713 TBP F$TBP_Q6| 0.277 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 0.231 HEX|Hexamer| 0.0601 IRF-1|M00747 IRF1| -0.147 NEG|Negative element| -0.214 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.263 Oct-1|M00138 V$OCT1_04 Oct-1| -0.608 HiNF-D|HiNF-D| -0.654 SPT10|Spt10p| -1.51 GC_box|M00255 GC box V$GC_01| -2.07 E2F|M00516 E2F V$E2F_03| -3.32 AACCCT_box|AACCCT S. pombe| -5.01 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT5G10400_H3_A_thaliana ref|NC_003076.4|chr5:1-26992728:3270889-3271888 Arabidopsis thaliana chromosome 5, complete sequence IRF-7|M00453 V$IRF7_01 IRF-7| 19 - 36 - gtttgattcgctttccat 7.11 IRF-7|M00453 V$IRF7_01 IRF-7| 25 - 42 - ttcgctttccattttctt 7.14 IRF-7|M00453 V$IRF7_01 IRF-7| 73 - 90 - gtgagtttccttttgcaa 7.98 TBP|M00713 TBP F$TBP_Q6| 505 - 513 - atataagta 6.2 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 789 - 799 - cttattggtta 6.15 NEG|Negative element| 809 - 823 - gacgcggatcgtaaa 6.3 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 847 - 858 + ataagccaaaca 6.52 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 849 - 859 + aagccaaacag 7.52 TATA_box|M00252 TATA V$TATA_01| 901 - 915 + gtataaaaaagcctc 8.27 SPT10|Spt10p| 943 - 963 + gcattctcaccgaatcaaatc 6.05 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT5G10980_H3_A_thaliana.fasta (1 sequences, 1000 bp, 36.1% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score NEG|Negative element| 0.615 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.555 Oct-1|M00138 V$OCT1_04 Oct-1| 0.199 HiNF-D|HiNF-D| 0.147 IRF-1|M00747 IRF1| 0.136 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 0.119 IRF-7|M00453 V$IRF7_01 IRF-7| 0.0658 HEX|Hexamer| -0.0941 TBP|M00713 TBP F$TBP_Q6| -0.117 TATA_box|M00252 TATA V$TATA_01| -1.32 GC_box|M00255 GC box V$GC_01| -1.34 E2F|M00516 E2F V$E2F_03| -2.5 AACCCT_box|AACCCT S. pombe| -3.52 SPT10|Spt10p| -3.73 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT5G10980_H3_A_thaliana ref|NC_003076.4|chr5:1-26992728:3473350-3474349 Arabidopsis thaliana chromosome 5, complete sequence Oct-1|M00138 V$OCT1_04 Oct-1| 35 - 57 + ttttgtgcattcaaatttaggct 7.32 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 58 - 69 - tcaatggccata 7.58 IRF-1|M00747 IRF1| 240 - 246 + ttctgtt 6.4 IRF-7|M00453 V$IRF7_01 IRF-7| 378 - 395 + taccaaaccgaattttaa 6.72 HiNF-D|HiNF-D| 479 - 494 + gatcggagcggccgta 6.44 NEG|Negative element| 533 - 547 + cgaactctcaatgcc 7.72 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 739 - 750 + ttaaaccaatca 6.81 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 741 - 751 + aaaccaatcag 7.46 HiNF-D|HiNF-D| 747 - 762 + atcagaagcgaggacg 6.43 IRF-7|M00453 V$IRF7_01 IRF-7| 811 - 828 + cgaaaatgtgaagattgg 6.08 IRF-7|M00453 V$IRF7_01 IRF-7| 914 - 931 + caagaaaacaaaactcgc 6.2 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT5G12910_H3_A_thaliana.fasta (1 sequences, 1000 bp, 31% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.729 IRF-1|M00747 IRF1| 0.253 TBP|M00713 TBP F$TBP_Q6| 0.142 NEG|Negative element| -0.0294 TATA_box|M00252 TATA V$TATA_01| -0.044 HiNF-D|HiNF-D| -0.275 IRF-7|M00453 V$IRF7_01 IRF-7| -0.499 HEX|Hexamer| -0.562 Oct-1|M00138 V$OCT1_04 Oct-1| -0.795 SPT10|Spt10p| -0.948 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.01 E2F|M00516 E2F V$E2F_03| -1.9 GC_box|M00255 GC box V$GC_01| -3.33 AACCCT_box|AACCCT S. pombe| -3.9 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT5G12910_H3_A_thaliana ref|NC_003076.4|chr5:1-26992728:4076166-4077165 Arabidopsis thaliana chromosome 5, complete sequence IRF-1|M00747 IRF1| 72 - 78 + ttcactt 7.21 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 144 - 155 + ccgggccataca 8.22 TATA_box|M00252 TATA V$TATA_01| 144 - 158 - ccgggccatacatgc 6.94 IRF-7|M00453 V$IRF7_01 IRF-7| 285 - 302 + gtgcaaactgacgatggg 6.64 SPT10|Spt10p| 640 - 660 - cagttgacacagtcgcaacgg 6.6 HiNF-D|HiNF-D| 647 - 662 + cacagtcgcaacggaa 6.02 NEG|Negative element| 668 - 682 - gatctcaagcgttga 6.02 HiNF-D|HiNF-D| 800 - 815 + cagcaaacctatggtc 6.21 TATA_box|M00252 TATA V$TATA_01| 810 - 824 - atggtctatatatag 6.09 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT5G22880_H2B_A_thaliana.fasta (1 sequences, 1000 bp, 32.5% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score SPT10|Spt10p| 1.62 IRF-1|M00747 IRF1| 0.438 TBP|M00713 TBP F$TBP_Q6| 0.218 Oct-1|M00138 V$OCT1_04 Oct-1| 0.171 HiNF-D|HiNF-D| -0.0836 HEX|Hexamer| -0.281 TATA_box|M00252 TATA V$TATA_01| -0.529 IRF-7|M00453 V$IRF7_01 IRF-7| -0.781 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.963 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1 NEG|Negative element| -1.11 AACCCT_box|AACCCT S. pombe| -1.34 E2F|M00516 E2F V$E2F_03| -1.65 GC_box|M00255 GC box V$GC_01| -3.78 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT5G22880_H2B_A_thaliana ref|NC_003076.4|chr5:1-26992728:7652510-7653509 Arabidopsis thaliana chromosome 5, complete sequence HiNF-D|HiNF-D| 35 - 50 - ctccctctcttttttt 6.48 AACCCT_box|AACCCT S. pombe| 158 - 180 - caaatgattttggttctgatggg 6.21 TBP|M00713 TBP F$TBP_Q6| 315 - 323 - atataagaa 6.02 TATA_box|M00252 TATA V$TATA_01| 432 - 446 + ctataaaaagttggt 6.74 Oct-1|M00138 V$OCT1_04 Oct-1| 443 - 465 - tggttatttttgaagaattttga 6.53 IRF-1|M00747 IRF1| 499 - 505 + ttcattt 6.11 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 749 - 760 + accatccattca 6.39 IRF-1|M00747 IRF1| 844 - 850 + ttctctt 6.75 TBP|M00713 TBP F$TBP_Q6| 846 - 854 + ctcttatat 6.54 SPT10|Spt10p| 964 - 984 - gcggagaagaaaccggcagag 9.19 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT5G27670_H2A_A_thaliana.fasta (1 sequences, 1000 bp, 37.5% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 1.5 IRF-1|M00747 IRF1| 0.796 HiNF-D|HiNF-D| 0.636 HEX|Hexamer| 0.255 Oct-1|M00138 V$OCT1_04 Oct-1| 0.206 IRF-7|M00453 V$IRF7_01 IRF-7| -0.3 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.562 NEG|Negative element| -0.661 TBP|M00713 TBP F$TBP_Q6| -0.689 E2F|M00516 E2F V$E2F_03| -1.21 TATA_box|M00252 TATA V$TATA_01| -1.29 AACCCT_box|AACCCT S. pombe| -2.07 SPT10|Spt10p| -3.41 GC_box|M00255 GC box V$GC_01| -3.62 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT5G27670_H2A_A_thaliana ref|NC_003076.4|chr5:1-26992728:9793332-9794331 Arabidopsis thaliana chromosome 5, complete sequence IRF-1|M00747 IRF1| 7 - 13 - aagagaa 6.79 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 62 - 72 + catccatggag 6.07 HiNF-D|HiNF-D| 230 - 245 + aggcatagataccgcg 7.96 IRF-1|M00747 IRF1| 291 - 297 - aagagaa 6.79 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 397 - 408 + tgcagccattaa 6.82 IRF-1|M00747 IRF1| 418 - 424 + ttcattt 6.19 HEX|Hexamer| 746 - 751 - gaagtc 6.98 Oct-1|M00138 V$OCT1_04 Oct-1| 834 - 856 - acgtggtatatacatacacgtcg 7.02 IRF-7|M00453 V$IRF7_01 IRF-7| 872 - 889 + aagcaaatcgtaaaccgc 6.21 Oct-1|M00138 V$OCT1_04 Oct-1| 927 - 949 - tagattcatttgtattttctttt 6.11 IRF-1|M00747 IRF1| 931 - 937 + ttcattt 6.19 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 988 - 998 + aagccaacgag 8.96 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT5G54640_H2A_A_thaliana.fasta (1 sequences, 1000 bp, 33% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score CCAAT_box|M00254 V$CAAT_01 CCAAT box| 2.15 GC_box|M00255 GC box V$GC_01| 0.951 HEX|Hexamer| 0.343 TBP|M00713 TBP F$TBP_Q6| 0.302 HiNF-D|HiNF-D| 0.0858 IRF-1|M00747 IRF1| -0.02 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.0472 IRF-7|M00453 V$IRF7_01 IRF-7| -0.379 E2F|M00516 E2F V$E2F_03| -0.483 NEG|Negative element| -0.791 Oct-1|M00138 V$OCT1_04 Oct-1| -0.817 TATA_box|M00252 TATA V$TATA_01| -0.828 SPT10|Spt10p| -3.13 AACCCT_box|AACCCT S. pombe| -3.16 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT5G54640_H2A_A_thaliana ref|NC_003076.4|chr5:1-26992728:22212767-22213766 Arabidopsis thaliana chromosome 5, complete sequence HEX|Hexamer| 3 - 8 + gacttc 7.03 GC_box|M00255 GC box V$GC_01| 146 - 159 + agtaggtgtgggtg 8.2 IRF-7|M00453 V$IRF7_01 IRF-7| 200 - 217 + ttagaaattgaattttga 6.63 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 305 - 315 - cacattgactg 7.09 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 310 - 321 - tgactggtctgc 6.73 GC_box|M00255 GC box V$GC_01| 313 - 326 - ctggtctgccccaa 6.9 IRF-1|M00747 IRF1| 416 - 422 + ttctctt 6.54 TBP|M00713 TBP F$TBP_Q6| 452 - 460 + tttttatat 6.28 TBP|M00713 TBP F$TBP_Q6| 486 - 494 + tatttatat 6.4 HiNF-D|HiNF-D| 601 - 616 - tttcttcgctggggtt 6.06 E2F|M00516 E2F V$E2F_03| 615 - 626 + tttggtgggcga 6.97 HiNF-D|HiNF-D| 787 - 802 + agttcaagcggtggga 6.08 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 818 - 829 + cgtagccattca 9.63 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 879 - 890 - ttattggtcaaa 6.76 HiNF-D|HiNF-D| 970 - 985 - tgcgctctttgtgggt 6.04 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT5G59690_H4_A_thaliana.fasta (1 sequences, 1000 bp, 34.5% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score E2F|M00516 E2F V$E2F_03| 1.53 Oct-1|M00138 V$OCT1_04 Oct-1| -0.0137 HEX|Hexamer| -0.155 IRF-7|M00453 V$IRF7_01 IRF-7| -0.166 NEG|Negative element| -0.307 TBP|M00713 TBP F$TBP_Q6| -0.32 IRF-1|M00747 IRF1| -0.592 TATA_box|M00252 TATA V$TATA_01| -0.61 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.891 AACCCT_box|AACCCT S. pombe| -1.31 HiNF-D|HiNF-D| -1.4 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -2.02 GC_box|M00255 GC box V$GC_01| -2.48 SPT10|Spt10p| -3.35 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT5G59690_H4_A_thaliana ref|NC_003076.4|chr5:1-26992728:24067876-24068875 Arabidopsis thaliana chromosome 5, complete sequence IRF-7|M00453 V$IRF7_01 IRF-7| 649 - 666 - cgcaattttattttccga 7.1 E2F|M00516 E2F V$E2F_03| 700 - 711 + tgtggcgccaca 8.41 E2F|M00516 E2F V$E2F_03| 700 - 711 - tgtggcgccaca 8.41 AACCCT_box|AACCCT S. pombe| 738 - 760 + gctatcactgccatcacgcggat 6.23 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT5G59870_H2A_A_thaliana.fasta (1 sequences, 1000 bp, 30.1% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1.53 IRF-1|M00747 IRF1| 1.04 Oct-1|M00138 V$OCT1_04 Oct-1| 0.694 HiNF-D|HiNF-D| 0.178 TBP|M00713 TBP F$TBP_Q6| 0.0616 HEX|Hexamer| -0.197 NEG|Negative element| -0.304 TATA_box|M00252 TATA V$TATA_01| -0.457 IRF-7|M00453 V$IRF7_01 IRF-7| -0.521 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.905 E2F|M00516 E2F V$E2F_03| -1.02 AACCCT_box|AACCCT S. pombe| -1.56 SPT10|Spt10p| -2.79 GC_box|M00255 GC box V$GC_01| -4.24 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT5G59870_H2A_A_thaliana ref|NC_003076.4|chr5:1-26992728:24133337-24134336 Arabidopsis thaliana chromosome 5, complete sequence Oct-1|M00138 V$OCT1_04 Oct-1| 65 - 87 + taacgagcatgtaaaactaacca 7.77 IRF-1|M00747 IRF1| 125 - 131 + ttcactt 7.22 TBP|M00713 TBP F$TBP_Q6| 286 - 294 + ctcttatat 6.14 Oct-1|M00138 V$OCT1_04 Oct-1| 335 - 357 - taattgggtttgcataagttttg 6.47 IRF-1|M00747 IRF1| 432 - 438 + ttctctt 6.3 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 754 - 765 - tgattggttaat 9.1 TATA_box|M00252 TATA V$TATA_01| 862 - 876 + ctataaatatcacag 6.19 NEG|Negative element| 932 - 946 + taaactctcaatttc 6.01 HiNF-D|HiNF-D| 957 - 972 + aaccgtagcaatggaa 7.01 IRF-7|M00453 V$IRF7_01 IRF-7| 978 - 995 + cggaaaagtgaagaaagc 6.49 IRF-1|M00747 IRF1| 983 - 989 - aagtgaa 7.87 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT5G59910_H2B_A_thaliana.fasta (1 sequences, 1000 bp, 44.6% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1.37 IRF-7|M00453 V$IRF7_01 IRF-7| 0.996 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 0.255 TBP|M00713 TBP F$TBP_Q6| 0.242 E2F|M00516 E2F V$E2F_03| -0.00331 IRF-1|M00747 IRF1| -0.0625 HEX|Hexamer| -0.231 HiNF-D|HiNF-D| -0.291 TATA_box|M00252 TATA V$TATA_01| -0.54 Oct-1|M00138 V$OCT1_04 Oct-1| -0.683 NEG|Negative element| -0.838 AACCCT_box|AACCCT S. pombe| -2.1 SPT10|Spt10p| -2.29 GC_box|M00255 GC box V$GC_01| -3.75 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT5G59910_H2B_A_thaliana ref|NC_003076.4|chr5:1-26992728:24143496-24144495 Arabidopsis thaliana chromosome 5, complete sequence IRF-7|M00453 V$IRF7_01 IRF-7| 156 - 173 + gaggaaattgaaaaacct 7.11 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 193 - 204 - tcaatggttcca 6.63 IRF-1|M00747 IRF1| 296 - 302 + ttctttt 6.57 IRF-7|M00453 V$IRF7_01 IRF-7| 389 - 406 + tgcgaaaatgagagcttg 6.74 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 534 - 544 - ctcactggtta 7.27 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 535 - 546 - tcactggttata 7.26 IRF-7|M00453 V$IRF7_01 IRF-7| 607 - 624 + gcgggaatggaaaatttc 7.75 IRF-7|M00453 V$IRF7_01 IRF-7| 608 - 625 + cgggaatggaaaatttca 6.21 E2F|M00516 E2F V$E2F_03| 629 - 640 - gatagcgccaat 6.29 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 672 - 683 + tgtatccaataa 6.69 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 674 - 684 + tatccaataag 6.47 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 796 - 807 + tgtatccaatca 8.31 TATA_box|M00252 TATA V$TATA_01| 824 - 838 + ctatataaaagcaat 6.06 TBP|M00713 TBP F$TBP_Q6| 826 - 834 - atataaaag 7.41 E2F|M00516 E2F V$E2F_03| 936 - 947 - aatggcgccgaa 6.38 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT5G59970_H4_A_thaliana.fasta (1 sequences, 1000 bp, 41% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score HiNF-D|HiNF-D| 2.32 TBP|M00713 TBP F$TBP_Q6| 1.03 TATA_box|M00252 TATA V$TATA_01| 0.505 IRF-7|M00453 V$IRF7_01 IRF-7| 0.401 E2F|M00516 E2F V$E2F_03| 0.255 HEX|Hexamer| 0.0675 NEG|Negative element| -0.0582 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.274 IRF-1|M00747 IRF1| -0.287 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.803 SPT10|Spt10p| -1.09 Oct-1|M00138 V$OCT1_04 Oct-1| -1.12 AACCCT_box|AACCCT S. pombe| -1.78 GC_box|M00255 GC box V$GC_01| -3.07 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT5G59970_H4_A_thaliana ref|NC_003076.4|chr5:1-26992728:24163889-24164888 Arabidopsis thaliana chromosome 5, complete sequence Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 346 - 356 - ctccatggctt 6.46 HiNF-D|HiNF-D| 346 - 361 - ctccatggctttcgtg 8.65 E2F|M00516 E2F V$E2F_03| 382 - 393 + tttcccgccggc 7.66 IRF-7|M00453 V$IRF7_01 IRF-7| 385 - 402 - cccgccggcgatttcctt 6.7 HiNF-D|HiNF-D| 387 - 402 - cgccggcgatttcctt 9.47 NEG|Negative element| 415 - 429 + tggcggctcattgta 6.3 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 421 - 431 - ctcattgtacg 6.06 TBP|M00713 TBP F$TBP_Q6| 555 - 563 - atataaata 7.12 TATA_box|M00252 TATA V$TATA_01| 555 - 569 + atataaatacgacca 6.37 IRF-7|M00453 V$IRF7_01 IRF-7| 650 - 667 + tgcgtattcgaaaataag 6.53 TATA_box|M00252 TATA V$TATA_01| 896 - 910 - agccctcttatatat 7.39 TATA_box|M00252 TATA V$TATA_01| 898 - 912 - ccctcttatatataa 6.08 TBP|M00713 TBP F$TBP_Q6| 900 - 908 + ctcttatat 7.69 TBP|M00713 TBP F$TBP_Q6| 902 - 910 + cttatatat 6.44 TBP|M00713 TBP F$TBP_Q6| 907 - 915 - atataaaca 6.05 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 918 - 929 + cacgtccagtca 6.4 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT5G65360_H3_A_thaliana.fasta (1 sequences, 1000 bp, 40.9% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 4.59 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 3.26 Oct-1|M00138 V$OCT1_04 Oct-1| 2.48 IRF-7|M00453 V$IRF7_01 IRF-7| 1.78 E2F|M00516 E2F V$E2F_03| 1.65 HiNF-D|HiNF-D| 1.05 TATA_box|M00252 TATA V$TATA_01| 0.65 HEX|Hexamer| 0.22 NEG|Negative element| 0.204 IRF-1|M00747 IRF1| -0.166 TBP|M00713 TBP F$TBP_Q6| -0.265 AACCCT_box|AACCCT S. pombe| -1.36 SPT10|Spt10p| -1.83 GC_box|M00255 GC box V$GC_01| -3.03 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT5G65360_H3_A_thaliana ref|NC_003076.4|chr5:1-26992728:26137051-26138050 Arabidopsis thaliana chromosome 5, complete sequence TATA_box|M00252 TATA V$TATA_01| 16 - 30 + gtttaaaagacgcgc 7.56 E2F|M00516 E2F V$E2F_03| 73 - 84 - ttgggcgctaaa 8.68 E2F|M00516 E2F V$E2F_03| 73 - 84 + ttgggcgctaaa 8.27 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 95 - 105 - ctgattggctg 12.2 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 96 - 107 - tgattggctgct 10.8 TATA_box|M00252 TATA V$TATA_01| 208 - 222 + ctataaaaaccaatc 7.39 IRF-1|M00747 IRF1| 462 - 468 - aagagaa 6.42 HiNF-D|HiNF-D| 503 - 518 - tccgcaagcttccgtt 6.15 AACCCT_box|AACCCT S. pombe| 518 - 540 - tccagcgtttggttcgtgagatc 6.09 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 523 - 534 - cgtttggttcgt 7.01 HiNF-D|HiNF-D| 571 - 586 + cagagcagcgccgtcg 7.48 HiNF-D|HiNF-D| 579 - 594 - cgccgtcgcagcactt 7.08 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 616 - 626 - ctcgttggatt 7.66 Oct-1|M00138 V$OCT1_04 Oct-1| 759 - 781 + ttatgcttatgtatatctttcgt 9.97 IRF-7|M00453 V$IRF7_01 IRF-7| 771 - 788 - atatctttcgttttccct 9.24 Oct-1|M00138 V$OCT1_04 Oct-1| 774 - 796 - tctttcgttttccctaatttcgt 6.84 NEG|Negative element| 812 - 826 - taggttttgcgttta 6.85 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: AT_H3_A_thaliana.fasta (1 sequences, 1000 bp, 28.3% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-7|M00453 V$IRF7_01 IRF-7| 0.514 HEX|Hexamer| -0.0193 IRF-1|M00747 IRF1| -0.0678 TBP|M00713 TBP F$TBP_Q6| -0.197 HiNF-D|HiNF-D| -0.648 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.707 Oct-1|M00138 V$OCT1_04 Oct-1| -0.961 TATA_box|M00252 TATA V$TATA_01| -1.13 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.57 NEG|Negative element| -1.61 GC_box|M00255 GC box V$GC_01| -2.75 AACCCT_box|AACCCT S. pombe| -2.91 E2F|M00516 E2F V$E2F_03| -3.07 SPT10|Spt10p| -3.63 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >AT_H3_A_thaliana ref|NC_003071.3|chr2:1-19705359:10153892-10154891 Arabidopsis thaliana chromosome 2, complete sequence IRF-1|M00747 IRF1| 170 - 176 + ttcattt 6.13 IRF-7|M00453 V$IRF7_01 IRF-7| 355 - 372 + ttgcaattggaaggttga 7.96 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 415 - 426 + acaaaccaagca 6.2 TBP|M00713 TBP F$TBP_Q6| 428 - 436 + cttttatat 6.65 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H2A.1_D_ananassae.fasta (1 sequences, 274 bp, 40.1% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score TATA_box|M00252 TATA V$TATA_01| 2.92 TBP|M00713 TBP F$TBP_Q6| 2.11 IRF-1|M00747 IRF1| 1.35 HiNF-D|HiNF-D| 0.999 IRF-7|M00453 V$IRF7_01 IRF-7| 0.223 SPT10|Spt10p| 0.116 HEX|Hexamer| -0.333 Oct-1|M00138 V$OCT1_04 Oct-1| -0.454 E2F|M00516 E2F V$E2F_03| -0.557 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.612 NEG|Negative element| -1.21 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -3.47 GC_box|M00255 GC box V$GC_01| -4.35 AACCCT_box|AACCCT S. pombe| -4.97 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H2A.1_D_ananassae droAna1_dna range=2448756:7696-7969 U.D_ananassae.copy1 CG31613-RA >droAna1_dna range=2448756:7696-7969 U.D_ananassae.copy1 CG31613-RA TBP|M00713 TBP F$TBP_Q6| 17 - 25 + tttttatat 6.77 TATA_box|M00252 TATA V$TATA_01| 66 - 80 - cgctgctctttatac 8.57 IRF-7|M00453 V$IRF7_01 IRF-7| 89 - 106 + tgagaatacgaagaggtc 6.28 SPT10|Spt10p| 93 - 113 - aatacgaagaggtccgagcga 6.25 HiNF-D|HiNF-D| 153 - 168 - ctcgttctctccccct 6.24 TATA_box|M00252 TATA V$TATA_01| 192 - 206 + gtatataaagaggta 8.03 TBP|M00713 TBP F$TBP_Q6| 194 - 202 - atataaaga 8.03 TATA_box|M00252 TATA V$TATA_01| 194 - 208 + atataaagaggtagc 6.76 IRF-1|M00747 IRF1| 247 - 253 - aagagaa 7.37 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H2A.1_D_mojavensis.fasta (1 sequences, 250 bp, 33.2% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-1|M00747 IRF1| 1.73 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 0.973 HiNF-D|HiNF-D| 0.512 NEG|Negative element| -0.396 HEX|Hexamer| -0.418 AACCCT_box|AACCCT S. pombe| -0.464 TBP|M00713 TBP F$TBP_Q6| -1.24 SPT10|Spt10p| -1.43 Oct-1|M00138 V$OCT1_04 Oct-1| -1.6 IRF-7|M00453 V$IRF7_01 IRF-7| -1.65 TATA_box|M00252 TATA V$TATA_01| -1.99 GC_box|M00255 GC box V$GC_01| -2.12 E2F|M00516 E2F V$E2F_03| -2.13 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -2.43 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H2A.1_D_mojavensis droMoj1_dna range=contig_4973:7684-7933 CG31618-RA CG17949-RA >droMoj1_dna range=contig_4973:7684-7933 CG31618-RA CG17949-RA Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 106 - 116 + cagctaaagag 7.13 IRF-1|M00747 IRF1| 217 - 223 - aagtgaa 7.7 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H2A.1_D_virilis.fasta (1 sequences, 243 bp, 32.5% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-1|M00747 IRF1| 2.4 TATA_box|M00252 TATA V$TATA_01| 1.15 HEX|Hexamer| 0.167 TBP|M00713 TBP F$TBP_Q6| -0.306 NEG|Negative element| -0.909 HiNF-D|HiNF-D| -1.24 GC_box|M00255 GC box V$GC_01| -1.34 Oct-1|M00138 V$OCT1_04 Oct-1| -1.63 IRF-7|M00453 V$IRF7_01 IRF-7| -2.07 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.82 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -2.87 E2F|M00516 E2F V$E2F_03| -3.74 SPT10|Spt10p| -3.78 AACCCT_box|AACCCT S. pombe| -5.03 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H2A.1_D_virilis droVir1_dna range=scaffold_18:1618868-1619110 CG31618-RA CG17949-RA >droVir1_dna range=scaffold_18:1618868-1619110 CG31618-RA CG17949-RA IRF-1|M00747 IRF1| 109 - 115 + ttcagtt 6.68 TATA_box|M00252 TATA V$TATA_01| 167 - 181 + gtataaatgctaagc 7.05 IRF-1|M00747 IRF1| 211 - 217 - aagtgaa 7.64 IRF-1|M00747 IRF1| 221 - 227 - aagtgaa 7.64 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H2A.1_D_yakuba.fasta (1 sequences, 478 bp, 31.2% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1.54 E2F|M00516 E2F V$E2F_03| 0.677 HiNF-D|HiNF-D| 0.657 TBP|M00713 TBP F$TBP_Q6| 0.349 GC_box|M00255 GC box V$GC_01| -0.00417 HEX|Hexamer| -0.0964 NEG|Negative element| -0.171 IRF-7|M00453 V$IRF7_01 IRF-7| -0.396 IRF-1|M00747 IRF1| -0.785 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.815 TATA_box|M00252 TATA V$TATA_01| -0.947 Oct-1|M00138 V$OCT1_04 Oct-1| -1.28 SPT10|Spt10p| -3.72 AACCCT_box|AACCCT S. pombe| -5.92 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H2A.1_D_yakuba droYak1_dna range=chr2R:1275077-1275554 U.D_yakuba.copy5 U.D_yakuba.copy6 >droYak1_dna range=chr2R:1275077-1275554 U.D_yakuba.copy5 U.D_yakuba.copy6 GC_box|M00255 GC box V$GC_01| 5 - 18 + aagaggcaaggccg 6.76 HiNF-D|HiNF-D| 15 - 30 - gccgcactctctacgg 6.32 HiNF-D|HiNF-D| 17 - 32 - cgcactctctacggat 6.18 E2F|M00516 E2F V$E2F_03| 32 - 43 + tttggcggttaa 7.48 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 138 - 149 - ttattggttggg 8.36 IRF-7|M00453 V$IRF7_01 IRF-7| 146 - 163 + tgggaatcccaagaatga 6.21 TBP|M00713 TBP F$TBP_Q6| 388 - 396 - atataaata 6.01 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H2A.2_D_ananassae.fasta (1 sequences, 251 bp, 42.6% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score TATA_box|M00252 TATA V$TATA_01| 3.1 TBP|M00713 TBP F$TBP_Q6| 1.9 HiNF-D|HiNF-D| 1.12 IRF-1|M00747 IRF1| 1.04 IRF-7|M00453 V$IRF7_01 IRF-7| -0.195 HEX|Hexamer| -0.403 SPT10|Spt10p| -0.607 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.641 E2F|M00516 E2F V$E2F_03| -1.05 NEG|Negative element| -1.27 Oct-1|M00138 V$OCT1_04 Oct-1| -2.41 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -3.47 GC_box|M00255 GC box V$GC_01| -4.52 AACCCT_box|AACCCT S. pombe| -4.64 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H2A.2_D_ananassae droAna1_dna range=2448756:7719-7969 U.D_ananassae.copy2 CG31613-RA >droAna1_dna range=2448756:7719-7969 U.D_ananassae.copy2 CG31613-RA TATA_box|M00252 TATA V$TATA_01| 43 - 57 - cgctgctctttatac 8.85 HiNF-D|HiNF-D| 130 - 145 - ctcgttctctccccct 6.58 TATA_box|M00252 TATA V$TATA_01| 169 - 183 + gtatataaagaggta 7.83 TBP|M00713 TBP F$TBP_Q6| 171 - 179 - atataaaga 7.9 TATA_box|M00252 TATA V$TATA_01| 171 - 185 + atataaagaggtagc 6.42 IRF-1|M00747 IRF1| 224 - 230 - aagagaa 6.96 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H2A.2_H2B.2_IR_A_gossypii.fasta (1 sequences, 591 bp, 46.7% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score SPT10|Spt10p| 3.43 E2F|M00516 E2F V$E2F_03| 1.71 HiNF-D|HiNF-D| 0.856 TATA_box|M00252 TATA V$TATA_01| 0.632 Oct-1|M00138 V$OCT1_04 Oct-1| 0.494 TBP|M00713 TBP F$TBP_Q6| 0.158 NEG|Negative element| 0.146 IRF-1|M00747 IRF1| 0.0526 HEX|Hexamer| -0.199 IRF-7|M00453 V$IRF7_01 IRF-7| -0.405 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.829 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.02 AACCCT_box|AACCCT S. pombe| -2.63 GC_box|M00255 GC box V$GC_01| -3.19 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H2A.2_H2B.2_IR_A_gossypii TATA_box|M00252 TATA V$TATA_01| 134 - 148 - tctacatatttatac 6.73 SPT10|Spt10p| 253 - 273 + ccgtgctggttttttcgcgct 10.2 E2F|M00516 E2F V$E2F_03| 265 - 276 + tttcgcgctgaa 8.44 E2F|M00516 E2F V$E2F_03| 265 - 276 - tttcgcgctgaa 6.37 IRF-7|M00453 V$IRF7_01 IRF-7| 271 - 288 + gctgaaaaggaaagcgcg 6.4 HiNF-D|HiNF-D| 277 - 292 + aaggaaagcgcgtggc 7.52 SPT10|Spt10p| 307 - 327 + ccgtactagctctttcgcgtg 6.42 E2F|M00516 E2F V$E2F_03| 337 - 348 - gtgcacgcgaaa 6.54 Oct-1|M00138 V$OCT1_04 Oct-1| 341 - 363 - acgcgaaattttcatactgtaga 6.72 SPT10|Spt10p| 364 - 384 + gtgtgccatcagcttcacaga 8.82 TATA_box|M00252 TATA V$TATA_01| 487 - 501 + gtataaaacaaaagt 6.99 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H2A.2_H2B.2_IR_A_nidulans.fasta (1 sequences, 671 bp, 47.2% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 1.18 TATA_box|M00252 TATA V$TATA_01| 1.07 IRF-7|M00453 V$IRF7_01 IRF-7| 0.908 E2F|M00516 E2F V$E2F_03| 0.601 HiNF-D|HiNF-D| 0.496 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.435 TBP|M00713 TBP F$TBP_Q6| -0.0528 Oct-1|M00138 V$OCT1_04 Oct-1| -0.155 HEX|Hexamer| -0.322 IRF-1|M00747 IRF1| -0.525 NEG|Negative element| -0.871 GC_box|M00255 GC box V$GC_01| -1.28 SPT10|Spt10p| -3.28 AACCCT_box|AACCCT S. pombe| -5.44 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H2A.2_H2B.2_IR_A_nidulans HiNF-D|HiNF-D| 115 - 130 + gacgacagctatcgcg 6.29 TATA_box|M00252 TATA V$TATA_01| 138 - 152 - ggagggcatatataa 6.88 TATA_box|M00252 TATA V$TATA_01| 145 - 159 + atatataacgacacc 6.06 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 217 - 228 + gtcaaccaatca 7.46 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 219 - 229 + caaccaatcaa 6.27 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 223 - 233 + caatcaatgag 8.17 E2F|M00516 E2F V$E2F_03| 346 - 357 - cctgccgccaat 6.82 Oct-1|M00138 V$OCT1_04 Oct-1| 385 - 407 + ttctaatcatacaaatcatacaa 6.07 E2F|M00516 E2F V$E2F_03| 463 - 474 + tttggagccaag 6.62 TATA_box|M00252 TATA V$TATA_01| 474 - 488 + gtataagtagcgcgc 7.56 IRF-7|M00453 V$IRF7_01 IRF-7| 614 - 631 - tcaactttcgaatttatc 7.59 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H2A.2_H2B.2_IR_C_albicans.fasta (1 sequences, 544 bp, 32% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score HiNF-D|HiNF-D| 1.33 IRF-1|M00747 IRF1| 1.17 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.606 SPT10|Spt10p| 0.427 TBP|M00713 TBP F$TBP_Q6| 0.275 Oct-1|M00138 V$OCT1_04 Oct-1| 0.116 HEX|Hexamer| -0.565 TATA_box|M00252 TATA V$TATA_01| -0.963 NEG|Negative element| -1.68 IRF-7|M00453 V$IRF7_01 IRF-7| -2.22 E2F|M00516 E2F V$E2F_03| -2.32 AACCCT_box|AACCCT S. pombe| -2.36 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.37 GC_box|M00255 GC box V$GC_01| -4.39 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H2A.2_H2B.2_IR_C_albicans IRF-1|M00747 IRF1| 54 - 60 - aactgaa 6.88 TBP|M00713 TBP F$TBP_Q6| 67 - 75 - atataaaaa 6.12 HiNF-D|HiNF-D| 222 - 237 + acgtagtgcgatggag 6.63 IRF-1|M00747 IRF1| 287 - 293 - aagagaa 6.37 HiNF-D|HiNF-D| 302 - 317 + agagaaagagagggag 7.12 HiNF-D|HiNF-D| 356 - 371 - ctccttctctctcttg 6.92 SPT10|Spt10p| 366 - 386 + ctcttgtcacttcttcttcct 7.07 Oct-1|M00138 V$OCT1_04 Oct-1| 480 - 502 - tttcttaatttccataactttat 6.35 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 519 - 530 + cacaaccaaaca 7.48 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H2A.2_H2B.2_IR_K_waltii.fasta (1 sequences, 496 bp, 41.1% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score SPT10|Spt10p| 5.71 E2F|M00516 E2F V$E2F_03| 3.3 TATA_box|M00252 TATA V$TATA_01| 2.64 TBP|M00713 TBP F$TBP_Q6| 0.645 IRF-7|M00453 V$IRF7_01 IRF-7| 0.617 NEG|Negative element| 0.293 Oct-1|M00138 V$OCT1_04 Oct-1| -0.0482 IRF-1|M00747 IRF1| -0.145 HEX|Hexamer| -0.348 HiNF-D|HiNF-D| -0.387 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.71 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.31 GC_box|M00255 GC box V$GC_01| -3.83 AACCCT_box|AACCCT S. pombe| -4.74 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H2A.2_H2B.2_IR_K_waltii NEG|Negative element| 45 - 59 + tttagcctaaatgtg 6.16 Oct-1|M00138 V$OCT1_04 Oct-1| 76 - 98 - ttcagtaatttatatactccttc 6.29 NEG|Negative element| 113 - 127 - taactttggcgttta 6.09 SPT10|Spt10p| 178 - 198 - ggtgagaattaattagaacga 12.1 SPT10|Spt10p| 202 - 222 + ccgtactcaattcttcgcgtg 11.5 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 228 - 239 + ttcagccaagaa 6.06 IRF-1|M00747 IRF1| 247 - 253 - aaatgaa 6.23 TATA_box|M00252 TATA V$TATA_01| 254 - 268 + atatataaccccgta 6.22 SPT10|Spt10p| 285 - 305 + gcggaccaagaacttcgcagt 9.41 E2F|M00516 E2F V$E2F_03| 356 - 367 + cttcgcgcgatg 10.1 E2F|M00516 E2F V$E2F_03| 356 - 367 - cttcgcgcgatg 7.62 IRF-7|M00453 V$IRF7_01 IRF-7| 382 - 399 + ggggaaaacgaaatgtat 7.37 TATA_box|M00252 TATA V$TATA_01| 396 - 410 + gtatataagggaccg 9.45 TBP|M00713 TBP F$TBP_Q6| 398 - 406 - atataaggg 7.08 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H2A.2_H2B.2_IR_S_bayanus.fasta (1 sequences, 713 bp, 34.8% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score SPT10|Spt10p| 8.04 HiNF-D|HiNF-D| 3.13 TATA_box|M00252 TATA V$TATA_01| 1.09 TBP|M00713 TBP F$TBP_Q6| 0.534 GC_box|M00255 GC box V$GC_01| 0.492 IRF-1|M00747 IRF1| 0.125 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.0619 HEX|Hexamer| -0.123 NEG|Negative element| -0.335 IRF-7|M00453 V$IRF7_01 IRF-7| -0.805 Oct-1|M00138 V$OCT1_04 Oct-1| -0.819 E2F|M00516 E2F V$E2F_03| -2.18 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -2.37 AACCCT_box|AACCCT S. pombe| -3.65 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H2A.2_H2B.2_IR_S_bayanus SPT10|Spt10p| 304 - 324 + ctgttctataaaattcgcacc 12.8 TATA_box|M00252 TATA V$TATA_01| 309 - 323 + ctataaaattcgcac 6.43 SPT10|Spt10p| 327 - 347 - gttgagaaaaaatgggaacga 12.3 IRF-7|M00453 V$IRF7_01 IRF-7| 344 - 361 - acgactttcgcgttggct 6.13 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 352 - 362 - cgcgttggcta 6.96 GC_box|M00255 GC box V$GC_01| 357 - 370 - tggctatgcccacc 7.66 SPT10|Spt10p| 360 - 380 + ctatgcccaccgcttcgccta 13.4 HiNF-D|HiNF-D| 364 - 379 - gcccaccgcttcgcct 10.3 SPT10|Spt10p| 389 - 409 + ctgttctgggaatttctcatc 14.9 TATA_box|M00252 TATA V$TATA_01| 560 - 574 - cggtggtctatatat 6.88 TATA_box|M00252 TATA V$TATA_01| 562 - 576 - gtggtctatatatac 7.33 IRF-1|M00747 IRF1| 621 - 627 + ttcagtt 6.88 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H2A.2_H2B.2_IR_S_castellii.fasta (1 sequences, 703 bp, 38.1% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score SPT10|Spt10p| 7.05 E2F|M00516 E2F V$E2F_03| 4.87 TBP|M00713 TBP F$TBP_Q6| 1.05 IRF-7|M00453 V$IRF7_01 IRF-7| 0.563 HiNF-D|HiNF-D| -0.366 IRF-1|M00747 IRF1| -0.48 HEX|Hexamer| -0.571 TATA_box|M00252 TATA V$TATA_01| -0.644 NEG|Negative element| -0.646 Oct-1|M00138 V$OCT1_04 Oct-1| -0.668 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -1.93 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.18 AACCCT_box|AACCCT S. pombe| -3.37 GC_box|M00255 GC box V$GC_01| -3.76 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H2A.2_H2B.2_IR_S_castellii SPT10|Spt10p| 261 - 281 + ccatgctctgacgttcgcccc 7.67 SPT10|Spt10p| 284 - 304 - agtgtgaaatttttggaacgc 14.2 IRF-7|M00453 V$IRF7_01 IRF-7| 390 - 407 + cccgaaagggaaattaat 7.44 SPT10|Spt10p| 418 - 438 + tcatgccagaagtttcgcgcg 10.3 E2F|M00516 E2F V$E2F_03| 430 - 441 + tttcgcgcgagg 12.1 E2F|M00516 E2F V$E2F_03| 430 - 441 - tttcgcgcgagg 8.21 E2F|M00516 E2F V$E2F_03| 450 - 461 - ttcgccgcgaca 7.33 SPT10|Spt10p| 463 - 483 - agtgtgaaacttgtggaacgg 11.2 TBP|M00713 TBP F$TBP_Q6| 582 - 590 - atataaatg 7.26 TBP|M00713 TBP F$TBP_Q6| 665 - 673 + tatttatat 7.01 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H2A.2_H2B.2_IR_S_cerevisiae.fasta (1 sequences, 701 bp, 33.4% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score SPT10|Spt10p| 9.82 HiNF-D|HiNF-D| 3.51 IRF-7|M00453 V$IRF7_01 IRF-7| 1.78 TBP|M00713 TBP F$TBP_Q6| 0.611 TATA_box|M00252 TATA V$TATA_01| 0.00331 HEX|Hexamer| -0.15 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.275 IRF-1|M00747 IRF1| -0.481 NEG|Negative element| -0.546 Oct-1|M00138 V$OCT1_04 Oct-1| -1.1 E2F|M00516 E2F V$E2F_03| -1.14 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.23 GC_box|M00255 GC box V$GC_01| -1.24 AACCCT_box|AACCCT S. pombe| -4.71 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H2A.2_H2B.2_IR_S_cerevisiae IRF-7|M00453 V$IRF7_01 IRF-7| 111 - 128 + gtcgaaattgaaatcgaa 8.94 SPT10|Spt10p| 150 - 170 - tgtttgaaattctaagaaagc 7.69 TBP|M00713 TBP F$TBP_Q6| 183 - 191 + cccttatat 6.87 SPT10|Spt10p| 291 - 311 + gtgttctctgaaattcgcatc 14.4 SPT10|Spt10p| 314 - 334 - tttgagaaataatgggaacac 12.4 HiNF-D|HiNF-D| 339 - 354 + cgcgtgagctgtgccc 7.56 HiNF-D|HiNF-D| 339 - 354 - cgcgtgagctgtgccc 6.81 SPT10|Spt10p| 347 - 367 + ctgtgcccaccgcttcgccta 16.3 HiNF-D|HiNF-D| 351 - 366 - gcccaccgcttcgcct 10.7 SPT10|Spt10p| 376 - 396 + gtgttctcaaaatttctcccc 16.2 SPT10|Spt10p| 421 - 441 + tagttctggtaaaatcgcgct 7.82 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 594 - 605 - tgactggttttg 6.66 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H2A.2_H2B.2_IR_S_kluyveri.fasta (1 sequences, 496 bp, 37.5% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score SPT10|Spt10p| 4.21 E2F|M00516 E2F V$E2F_03| 3.15 TATA_box|M00252 TATA V$TATA_01| 1.18 TBP|M00713 TBP F$TBP_Q6| 1.09 NEG|Negative element| 0.588 Oct-1|M00138 V$OCT1_04 Oct-1| 0.569 HiNF-D|HiNF-D| 0.49 IRF-1|M00747 IRF1| 0.0048 HEX|Hexamer| -0.0902 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.335 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.66 IRF-7|M00453 V$IRF7_01 IRF-7| -1.72 GC_box|M00255 GC box V$GC_01| -3 AACCCT_box|AACCCT S. pombe| -4.09 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H2A.2_H2B.2_IR_S_kluyveri Oct-1|M00138 V$OCT1_04 Oct-1| 28 - 50 + ttaaagatatgcaaaaatttgcg 7.01 NEG|Negative element| 136 - 150 + ataacgcgacatgtc 6.73 SPT10|Spt10p| 155 - 175 + gcgtgccagtttcttcgcggg 9.13 E2F|M00516 E2F V$E2F_03| 167 - 178 + cttcgcgggaga 9.52 E2F|M00516 E2F V$E2F_03| 167 - 178 - cttcgcgggaga 7.79 TATA_box|M00252 TATA V$TATA_01| 179 - 193 + gaataaaaagcgcga 7.76 E2F|M00516 E2F V$E2F_03| 184 - 195 - aaaagcgcgaaa 6.72 SPT10|Spt10p| 187 - 207 - agcgcgaaaaatctggtacag 10.1 E2F|M00516 E2F V$E2F_03| 242 - 253 + tttcgcggtcga 8.6 HiNF-D|HiNF-D| 245 - 260 - cgcggtcgacctccct 6.8 SPT10|Spt10p| 279 - 299 - gatgtgaaatctatggcacac 8.3 SPT10|Spt10p| 303 - 323 + gcgttccaaagttttcgccaa 10.1 TBP|M00713 TBP F$TBP_Q6| 400 - 408 - atataaatg 7.25 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 467 - 478 + accacccaataa 6.35 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H2A.2_H2B.2_IR_S_kudriavzevii.fasta (1 sequences, 695 bp, 36.7% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score SPT10|Spt10p| 9.32 HiNF-D|HiNF-D| 1.59 TATA_box|M00252 TATA V$TATA_01| 1.34 TBP|M00713 TBP F$TBP_Q6| 0.935 HEX|Hexamer| 0.487 IRF-7|M00453 V$IRF7_01 IRF-7| 0.267 IRF-1|M00747 IRF1| 0.187 Oct-1|M00138 V$OCT1_04 Oct-1| -0.333 NEG|Negative element| -0.867 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.93 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -2.21 GC_box|M00255 GC box V$GC_01| -2.41 E2F|M00516 E2F V$E2F_03| -2.57 AACCCT_box|AACCCT S. pombe| -4.73 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H2A.2_H2B.2_IR_S_kudriavzevii IRF-7|M00453 V$IRF7_01 IRF-7| 104 - 121 + gtcgtaaccgaaagcgag 7.31 HiNF-D|HiNF-D| 110 - 125 + accgaaagcgagagga 7.91 HEX|Hexamer| 135 - 140 + gacttc 6.89 TATA_box|M00252 TATA V$TATA_01| 182 - 196 - ccatcctttatatag 8.19 TBP|M00713 TBP F$TBP_Q6| 186 - 194 + cctttatat 7.3 SPT10|Spt10p| 296 - 316 + ctgttctataaaattcgcacc 12.8 TATA_box|M00252 TATA V$TATA_01| 301 - 315 + ctataaaattcgcac 6.44 SPT10|Spt10p| 319 - 339 - tccaagaaataatgggaacgc 10.1 SPT10|Spt10p| 352 - 372 + ctgtgcccaacgcttcgccta 14.9 HiNF-D|HiNF-D| 356 - 371 - gcccaacgcttcgcct 8.13 SPT10|Spt10p| 381 - 401 + ctgttctcaaaatttcgccta 16.3 IRF-1|M00747 IRF1| 631 - 637 + ttcattt 6.19 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H2A.2_H2B.2_IR_S_mikatae.fasta (1 sequences, 711 bp, 34.7% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score SPT10|Spt10p| 10.3 HiNF-D|HiNF-D| 3.19 TATA_box|M00252 TATA V$TATA_01| 1.86 TBP|M00713 TBP F$TBP_Q6| 1.26 HEX|Hexamer| 0.31 Oct-1|M00138 V$OCT1_04 Oct-1| -0.0244 IRF-1|M00747 IRF1| -0.289 NEG|Negative element| -0.369 IRF-7|M00453 V$IRF7_01 IRF-7| -0.494 E2F|M00516 E2F V$E2F_03| -1.53 GC_box|M00255 GC box V$GC_01| -1.55 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.69 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -1.81 AACCCT_box|AACCCT S. pombe| -5.62 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H2A.2_H2B.2_IR_S_mikatae TATA_box|M00252 TATA V$TATA_01| 179 - 193 - ccatcccttatatag 8.63 TBP|M00713 TBP F$TBP_Q6| 183 - 191 + cccttatat 6.95 HEX|Hexamer| 222 - 227 - gaagtc 7.03 SPT10|Spt10p| 295 - 315 + gtgttctctaaaattcgcatc 13.3 SPT10|Spt10p| 318 - 338 - ttagagaaataattggaacac 7.73 HiNF-D|HiNF-D| 343 - 358 + cgcgtgagctgtgccc 7.28 HiNF-D|HiNF-D| 343 - 358 - cgcgtgagctgtgccc 6.53 SPT10|Spt10p| 351 - 371 + ctgtgcccaccgcttcgccta 16 HiNF-D|HiNF-D| 355 - 370 - gcccaccgcttcgcct 10.3 SPT10|Spt10p| 380 - 400 + ctgttcccagaatttcacccc 17.3 HiNF-D|HiNF-D| 412 - 427 - cacgagcgccattgtg 6.81 TATA_box|M00252 TATA V$TATA_01| 522 - 536 - gccgcctttaaatac 7.74 TBP|M00713 TBP F$TBP_Q6| 562 - 570 - atataaata 6.55 TBP|M00713 TBP F$TBP_Q6| 575 - 583 + tatttatat 6.68 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H2A.2_H2B.2_IR_S_paradoxus.fasta (1 sequences, 696 bp, 36.4% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score SPT10|Spt10p| 9.24 HiNF-D|HiNF-D| 3.09 IRF-7|M00453 V$IRF7_01 IRF-7| 1.51 TBP|M00713 TBP F$TBP_Q6| 0.921 TATA_box|M00252 TATA V$TATA_01| 0.639 Oct-1|M00138 V$OCT1_04 Oct-1| 0.637 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.0854 IRF-1|M00747 IRF1| -0.0751 HEX|Hexamer| -0.508 NEG|Negative element| -0.66 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.868 GC_box|M00255 GC box V$GC_01| -1.71 E2F|M00516 E2F V$E2F_03| -2.51 AACCCT_box|AACCCT S. pombe| -4.26 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H2A.2_H2B.2_IR_S_paradoxus IRF-7|M00453 V$IRF7_01 IRF-7| 119 - 136 + agcggaaacgaaactctg 8.64 TATA_box|M00252 TATA V$TATA_01| 177 - 191 - tcatcccttatatag 7.66 TBP|M00713 TBP F$TBP_Q6| 181 - 189 + cccttatat 7.11 SPT10|Spt10p| 288 - 308 + gtgttctctaaaattcgcatc 13.2 SPT10|Spt10p| 311 - 331 - ttcgagaaataatgggaacac 12.4 HiNF-D|HiNF-D| 336 - 351 + cgcgtgagctgtgccc 6.72 SPT10|Spt10p| 344 - 364 + ctgtgcccaccgcttcgcctg 15.4 HiNF-D|HiNF-D| 348 - 363 - gcccaccgcttcgcct 10.2 SPT10|Spt10p| 373 - 393 + gtgttctcaaaatttcacccc 15.9 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 512 - 523 - tcagtggccgtt 7.13 Oct-1|M00138 V$OCT1_04 Oct-1| 572 - 594 - tgtataattttgcgttagcgtaa 7.58 TBP|M00713 TBP F$TBP_Q6| 601 - 609 + tgtttatat 6.03 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H2A.2_H2B.2_IR_S_pombe.fasta (1 sequences, 564 bp, 35.1% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score AACCCT_box|AACCCT S. pombe| 17.8 HiNF-D|HiNF-D| 0.92 TBP|M00713 TBP F$TBP_Q6| 0.78 TATA_box|M00252 TATA V$TATA_01| 0.64 Oct-1|M00138 V$OCT1_04 Oct-1| -0.0536 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.281 IRF-1|M00747 IRF1| -0.612 HEX|Hexamer| -0.692 IRF-7|M00453 V$IRF7_01 IRF-7| -0.79 NEG|Negative element| -1.12 SPT10|Spt10p| -1.47 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.54 E2F|M00516 E2F V$E2F_03| -1.86 GC_box|M00255 GC box V$GC_01| -2.89 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H2A.2_H2B.2_IR_S_pombe TBP|M00713 TBP F$TBP_Q6| 194 - 202 + tgtttatat 6.56 TATA_box|M00252 TATA V$TATA_01| 288 - 302 - ccttcatatatatac 6.29 HiNF-D|HiNF-D| 356 - 371 - ccgcgtcgcatggcta 6.69 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 362 - 373 - cgcatggctaaa 6.35 AACCCT_box|AACCCT S. pombe| 375 - 397 - accagggttagggttgtgatgcc 24.8 TATA_box|M00252 TATA V$TATA_01| 404 - 418 + gtatataaccatcgc 6.87 HiNF-D|HiNF-D| 410 - 425 - aaccatcgcgtcgcct 6.04 HiNF-D|HiNF-D| 415 - 430 - tcgcgtcgcctgcagg 6.36 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H2A.3_D_ananassae.fasta (1 sequences, 227 bp, 36.6% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-1|M00747 IRF1| 2.78 GC_box|M00255 GC box V$GC_01| 2.06 TATA_box|M00252 TATA V$TATA_01| 1.16 IRF-7|M00453 V$IRF7_01 IRF-7| 0.542 E2F|M00516 E2F V$E2F_03| 0.229 HEX|Hexamer| 0.0368 HiNF-D|HiNF-D| -0.0492 NEG|Negative element| -0.319 TBP|M00713 TBP F$TBP_Q6| -0.974 Oct-1|M00138 V$OCT1_04 Oct-1| -1.41 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.5 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -3.24 SPT10|Spt10p| -4.88 AACCCT_box|AACCCT S. pombe| -5.69 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H2A.3_D_ananassae droAna1_dna range=2447780:997-1223 CG17949-RA CG31618-RA >droAna1_dna range=2447780:997-1223 CG17949-RA CG31618-RA >droMoj1_dna range=contig_9922:2029-2255 CG17949-RA CG31618-RA IRF-7|M00453 V$IRF7_01 IRF-7| 3 - 20 - gttactttcaaattcact 6.45 IRF-1|M00747 IRF1| 15 - 21 + ttcactt 7.61 IRF-1|M00747 IRF1| 20 - 26 + ttcactt 7.61 GC_box|M00255 GC box V$GC_01| 117 - 130 - acgacctaccccca 8.12 IRF-1|M00747 IRF1| 130 - 136 - aactgaa 6.8 TATA_box|M00252 TATA V$TATA_01| 156 - 170 + gtataaattggtggt 7.13 IRF-1|M00747 IRF1| 200 - 206 - aagtgaa 7.62 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H2A_H2B_S_purpuratus.fasta (1 sequences, 521 bp, 48.6% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score Oct-1|M00138 V$OCT1_04 Oct-1| 3.72 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 2.05 TATA_box|M00252 TATA V$TATA_01| 1.84 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1.19 HiNF-D|HiNF-D| 1.17 TBP|M00713 TBP F$TBP_Q6| 0.435 IRF-1|M00747 IRF1| -0.165 HEX|Hexamer| -0.378 NEG|Negative element| -0.666 E2F|M00516 E2F V$E2F_03| -0.903 IRF-7|M00453 V$IRF7_01 IRF-7| -1.83 SPT10|Spt10p| -2.49 GC_box|M00255 GC box V$GC_01| -3.15 AACCCT_box|AACCCT S. pombe| -5.4 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H2A_H2B_S_purpuratus ref|NW_791222.1|SpuUn_WGA357_1:140158-140678 Strongylocentrotus purpuratus chromosome Un genomic contig, whole genome shotgun sequence TATA_box|M00252 TATA V$TATA_01| 52 - 66 - cacttctatttatac 8.43 TBP|M00713 TBP F$TBP_Q6| 58 - 66 + tatttatac 6.32 Oct-1|M00138 V$OCT1_04 Oct-1| 89 - 111 + atacgtttatgaaaattagtccg 9.73 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 138 - 149 + gcaagccattca 6.19 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 140 - 150 + aagccattcag 6.67 HiNF-D|HiNF-D| 268 - 283 - ggcccccgctgttcgg 7.45 Oct-1|M00138 V$OCT1_04 Oct-1| 284 - 306 - gcgacacatttgcatacacccgt 7.66 Oct-1|M00138 V$OCT1_04 Oct-1| 329 - 351 + gcacgtatatgcaaataatagtg 9.99 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 384 - 394 - ctgattggctc 8.83 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 385 - 396 - tgattggctccc 7.91 HiNF-D|HiNF-D| 401 - 416 - gatcctcgctgtgcgt 6.69 TATA_box|M00252 TATA V$TATA_01| 434 - 448 + gtataaatccctagc 7.25 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H2B.1_D_ananassae.fasta (1 sequences, 234 bp, 38% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-1|M00747 IRF1| 2.81 GC_box|M00255 GC box V$GC_01| 1.96 TATA_box|M00252 TATA V$TATA_01| 1.04 IRF-7|M00453 V$IRF7_01 IRF-7| 0.686 E2F|M00516 E2F V$E2F_03| 0.146 HEX|Hexamer| -0.0103 HiNF-D|HiNF-D| -0.24 NEG|Negative element| -0.424 TBP|M00713 TBP F$TBP_Q6| -0.868 Oct-1|M00138 V$OCT1_04 Oct-1| -1.43 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.75 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -3.41 SPT10|Spt10p| -5.05 AACCCT_box|AACCCT S. pombe| -5.8 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H2B.1_D_ananassae droAna1_dna range=2452363:514-747 CG17949-RA CG31618-RA >droAna1_dna range=2452363:514-747 CG17949-RA CG31618-RA IRF-7|M00453 V$IRF7_01 IRF-7| 10 - 27 - gttactttcaaattcact 6.66 IRF-1|M00747 IRF1| 22 - 28 + ttcactt 7.73 IRF-1|M00747 IRF1| 27 - 33 + ttcactt 7.73 GC_box|M00255 GC box V$GC_01| 124 - 137 - acgacctaccccca 8.05 IRF-1|M00747 IRF1| 137 - 143 - aactgaa 6.82 TATA_box|M00252 TATA V$TATA_01| 163 - 177 + gtataaattggtggt 7.03 IRF-1|M00747 IRF1| 207 - 213 - aagtgaa 7.58 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H2B.1_D_pseudoobscura.fasta (1 sequences, 151 bp, 33.1% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score GC_box|M00255 GC box V$GC_01| 0.602 Oct-1|M00138 V$OCT1_04 Oct-1| 0.464 TBP|M00713 TBP F$TBP_Q6| -0.117 IRF-1|M00747 IRF1| -0.996 HEX|Hexamer| -1.34 NEG|Negative element| -1.38 E2F|M00516 E2F V$E2F_03| -1.47 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -1.58 TATA_box|M00252 TATA V$TATA_01| -1.69 HiNF-D|HiNF-D| -1.73 IRF-7|M00453 V$IRF7_01 IRF-7| -1.94 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.66 SPT10|Spt10p| -4.34 AACCCT_box|AACCCT S. pombe| -6.2 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H2B.1_D_pseudoobscura dp3_dna range=chrXL_group1e:10045565-10045715 U.D_pseudoobscura.copy1 CG17949-RA >dp3_dna range=chrXL_group1e:10045565-10045715 U.D_pseudoobscura.copy1 CG17949-RA GC_box|M00255 GC box V$GC_01| 134 - 147 + gcagggaagagcat 6.14 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H2B.1_D_simulans.fasta (1 sequences, 228 bp, 43% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-1|M00747 IRF1| 3.03 TBP|M00713 TBP F$TBP_Q6| 1.67 TATA_box|M00252 TATA V$TATA_01| 1.49 Oct-1|M00138 V$OCT1_04 Oct-1| 0.0985 HiNF-D|HiNF-D| -0.0993 HEX|Hexamer| -0.176 IRF-7|M00453 V$IRF7_01 IRF-7| -0.278 E2F|M00516 E2F V$E2F_03| -0.776 GC_box|M00255 GC box V$GC_01| -1.18 NEG|Negative element| -1.28 SPT10|Spt10p| -2.75 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -3.34 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -3.58 AACCCT_box|AACCCT S. pombe| -5.1 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H2B.1_D_simulans droSim1_dna range=chrU:3636871-3637098 CG31618-RA CG17949-RA >droSim1_dna range=chrU:3636871-3637098 CG31618-RA CG17949-RA IRF-1|M00747 IRF1| 18 - 24 + ttcactt 7.89 IRF-1|M00747 IRF1| 27 - 33 + ttcactt 7.89 TATA_box|M00252 TATA V$TATA_01| 70 - 84 - gcggaatatttatac 6.91 IRF-1|M00747 IRF1| 104 - 110 + ttcagtt 7.08 TATA_box|M00252 TATA V$TATA_01| 153 - 167 + gtataaaggtgaacg 6.73 IRF-1|M00747 IRF1| 189 - 195 - aagtgaa 7.75 TBP|M00713 TBP F$TBP_Q6| 210 - 218 - atataagta 7.36 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H2B.1_D_virilis.fasta (1 sequences, 246 bp, 33.3% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-1|M00747 IRF1| 1.93 TATA_box|M00252 TATA V$TATA_01| 1.14 TBP|M00713 TBP F$TBP_Q6| 0.0122 HEX|Hexamer| -0.0169 NEG|Negative element| -0.594 Oct-1|M00138 V$OCT1_04 Oct-1| -0.79 HiNF-D|HiNF-D| -1.28 IRF-7|M00453 V$IRF7_01 IRF-7| -2.19 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.85 SPT10|Spt10p| -3.22 E2F|M00516 E2F V$E2F_03| -3.77 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -4.16 AACCCT_box|AACCCT S. pombe| -4.43 GC_box|M00255 GC box V$GC_01| -5.11 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H2B.1_D_virilis droVir1_dna range=scaffold_1633:2653-2898 CG31618-RA CG17949-RA >droVir1_dna range=scaffold_1633:2653-2898 CG31618-RA CG17949-RA IRF-1|M00747 IRF1| 112 - 118 + ttcagtt 6.72 TATA_box|M00252 TATA V$TATA_01| 170 - 184 + gtataaatgctaagc 7.02 IRF-1|M00747 IRF1| 224 - 230 - aagtgaa 7.64 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H2B.1_D_yakuba.fasta (1 sequences, 224 bp, 38.4% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-1|M00747 IRF1| 3.19 HiNF-D|HiNF-D| 1.84 TATA_box|M00252 TATA V$TATA_01| 1.38 TBP|M00713 TBP F$TBP_Q6| 0.973 IRF-7|M00453 V$IRF7_01 IRF-7| 0.708 HEX|Hexamer| -0.327 Oct-1|M00138 V$OCT1_04 Oct-1| -0.5 E2F|M00516 E2F V$E2F_03| -1.31 NEG|Negative element| -1.76 GC_box|M00255 GC box V$GC_01| -2.07 SPT10|Spt10p| -2.51 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -3.35 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -3.37 AACCCT_box|AACCCT S. pombe| -5.47 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H2B.1_D_yakuba droYak1_dna range=chrU:33422246-33422469 CG31618-RA CG17949-RA >droYak1_dna range=chrU:33422246-33422469 CG31618-RA CG17949-RA IRF-1|M00747 IRF1| 17 - 23 + ttcactt 7.91 IRF-1|M00747 IRF1| 26 - 32 + ttcactt 7.91 IRF-7|M00453 V$IRF7_01 IRF-7| 38 - 55 + acggaacacgaatgctgg 6.7 HiNF-D|HiNF-D| 91 - 106 - tgccagcgctttcagt 7.7 IRF-1|M00747 IRF1| 101 - 107 + ttcagtt 6.98 TATA_box|M00252 TATA V$TATA_01| 149 - 163 + gtataaaaatgaacg 7.4 IRF-1|M00747 IRF1| 155 - 161 - aaatgaa 6.2 IRF-1|M00747 IRF1| 185 - 191 - aagtgaa 7.43 TBP|M00713 TBP F$TBP_Q6| 206 - 214 - atataagta 6.77 IRF-1|M00747 IRF1| 215 - 221 - aagtgaa 7.43 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H2B.1_H2A.1_IR_A_gossypii.fasta (1 sequences, 363 bp, 64.5% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score TATA_box|M00252 TATA V$TATA_01| 5.48 TBP|M00713 TBP F$TBP_Q6| 4.41 SPT10|Spt10p| 1.99 NEG|Negative element| 0.0248 HEX|Hexamer| -0.395 HiNF-D|HiNF-D| -0.653 GC_box|M00255 GC box V$GC_01| -0.861 Oct-1|M00138 V$OCT1_04 Oct-1| -0.933 E2F|M00516 E2F V$E2F_03| -1.5 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.59 IRF-7|M00453 V$IRF7_01 IRF-7| -1.82 IRF-1|M00747 IRF1| -1.87 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -2.94 AACCCT_box|AACCCT S. pombe| -4.54 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H2B.1_H2A.1_IR_A_gossypii TATA_box|M00252 TATA V$TATA_01| 39 - 53 - cccctgtgtttatat 7.38 TATA_box|M00252 TATA V$TATA_01| 41 - 55 - cctgtgtttatatag 11.6 TBP|M00713 TBP F$TBP_Q6| 45 - 53 + tgtttatat 10.4 NEG|Negative element| 45 - 59 - tgtttatatagtttt 6.13 TATA_box|M00252 TATA V$TATA_01| 46 - 60 + gtttatatagttttc 7.08 TBP|M00713 TBP F$TBP_Q6| 47 - 55 + tttatatag 8.63 SPT10|Spt10p| 90 - 110 - gtcgcgaagctgcgggcacgc 8.05 SPT10|Spt10p| 227 - 247 + tggtgccagttttttcacaga 6.18 SPT10|Spt10p| 249 - 269 - gctgcgaaacgcgtggcacag 7.13 TATA_box|M00252 TATA V$TATA_01| 292 - 306 - gagcggtatataaag 7.2 TBP|M00713 TBP F$TBP_Q6| 297 - 305 - gtatataaa 7.19 TATA_box|M00252 TATA V$TATA_01| 297 - 311 + gtatataaaggcccc 10.7 TBP|M00713 TBP F$TBP_Q6| 298 - 306 + tatataaag 6.68 TBP|M00713 TBP F$TBP_Q6| 299 - 307 - atataaagg 9.77 TATA_box|M00252 TATA V$TATA_01| 299 - 313 + atataaaggccccct 8.94 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H2B.1_H2A.1_IR_A_nidulans.fasta (1 sequences, 685 bp, 47.6% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 1.17 TATA_box|M00252 TATA V$TATA_01| 1.04 IRF-7|M00453 V$IRF7_01 IRF-7| 0.928 HiNF-D|HiNF-D| 0.701 E2F|M00516 E2F V$E2F_03| 0.569 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.433 TBP|M00713 TBP F$TBP_Q6| -0.0357 Oct-1|M00138 V$OCT1_04 Oct-1| -0.112 HEX|Hexamer| -0.34 IRF-1|M00747 IRF1| -0.541 NEG|Negative element| -0.873 GC_box|M00255 GC box V$GC_01| -1.3 SPT10|Spt10p| -3.26 AACCCT_box|AACCCT S. pombe| -4.26 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H2B.1_H2A.1_IR_A_nidulans HiNF-D|HiNF-D| 4 - 19 - cgccagtgctaggctt 6.4 IRF-7|M00453 V$IRF7_01 IRF-7| 54 - 71 + gataaattcgaaagttga 7.66 TATA_box|M00252 TATA V$TATA_01| 197 - 211 - gcgcgctacttatac 7.53 E2F|M00516 E2F V$E2F_03| 211 - 222 - cttggctccaaa 6.61 Oct-1|M00138 V$OCT1_04 Oct-1| 278 - 300 - ttgtatgatttgtatgattagaa 6.17 E2F|M00516 E2F V$E2F_03| 328 - 339 + attggcggcagg 6.81 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 452 - 462 - ctcattgattg 8.18 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 456 - 466 - ttgattggttg 6.29 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 457 - 468 - tgattggttgac 7.48 TATA_box|M00252 TATA V$TATA_01| 526 - 540 - ggtgtcgttatatat 6.09 TATA_box|M00252 TATA V$TATA_01| 533 - 547 + ttatatatgccctcc 6.87 HiNF-D|HiNF-D| 555 - 570 - cgcgatagctgtcgtc 6.25 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H2B.1_H2A.1_IR_C_albicans.fasta (1 sequences, 546 bp, 31.9% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score HiNF-D|HiNF-D| 1.35 IRF-1|M00747 IRF1| 1.16 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.609 SPT10|Spt10p| 0.436 TBP|M00713 TBP F$TBP_Q6| 0.259 Oct-1|M00138 V$OCT1_04 Oct-1| 0.101 HEX|Hexamer| -0.566 TATA_box|M00252 TATA V$TATA_01| -0.975 NEG|Negative element| -1.68 IRF-7|M00453 V$IRF7_01 IRF-7| -2.22 E2F|M00516 E2F V$E2F_03| -2.29 AACCCT_box|AACCCT S. pombe| -2.35 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.37 GC_box|M00255 GC box V$GC_01| -4.38 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H2B.1_H2A.1_IR_C_albicans IRF-1|M00747 IRF1| 55 - 61 - aactgaa 6.88 TBP|M00713 TBP F$TBP_Q6| 68 - 76 - atataaaaa 6.1 HiNF-D|HiNF-D| 223 - 238 + acgtagtgcgatggag 6.65 IRF-1|M00747 IRF1| 288 - 294 - aagagaa 6.37 HiNF-D|HiNF-D| 303 - 318 + agagaaagagagggag 7.13 HiNF-D|HiNF-D| 357 - 372 - ctccttctctctcttg 6.94 SPT10|Spt10p| 367 - 387 + ctcttgtcacttcttcttcct 7.08 Oct-1|M00138 V$OCT1_04 Oct-1| 481 - 503 - tttcttaatttccataactttat 6.34 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 520 - 531 + cacaaccaaaca 7.49 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H2B.1_H2A.1_IR_K_waltii.fasta (1 sequences, 577 bp, 48.2% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score SPT10|Spt10p| 3.71 TATA_box|M00252 TATA V$TATA_01| 3.15 E2F|M00516 E2F V$E2F_03| 2.43 TBP|M00713 TBP F$TBP_Q6| 2.36 IRF-7|M00453 V$IRF7_01 IRF-7| 1.54 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 1.06 HiNF-D|HiNF-D| 0.584 Oct-1|M00138 V$OCT1_04 Oct-1| -0.00237 IRF-1|M00747 IRF1| -0.101 HEX|Hexamer| -0.251 NEG|Negative element| -0.565 GC_box|M00255 GC box V$GC_01| -0.604 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -3 AACCCT_box|AACCCT S. pombe| -3.81 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H2B.1_H2A.1_IR_K_waltii TATA_box|M00252 TATA V$TATA_01| 68 - 82 - ctgctctctttatat 8.23 TATA_box|M00252 TATA V$TATA_01| 70 - 84 - gctctctttatatac 9.74 TBP|M00713 TBP F$TBP_Q6| 74 - 82 + tctttatat 9.11 TATA_box|M00252 TATA V$TATA_01| 75 - 89 + ctttatatacgcctt 6.51 E2F|M00516 E2F V$E2F_03| 88 - 99 + tttgccggccgc 6.5 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 126 - 136 + caatcaatgag 8.03 E2F|M00516 E2F V$E2F_03| 165 - 176 + tatcgcgcgaac 7.82 E2F|M00516 E2F V$E2F_03| 165 - 176 - tatcgcgcgaac 9.14 Oct-1|M00138 V$OCT1_04 Oct-1| 193 - 215 - ccatcgtatattaattttttctc 6.61 SPT10|Spt10p| 198 - 218 + gtatattaattttttctcacc 6.69 IRF-7|M00453 V$IRF7_01 IRF-7| 218 - 235 - caaaatttcccttttcgg 8.52 HiNF-D|HiNF-D| 302 - 317 + atggaaagcggcgcga 6.21 SPT10|Spt10p| 323 - 343 + gtgttccaggaagttcgcacg 10.7 TATA_box|M00252 TATA V$TATA_01| 468 - 482 + gtatataaaggaggt 8.43 TBP|M00713 TBP F$TBP_Q6| 470 - 478 - atataaagg 7.7 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H2B.1_H2A.1_IR_S_bayanus.fasta (1 sequences, 819 bp, 38.7% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score SPT10|Spt10p| 8.33 E2F|M00516 E2F V$E2F_03| 3.58 TBP|M00713 TBP F$TBP_Q6| 1.07 IRF-7|M00453 V$IRF7_01 IRF-7| 0.753 HiNF-D|HiNF-D| 0.517 TATA_box|M00252 TATA V$TATA_01| 0.38 IRF-1|M00747 IRF1| 0.263 HEX|Hexamer| -0.311 NEG|Negative element| -0.881 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -1.04 Oct-1|M00138 V$OCT1_04 Oct-1| -1.09 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.13 GC_box|M00255 GC box V$GC_01| -2.14 AACCCT_box|AACCCT S. pombe| -2.36 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H2B.1_H2A.1_IR_S_bayanus TBP|M00713 TBP F$TBP_Q6| 34 - 42 + tacttatat 6.79 IRF-1|M00747 IRF1| 83 - 89 - aagagaa 6.99 TATA_box|M00252 TATA V$TATA_01| 130 - 144 - ctgttgtttatatac 7.16 TBP|M00713 TBP F$TBP_Q6| 134 - 142 + tgtttatat 6.32 SPT10|Spt10p| 250 - 270 + ccgttcccggtttttcgcgtg 13.7 E2F|M00516 E2F V$E2F_03| 281 - 292 + ttgcccgcgaaa 8.04 E2F|M00516 E2F V$E2F_03| 281 - 292 - ttgcccgcgaaa 10.9 SPT10|Spt10p| 284 - 304 - cccgcgaaaaaacgggaacag 11.6 IRF-7|M00453 V$IRF7_01 IRF-7| 301 - 318 - acagccttccctttcggg 8.02 SPT10|Spt10p| 406 - 426 + ctgttccaagtttttcgcccc 15.5 HiNF-D|HiNF-D| 420 - 435 - tcgccccgctgtgcga 6.9 SPT10|Spt10p| 429 - 449 - tgtgcgaagccgttggcatgg 10.6 TBP|M00713 TBP F$TBP_Q6| 647 - 655 - atataaata 7.28 TATA_box|M00252 TATA V$TATA_01| 647 - 661 + atataaataaggtgc 6.55 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H2B.1_H2A.1_IR_S_castellii.fasta (1 sequences, 705 bp, 38% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score SPT10|Spt10p| 7.05 E2F|M00516 E2F V$E2F_03| 4.88 TBP|M00713 TBP F$TBP_Q6| 1.03 IRF-7|M00453 V$IRF7_01 IRF-7| 0.559 HiNF-D|HiNF-D| -0.351 IRF-1|M00747 IRF1| -0.487 HEX|Hexamer| -0.572 NEG|Negative element| -0.641 TATA_box|M00252 TATA V$TATA_01| -0.658 Oct-1|M00138 V$OCT1_04 Oct-1| -0.673 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -1.92 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.17 AACCCT_box|AACCCT S. pombe| -3.36 GC_box|M00255 GC box V$GC_01| -3.74 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H2B.1_H2A.1_IR_S_castellii TBP|M00713 TBP F$TBP_Q6| 32 - 40 - atataaata 6.99 TBP|M00713 TBP F$TBP_Q6| 115 - 123 + catttatat 7.25 SPT10|Spt10p| 222 - 242 + ccgttccacaagtttcacact 11.2 E2F|M00516 E2F V$E2F_03| 244 - 255 + tgtcgcggcgaa 7.34 E2F|M00516 E2F V$E2F_03| 264 - 275 + cctcgcgcgaaa 8.23 E2F|M00516 E2F V$E2F_03| 264 - 275 - cctcgcgcgaaa 12.1 SPT10|Spt10p| 267 - 287 - cgcgcgaaacttctggcatga 10.3 IRF-7|M00453 V$IRF7_01 IRF-7| 298 - 315 - attaatttccctttcggg 7.44 SPT10|Spt10p| 401 - 421 + gcgttccaaaaatttcacact 14.2 SPT10|Spt10p| 424 - 444 - ggggcgaacgtcagagcatgg 7.7 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H2B.1_H2A.1_IR_S_cerevisiae.fasta (1 sequences, 819 bp, 36.8% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score SPT10|Spt10p| 9.1 NEG|Negative element| 5.4 E2F|M00516 E2F V$E2F_03| 2.83 IRF-7|M00453 V$IRF7_01 IRF-7| 1.05 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.675 IRF-1|M00747 IRF1| 0.609 TBP|M00713 TBP F$TBP_Q6| 0.581 HiNF-D|HiNF-D| 0.517 GC_box|M00255 GC box V$GC_01| 0.494 HEX|Hexamer| 0.0174 TATA_box|M00252 TATA V$TATA_01| -0.315 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.97 Oct-1|M00138 V$OCT1_04 Oct-1| -1.34 AACCCT_box|AACCCT S. pombe| -4.69 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H2B.1_H2A.1_IR_S_cerevisiae TATA_box|M00252 TATA V$TATA_01| 31 - 45 - gacttgtctatatag 6.01 IRF-1|M00747 IRF1| 81 - 87 - aagagaa 6.91 TATA_box|M00252 TATA V$TATA_01| 127 - 141 - atgttgtttatatac 6.02 TBP|M00713 TBP F$TBP_Q6| 131 - 139 + tgtttatat 6.23 IRF-1|M00747 IRF1| 224 - 230 + ttctctt 6.41 SPT10|Spt10p| 244 - 264 + tcgttctcattttttcgcgga 12.6 E2F|M00516 E2F V$E2F_03| 256 - 267 + tttcgcggaaga 8.16 HiNF-D|HiNF-D| 259 - 274 + cgcggaagaaagggtg 7.34 E2F|M00516 E2F V$E2F_03| 275 - 286 - caacgcgcgaaa 10 SPT10|Spt10p| 278 - 298 - cgcgcgaaaaagtgagaacag 15.8 IRF-7|M00453 V$IRF7_01 IRF-7| 295 - 312 - acagccttccctttcggg 8.35 E2F|M00516 E2F V$E2F_03| 306 - 317 + tttcgggcgaca 6.21 E2F|M00516 E2F V$E2F_03| 306 - 317 - tttcgggcgaca 6.11 NEG|Negative element| 314 - 328 - gacattgagcgtcta 12.8 SPT10|Spt10p| 400 - 420 + ctgttccaaaattttcgcctc 15.2 SPT10|Spt10p| 423 - 443 - tgtgcgaagctattggaatgg 15 GC_box|M00255 GC box V$GC_01| 575 - 588 - cacccccttccccg 6.1 GC_box|M00255 GC box V$GC_01| 576 - 589 - acccccttccccgt 7.59 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 597 - 608 + gccagccagtgg 7.88 TBP|M00713 TBP F$TBP_Q6| 646 - 654 - atataaata 6.93 IRF-1|M00747 IRF1| 723 - 729 + ttctctt 6.41 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H2B.1_H2A.1_IR_S_kluyveri.fasta (1 sequences, 498 bp, 37.3% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score SPT10|Spt10p| 4.22 E2F|M00516 E2F V$E2F_03| 3.17 TATA_box|M00252 TATA V$TATA_01| 1.17 TBP|M00713 TBP F$TBP_Q6| 1.07 NEG|Negative element| 0.594 Oct-1|M00138 V$OCT1_04 Oct-1| 0.55 HiNF-D|HiNF-D| 0.52 IRF-1|M00747 IRF1| -0.00156 HEX|Hexamer| -0.0926 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.337 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.66 IRF-7|M00453 V$IRF7_01 IRF-7| -1.73 GC_box|M00255 GC box V$GC_01| -2.99 AACCCT_box|AACCCT S. pombe| -4.08 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H2B.1_H2A.1_IR_S_kluyveri Oct-1|M00138 V$OCT1_04 Oct-1| 29 - 51 + ttaaagatatgcaaaaatttgcg 6.99 NEG|Negative element| 137 - 151 + ataacgcgacatgtc 6.74 SPT10|Spt10p| 156 - 176 + gcgtgccagtttcttcgcggg 9.17 E2F|M00516 E2F V$E2F_03| 168 - 179 + cttcgcgggaga 9.55 E2F|M00516 E2F V$E2F_03| 168 - 179 - cttcgcgggaga 7.82 TATA_box|M00252 TATA V$TATA_01| 180 - 194 + gaataaaaagcgcga 7.76 E2F|M00516 E2F V$E2F_03| 185 - 196 - aaaagcgcgaaa 6.72 SPT10|Spt10p| 188 - 208 - agcgcgaaaaatctggtacag 10.1 E2F|M00516 E2F V$E2F_03| 243 - 254 + tttcgcggtcga 8.62 HiNF-D|HiNF-D| 246 - 261 - cgcggtcgacctccct 6.84 SPT10|Spt10p| 280 - 300 - gatgtgaaatctatggcacac 8.31 SPT10|Spt10p| 304 - 324 + gcgttccaaagttttcgccaa 10.1 TBP|M00713 TBP F$TBP_Q6| 401 - 409 - atataaatg 7.23 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 468 - 479 + accacccaataa 6.35 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H2B.1_H2A.1_IR_S_kudriavzevii.fasta (1 sequences, 816 bp, 38% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score SPT10|Spt10p| 7.06 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 1.48 E2F|M00516 E2F V$E2F_03| 0.91 TATA_box|M00252 TATA V$TATA_01| 0.877 TBP|M00713 TBP F$TBP_Q6| 0.813 HiNF-D|HiNF-D| 0.257 IRF-7|M00453 V$IRF7_01 IRF-7| 0.248 IRF-1|M00747 IRF1| 0.241 HEX|Hexamer| -0.385 Oct-1|M00138 V$OCT1_04 Oct-1| -0.431 GC_box|M00255 GC box V$GC_01| -0.841 NEG|Negative element| -1.19 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -1.47 AACCCT_box|AACCCT S. pombe| -4.7 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H2B.1_H2A.1_IR_S_kudriavzevii Oct-1|M00138 V$OCT1_04 Oct-1| 32 - 54 + gtttagttatttaaattaagaaa 6.28 IRF-7|M00453 V$IRF7_01 IRF-7| 81 - 98 + aaggaaaggaacattcgg 6.35 TATA_box|M00252 TATA V$TATA_01| 132 - 146 - ctcttgtttatatac 7.23 TBP|M00713 TBP F$TBP_Q6| 136 - 144 + tgtttatat 6.33 IRF-1|M00747 IRF1| 230 - 236 + ttctctt 6.58 SPT10|Spt10p| 249 - 269 + ccgttctcattttttcgctgg 9.69 E2F|M00516 E2F V$E2F_03| 261 - 272 + tttcgctggcaa 6.13 E2F|M00516 E2F V$E2F_03| 280 - 291 - cagcacgcgaaa 7.17 SPT10|Spt10p| 283 - 303 - cacgcgaaaaaatgagaacag 14.2 E2F|M00516 E2F V$E2F_03| 311 - 322 + tttcgggcgatg 7.54 IRF-7|M00453 V$IRF7_01 IRF-7| 363 - 380 + ttgaaatttgaactcggc 6.65 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 395 - 405 - ctcattagcgg 8.82 SPT10|Spt10p| 405 - 425 + gcgttccagatttttcgcccg 12.5 SPT10|Spt10p| 428 - 448 - tgtgcgaagctattggtatgg 12 HiNF-D|HiNF-D| 429 - 444 - gtgcgaagctattggt 6.01 TATA_box|M00252 TATA V$TATA_01| 651 - 665 + atataaataaggcgc 7.48 TBP|M00713 TBP F$TBP_Q6| 651 - 659 - atataaata 7.09 GC_box|M00255 GC box V$GC_01| 699 - 712 - acactcttcccatt 6.07 IRF-1|M00747 IRF1| 712 - 718 + ttctctt 6.58 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H2B.1_H2A.1_IR_S_mikatae.fasta (1 sequences, 830 bp, 35.2% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score SPT10|Spt10p| 7.94 E2F|M00516 E2F V$E2F_03| 3.63 IRF-7|M00453 V$IRF7_01 IRF-7| 0.908 TBP|M00713 TBP F$TBP_Q6| 0.722 IRF-1|M00747 IRF1| 0.179 NEG|Negative element| 0.146 HiNF-D|HiNF-D| -0.0527 HEX|Hexamer| -0.282 TATA_box|M00252 TATA V$TATA_01| -0.323 Oct-1|M00138 V$OCT1_04 Oct-1| -0.53 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.936 GC_box|M00255 GC box V$GC_01| -2.03 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -2.58 AACCCT_box|AACCCT S. pombe| -4.84 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H2B.1_H2A.1_IR_S_mikatae IRF-1|M00747 IRF1| 240 - 246 + ttctctt 6.18 SPT10|Spt10p| 259 - 279 + tcgttctccttttttcgcgcg 10.5 E2F|M00516 E2F V$E2F_03| 271 - 282 + tttcgcgcggtg 11 NEG|Negative element| 291 - 305 + tgtacgcgaaaaaag 6.2 SPT10|Spt10p| 293 - 313 - tacgcgaaaaaaggagaacgg 12.9 IRF-7|M00453 V$IRF7_01 IRF-7| 310 - 327 - acgggcttccctttcggg 8.25 NEG|Negative element| 329 - 343 - gattaagagcgtcta 6.86 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 405 - 415 - ctcattagcgc 6.25 SPT10|Spt10p| 415 - 435 + ctgttccaaaactttcgcccc 14.2 SPT10|Spt10p| 438 - 458 - tgtgcgaagctattggaatgg 14.8 SPT10|Spt10p| 609 - 629 + ctgttcgatgaattccgcatg 9.99 TBP|M00713 TBP F$TBP_Q6| 659 - 667 - atataaata 6.91 TATA_box|M00252 TATA V$TATA_01| 659 - 673 + atataaataaggtgc 6.43 IRF-1|M00747 IRF1| 711 - 717 + ttctctt 6.18 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H2B.1_H2A.1_IR_S_paradoxus.fasta (1 sequences, 819 bp, 36.4% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score SPT10|Spt10p| 8.77 E2F|M00516 E2F V$E2F_03| 4.62 IRF-7|M00453 V$IRF7_01 IRF-7| 0.777 TBP|M00713 TBP F$TBP_Q6| 0.673 TATA_box|M00252 TATA V$TATA_01| 0.63 IRF-1|M00747 IRF1| 0.623 HiNF-D|HiNF-D| 0.602 NEG|Negative element| 0.298 HEX|Hexamer| 0.147 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.105 Oct-1|M00138 V$OCT1_04 Oct-1| -0.573 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.03 GC_box|M00255 GC box V$GC_01| -2.72 AACCCT_box|AACCCT S. pombe| -4.87 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H2B.1_H2A.1_IR_S_paradoxus TATA_box|M00252 TATA V$TATA_01| 129 - 143 - ctgttgtttatatac 7.02 TBP|M00713 TBP F$TBP_Q6| 133 - 141 + tgtttatat 6.15 IRF-1|M00747 IRF1| 225 - 231 + ttctctt 6.24 HiNF-D|HiNF-D| 239 - 254 - ctccatcgttctcctt 7.35 SPT10|Spt10p| 244 - 264 + tcgttctccttttttcgcgcg 10.5 E2F|M00516 E2F V$E2F_03| 256 - 267 + tttcgcgcgctg 11.9 E2F|M00516 E2F V$E2F_03| 256 - 267 - tttcgcgcgctg 6.05 E2F|M00516 E2F V$E2F_03| 275 - 286 - tcacccgcgaaa 8.97 SPT10|Spt10p| 278 - 298 - cccgcgaaaaaaagagaacag 11.2 IRF-1|M00747 IRF1| 289 - 295 - aagagaa 7.08 IRF-7|M00453 V$IRF7_01 IRF-7| 295 - 312 - acaggcttccctttcggg 8.07 E2F|M00516 E2F V$E2F_03| 306 - 317 + tttcgggcgacg 6.59 NEG|Negative element| 314 - 328 - gacgaagagcgtcta 7.42 SPT10|Spt10p| 400 - 420 + ctgttccaaaattttcgcccc 15.6 SPT10|Spt10p| 423 - 443 - tgtgcgaaactattggaatgg 15.3 HEX|Hexamer| 556 - 561 + gacttc 6.78 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 591 - 602 + cgaaaccagtca 7.3 TBP|M00713 TBP F$TBP_Q6| 646 - 654 - atataaata 6.95 TATA_box|M00252 TATA V$TATA_01| 646 - 660 + atataaataagaggc 6.91 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H2B.1_H2A.1_IR_S_pombe.fasta (1 sequences, 562 bp, 35.1% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score AACCCT_box|AACCCT S. pombe| 17.9 HiNF-D|HiNF-D| 0.93 TBP|M00713 TBP F$TBP_Q6| 0.773 TATA_box|M00252 TATA V$TATA_01| 0.627 Oct-1|M00138 V$OCT1_04 Oct-1| -0.071 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.267 IRF-1|M00747 IRF1| -0.607 HEX|Hexamer| -0.69 IRF-7|M00453 V$IRF7_01 IRF-7| -0.792 NEG|Negative element| -1.13 SPT10|Spt10p| -1.49 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.53 E2F|M00516 E2F V$E2F_03| -1.85 GC_box|M00255 GC box V$GC_01| -2.88 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H2B.1_H2A.1_IR_S_pombe TBP|M00713 TBP F$TBP_Q6| 195 - 203 + tgtttatat 6.55 TATA_box|M00252 TATA V$TATA_01| 289 - 303 - ccttcatatatatac 6.26 HiNF-D|HiNF-D| 357 - 372 - ccgcgtcgcatggcta 6.7 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 363 - 374 - cgcatggctaaa 6.36 AACCCT_box|AACCCT S. pombe| 376 - 398 - accagggttagggttgtgatgcc 24.8 TATA_box|M00252 TATA V$TATA_01| 405 - 419 + gtatataaccatcgc 6.86 HiNF-D|HiNF-D| 411 - 426 - aaccatcgcgtcgcct 6.03 HiNF-D|HiNF-D| 416 - 431 - tcgcgtcgcctgcagg 6.37 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H2B.2_D_pseudoobscura.fasta (1 sequences, 523 bp, 48.4% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-1|M00747 IRF1| 1.99 TATA_box|M00252 TATA V$TATA_01| 1.17 TBP|M00713 TBP F$TBP_Q6| 0.833 Oct-1|M00138 V$OCT1_04 Oct-1| 0.476 IRF-7|M00453 V$IRF7_01 IRF-7| 0.425 HEX|Hexamer| 0.191 HiNF-D|HiNF-D| 0.0741 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.521 NEG|Negative element| -0.76 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -1.1 GC_box|M00255 GC box V$GC_01| -2.43 E2F|M00516 E2F V$E2F_03| -2.55 SPT10|Spt10p| -2.72 AACCCT_box|AACCCT S. pombe| -3.98 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H2B.2_D_pseudoobscura dp3_dna range=chrXL_group1e:10046014-10046536 U.D_pseudoobscura.copy2 U.D_pseudoobscura.copy3 >dp3_dna range=chrXL_group1e:10046014-10046536 U.D_pseudoobscura.copy2 U.D_pseudoobscura.copy3 IRF-7|M00453 V$IRF7_01 IRF-7| 93 - 110 + cacgatttcgaaattcac 7.17 IRF-1|M00747 IRF1| 106 - 112 + ttcactt 7.78 Oct-1|M00138 V$OCT1_04 Oct-1| 183 - 205 + caggtttaatgcaaactaaacta 7.26 IRF-1|M00747 IRF1| 290 - 296 + ttcactt 7.78 TATA_box|M00252 TATA V$TATA_01| 335 - 349 - gtcttctatttatag 7.97 TBP|M00713 TBP F$TBP_Q6| 341 - 349 + tatttatag 7.39 IRF-1|M00747 IRF1| 515 - 521 - aactgaa 7.66 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H2B.2_D_simulans.fasta (1 sequences, 228 bp, 43% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-1|M00747 IRF1| 3.03 TBP|M00713 TBP F$TBP_Q6| 1.67 TATA_box|M00252 TATA V$TATA_01| 1.49 Oct-1|M00138 V$OCT1_04 Oct-1| 0.0985 HiNF-D|HiNF-D| -0.0993 HEX|Hexamer| -0.176 IRF-7|M00453 V$IRF7_01 IRF-7| -0.278 E2F|M00516 E2F V$E2F_03| -0.776 GC_box|M00255 GC box V$GC_01| -1.18 NEG|Negative element| -1.28 SPT10|Spt10p| -2.75 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -3.34 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -3.58 AACCCT_box|AACCCT S. pombe| -5.1 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H2B.2_D_simulans droSim1_dna range=chrU:554407-554634 CG17949-RA CG31618-RA >droSim1_dna range=chrU:554407-554634 CG17949-RA CG31618-RA TBP|M00713 TBP F$TBP_Q6| 11 - 19 + tacttatat 7.36 IRF-1|M00747 IRF1| 34 - 40 + ttcactt 7.75 TATA_box|M00252 TATA V$TATA_01| 62 - 76 - cgttcacctttatac 6.73 IRF-1|M00747 IRF1| 119 - 125 - aactgaa 7.08 TATA_box|M00252 TATA V$TATA_01| 145 - 159 + gtataaatattccgc 6.91 IRF-1|M00747 IRF1| 196 - 202 - aagtgaa 7.89 IRF-1|M00747 IRF1| 205 - 211 - aagtgaa 7.89 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H2B.2_D_yakuba.fasta (1 sequences, 228 bp, 38.2% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-1|M00747 IRF1| 3.17 HiNF-D|HiNF-D| 1.87 TATA_box|M00252 TATA V$TATA_01| 1.44 TBP|M00713 TBP F$TBP_Q6| 1.17 IRF-7|M00453 V$IRF7_01 IRF-7| 0.742 Oct-1|M00138 V$OCT1_04 Oct-1| -0.293 HEX|Hexamer| -0.322 GC_box|M00255 GC box V$GC_01| -0.882 NEG|Negative element| -1.3 E2F|M00516 E2F V$E2F_03| -1.86 SPT10|Spt10p| -2.11 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -3.54 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -4.18 AACCCT_box|AACCCT S. pombe| -5.05 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H2B.2_D_yakuba droYak1_dna range=chr2R:1277452-1277679 CG31618-RA CG17949-RA >droYak1_dna range=chr2R:1277452-1277679 CG31618-RA CG17949-RA IRF-1|M00747 IRF1| 18 - 24 + ttcactt 7.91 IRF-1|M00747 IRF1| 27 - 33 + ttcactt 7.91 IRF-7|M00453 V$IRF7_01 IRF-7| 39 - 56 + acggaacacgaatgctgg 6.76 HiNF-D|HiNF-D| 94 - 109 - tgccagcgctttcagt 7.73 IRF-1|M00747 IRF1| 104 - 110 + ttcagtt 6.95 TATA_box|M00252 TATA V$TATA_01| 153 - 167 + gtataaaaatgaacg 7.41 IRF-1|M00747 IRF1| 159 - 165 - aaatgaa 6.2 IRF-1|M00747 IRF1| 189 - 195 - aagtgaa 7.43 TBP|M00713 TBP F$TBP_Q6| 210 - 218 - atataagta 6.75 IRF-1|M00747 IRF1| 219 - 225 - aagtgaa 7.43 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H3.1_D_simulans.fasta (1 sequences, 282 bp, 37.9% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score TATA_box|M00252 TATA V$TATA_01| 2.87 TBP|M00713 TBP F$TBP_Q6| 1.31 IRF-1|M00747 IRF1| 0.646 NEG|Negative element| 0.234 HiNF-D|HiNF-D| -0.337 HEX|Hexamer| -0.496 SPT10|Spt10p| -1.23 Oct-1|M00138 V$OCT1_04 Oct-1| -1.54 IRF-7|M00453 V$IRF7_01 IRF-7| -1.54 E2F|M00516 E2F V$E2F_03| -1.93 GC_box|M00255 GC box V$GC_01| -2.25 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.41 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -3.96 AACCCT_box|AACCCT S. pombe| -6.83 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H3.1_D_simulans droSim1_dna range=chrU:13085550-13085831 CG31613-RA CG31611-RA >droSim1_dna range=chrU:13085550-13085831 CG31613-RA CG31611-RA TATA_box|M00252 TATA V$TATA_01| 71 - 85 - tacctacttatatag 6.45 TBP|M00713 TBP F$TBP_Q6| 75 - 83 + tacttatat 7 IRF-1|M00747 IRF1| 128 - 134 + ttcattt 6.49 TBP|M00713 TBP F$TBP_Q6| 195 - 203 - ctataaata 6.25 TATA_box|M00252 TATA V$TATA_01| 195 - 209 + ctataaataggggca 9.04 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H3.1_D_virilis.fasta (1 sequences, 300 bp, 35.3% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-1|M00747 IRF1| 1.82 TATA_box|M00252 TATA V$TATA_01| 1.29 TBP|M00713 TBP F$TBP_Q6| 0.884 HiNF-D|HiNF-D| 0.174 HEX|Hexamer| -0.706 Oct-1|M00138 V$OCT1_04 Oct-1| -1.13 IRF-7|M00453 V$IRF7_01 IRF-7| -1.25 NEG|Negative element| -1.29 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.82 SPT10|Spt10p| -2.55 GC_box|M00255 GC box V$GC_01| -3.54 E2F|M00516 E2F V$E2F_03| -3.68 AACCCT_box|AACCCT S. pombe| -3.73 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -4.58 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H3.1_D_virilis droVir1_dna range=scaffold_2274:1255-1554 CG31611-RA CG31613-RA >droVir1_dna range=scaffold_2274:1255-1554 CG31611-RA CG31613-RA IRF-1|M00747 IRF1| 4 - 10 + ttcactt 7.39 IRF-1|M00747 IRF1| 23 - 29 + ttcactt 7.39 TBP|M00713 TBP F$TBP_Q6| 76 - 84 + cgcttatat 6.08 TATA_box|M00252 TATA V$TATA_01| 76 - 90 - cgcttatatttatac 6.63 TATA_box|M00252 TATA V$TATA_01| 218 - 232 + ctatataagcgatac 6.93 TBP|M00713 TBP F$TBP_Q6| 220 - 228 - atataagcg 6.26 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H3.2_H4.2_IR_A_gossypii.fasta (1 sequences, 283 bp, 71.7% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score TATA_box|M00252 TATA V$TATA_01| 6.83 TBP|M00713 TBP F$TBP_Q6| 6.08 IRF-1|M00747 IRF1| 3.02 SPT10|Spt10p| 2.3 E2F|M00516 E2F V$E2F_03| 1.97 HiNF-D|HiNF-D| 0.37 IRF-7|M00453 V$IRF7_01 IRF-7| -0.0294 GC_box|M00255 GC box V$GC_01| -0.185 HEX|Hexamer| -0.505 NEG|Negative element| -1.78 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.09 Oct-1|M00138 V$OCT1_04 Oct-1| -2.34 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -3.65 AACCCT_box|AACCCT S. pombe| -5.8 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H3.2_H4.2_IR_A_gossypii TATA_box|M00252 TATA V$TATA_01| 43 - 57 - gccccgtgtttatat 7.18 TATA_box|M00252 TATA V$TATA_01| 45 - 59 - cccgtgtttatatac 12.5 TBP|M00713 TBP F$TBP_Q6| 49 - 57 + tgtttatat 12.1 TBP|M00713 TBP F$TBP_Q6| 50 - 58 - gtttatata 7.61 TATA_box|M00252 TATA V$TATA_01| 50 - 64 + gtttatatacgcccg 8.91 TBP|M00713 TBP F$TBP_Q6| 51 - 59 + tttatatac 9.07 TBP|M00713 TBP F$TBP_Q6| 52 - 60 - ttatatacg 7.28 IRF-7|M00453 V$IRF7_01 IRF-7| 64 - 81 - gcccctttctttttcccg 6.22 IRF-1|M00747 IRF1| 70 - 76 + ttctttt 9.26 E2F|M00516 E2F V$E2F_03| 206 - 217 - gcgcgcgcgaaa 8.15 SPT10|Spt10p| 209 - 229 - cgcgcgaaaaaactggaccgc 8.55 IRF-1|M00747 IRF1| 219 - 225 - aactgga 6.49 TATA_box|M00252 TATA V$TATA_01| 232 - 246 - ctgccgtataaatag 9.29 TBP|M00713 TBP F$TBP_Q6| 236 - 244 + cgtataaat 7.41 TBP|M00713 TBP F$TBP_Q6| 237 - 245 - gtataaata 10.8 TATA_box|M00252 TATA V$TATA_01| 237 - 251 + gtataaatagcccgc 12.2 TBP|M00713 TBP F$TBP_Q6| 238 - 246 + tataaatag 6.52 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H3.2_H4.2_IR_A_nidulans.fasta (1 sequences, 1135 bp, 51.5% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score AACCCT_box|AACCCT S. pombe| 3.7 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 2.32 GC_box|M00255 GC box V$GC_01| 2.2 SPT10|Spt10p| 1.96 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1.47 E2F|M00516 E2F V$E2F_03| 0.627 NEG|Negative element| 0.458 HEX|Hexamer| 0.0755 HiNF-D|HiNF-D| -6.45e-05 IRF-1|M00747 IRF1| -0.508 Oct-1|M00138 V$OCT1_04 Oct-1| -0.75 TBP|M00713 TBP F$TBP_Q6| -0.813 IRF-7|M00453 V$IRF7_01 IRF-7| -1.38 TATA_box|M00252 TATA V$TATA_01| -1.73 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H3.2_H4.2_IR_A_nidulans GC_box|M00255 GC box V$GC_01| 396 - 409 + agggggcgggtggg 8.23 GC_box|M00255 GC box V$GC_01| 430 - 443 + gagaggcgggtggt 6.35 E2F|M00516 E2F V$E2F_03| 537 - 548 + tttcgcggccca 7.07 E2F|M00516 E2F V$E2F_03| 617 - 628 + tttcccgggcag 7.62 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 624 - 635 + ggcagccaataa 7.06 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 626 - 636 + cagccaataag 9.98 AACCCT_box|AACCCT S. pombe| 677 - 699 + ctgatcccaaccccatccctgaa 11.4 GC_box|M00255 GC box V$GC_01| 877 - 890 - atgccccgccctct 9.64 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 889 - 899 - ctgattggtcg 6.98 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 890 - 901 - tgattggtcgat 9.02 SPT10|Spt10p| 992 - 1012 + ccattctcaacatctctcgcc 9.66 NEG|Negative element| 1019 - 1033 + ttgacgtttaattta 6.77 AACCCT_box|AACCCT S. pombe| 1038 - 1060 + cacctcacaactttaaccttaaa 6.16 NEG|Negative element| 1050 - 1064 + ttaaccttaaatctc 7 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H3.2_H4.2_IR_C_albicans.fasta (1 sequences, 968 bp, 33.3% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score SPT10|Spt10p| 4.66 E2F|M00516 E2F V$E2F_03| 3.24 AACCCT_box|AACCCT S. pombe| 0.783 GC_box|M00255 GC box V$GC_01| 0.515 HiNF-D|HiNF-D| 0.465 IRF-1|M00747 IRF1| 0.00687 NEG|Negative element| -0.038 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.157 Oct-1|M00138 V$OCT1_04 Oct-1| -0.299 TBP|M00713 TBP F$TBP_Q6| -0.302 HEX|Hexamer| -0.54 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.36 IRF-7|M00453 V$IRF7_01 IRF-7| -1.73 TATA_box|M00252 TATA V$TATA_01| -1.8 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H3.2_H4.2_IR_C_albicans HiNF-D|HiNF-D| 202 - 217 - ctccttctctctcgtt 7.08 E2F|M00516 E2F V$E2F_03| 219 - 230 + tttcgcgcgttg 10.1 GC_box|M00255 GC box V$GC_01| 258 - 271 + tgagggtgtgtgtg 7.76 E2F|M00516 E2F V$E2F_03| 297 - 308 + atgcgcgcccaa 8.07 E2F|M00516 E2F V$E2F_03| 297 - 308 - atgcgcgcccaa 9.8 HiNF-D|HiNF-D| 349 - 364 - ctctctctctctccgt 6.32 Oct-1|M00138 V$OCT1_04 Oct-1| 397 - 419 - acaagtaatttgcagattactct 6.15 GC_box|M00255 GC box V$GC_01| 435 - 448 - cacacacaccccaa 6.7 E2F|M00516 E2F V$E2F_03| 610 - 621 + tttcgcggactc 7.01 NEG|Negative element| 625 - 639 + tttacgctcaccaca 6.66 SPT10|Spt10p| 677 - 697 + tcgtgctcttattttcgcgca 12.2 E2F|M00516 E2F V$E2F_03| 689 - 700 + tttcgcgcactc 7.83 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 766 - 777 + ccaaaccaaaca 7.04 AACCCT_box|AACCCT S. pombe| 785 - 807 - atcacggtttggatagtcattcc 8.3 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H3.2_H4.2_IR_K_waltii.fasta (1 sequences, 601 bp, 41.9% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score SPT10|Spt10p| 4.37 TATA_box|M00252 TATA V$TATA_01| 3.42 E2F|M00516 E2F V$E2F_03| 2.38 TBP|M00713 TBP F$TBP_Q6| 1.1 IRF-1|M00747 IRF1| 0.743 NEG|Negative element| 0.412 HiNF-D|HiNF-D| -0.0821 HEX|Hexamer| -0.119 Oct-1|M00138 V$OCT1_04 Oct-1| -0.586 IRF-7|M00453 V$IRF7_01 IRF-7| -0.982 GC_box|M00255 GC box V$GC_01| -1.35 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.76 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -2.49 AACCCT_box|AACCCT S. pombe| -2.52 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H3.2_H4.2_IR_K_waltii NEG|Negative element| 10 - 24 - gactttgagtgtttt 6.66 TATA_box|M00252 TATA V$TATA_01| 73 - 87 - cctctctttttatac 10.4 IRF-1|M00747 IRF1| 124 - 130 + ttcagtt 7.21 NEG|Negative element| 200 - 214 - ggttttgcgcgaaaa 6.07 E2F|M00516 E2F V$E2F_03| 202 - 213 - ttttgcgcgaaa 8.99 E2F|M00516 E2F V$E2F_03| 202 - 213 + ttttgcgcgaaa 7.95 SPT10|Spt10p| 205 - 225 - tgcgcgaaaatatgagtccgc 11.4 E2F|M00516 E2F V$E2F_03| 222 - 233 - ccgcacgcgaaa 7.22 SPT10|Spt10p| 225 - 245 - cacgcgaaactaccggtccat 7.47 TATA_box|M00252 TATA V$TATA_01| 237 - 251 - ccggtccatttaaat 6.79 IRF-1|M00747 IRF1| 292 - 298 - aaatgaa 6.32 SPT10|Spt10p| 321 - 341 + tcggtccgttttattcacgcg 6.26 TATA_box|M00252 TATA V$TATA_01| 322 - 336 - cggtccgttttattc 6.48 SPT10|Spt10p| 349 - 369 - catgcgaatattggggcacga 7.75 TATA_box|M00252 TATA V$TATA_01| 512 - 526 + atatataaagaggca 6.82 TBP|M00713 TBP F$TBP_Q6| 512 - 520 - atatataaa 6.03 TATA_box|M00252 TATA V$TATA_01| 514 - 528 + atataaagaggcaca 6.41 TBP|M00713 TBP F$TBP_Q6| 514 - 522 - atataaaga 7.5 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H3.2_H4.2_IR_M_grisea.fasta (1 sequences, 1481 bp, 49% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.974 GC_box|M00255 GC box V$GC_01| 0.776 E2F|M00516 E2F V$E2F_03| 0.421 IRF-7|M00453 V$IRF7_01 IRF-7| 0.308 HEX|Hexamer| 0.166 IRF-1|M00747 IRF1| 0.051 HiNF-D|HiNF-D| -0.186 Oct-1|M00138 V$OCT1_04 Oct-1| -0.192 NEG|Negative element| -0.421 TBP|M00713 TBP F$TBP_Q6| -0.516 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.961 SPT10|Spt10p| -1.89 TATA_box|M00252 TATA V$TATA_01| -2.1 AACCCT_box|AACCCT S. pombe| -3.53 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H3.2_H4.2_IR_M_grisea GC_box|M00255 GC box V$GC_01| 227 - 240 + gtggggcggtgtgt 6.65 E2F|M00516 E2F V$E2F_03| 397 - 408 + cttggcgcaaaa 7.45 E2F|M00516 E2F V$E2F_03| 397 - 408 - cttggcgcaaaa 7.08 GC_box|M00255 GC box V$GC_01| 406 - 419 - aaaacccgcctcat 8.29 TBP|M00713 TBP F$TBP_Q6| 489 - 497 + tccttattt 6.35 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 513 - 524 - tgattggacagt 8.38 IRF-7|M00453 V$IRF7_01 IRF-7| 994 - 1011 - ccaggtctcggtttcctt 7.67 IRF-7|M00453 V$IRF7_01 IRF-7| 1000 - 1017 - ctcggtttcctttcctca 7.03 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1082 - 1093 + taggaccaatca 7.88 GC_box|M00255 GC box V$GC_01| 1244 - 1257 + tttaggtggggcgg 6.8 HEX|Hexamer| 1333 - 1338 + gacttc 6.79 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1380 - 1391 + accaaccaaaaa 6.13 Oct-1|M00138 V$OCT1_04 Oct-1| 1387 - 1409 - aaaaaacatatacattcatccta 6.72 NEG|Negative element| 1431 - 1445 - catcttgagccttca 6.23 IRF-1|M00747 IRF1| 1442 - 1448 + ttcattt 7.3 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H3.2_H4.2_IR_S_bayanus.fasta (1 sequences, 688 bp, 45.5% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score SPT10|Spt10p| 7.43 E2F|M00516 E2F V$E2F_03| 3.11 TBP|M00713 TBP F$TBP_Q6| 2.17 Oct-1|M00138 V$OCT1_04 Oct-1| 0.995 IRF-1|M00747 IRF1| 0.714 TATA_box|M00252 TATA V$TATA_01| 0.477 IRF-7|M00453 V$IRF7_01 IRF-7| 0.392 HiNF-D|HiNF-D| 0.228 NEG|Negative element| -0.552 HEX|Hexamer| -0.647 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -2.18 GC_box|M00255 GC box V$GC_01| -2.46 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.75 AACCCT_box|AACCCT S. pombe| -4.87 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H3.2_H4.2_IR_S_bayanus IRF-1|M00747 IRF1| 34 - 40 - aagagaa 7.03 TBP|M00713 TBP F$TBP_Q6| 113 - 121 + tacttatat 7.66 IRF-7|M00453 V$IRF7_01 IRF-7| 244 - 261 - gccaaattaccattccga 6.9 IRF-7|M00453 V$IRF7_01 IRF-7| 245 - 262 - ccaaattaccattccgaa 6.54 SPT10|Spt10p| 278 - 298 + gcgttccggcagtttcacgcg 12.5 SPT10|Spt10p| 302 - 322 - gatgcgaagtgcccggaacgg 14.5 E2F|M00516 E2F V$E2F_03| 336 - 347 + tttggcgccgcg 7.5 SPT10|Spt10p| 357 - 377 + gtggactgggtgcttcgcctt 7.47 SPT10|Spt10p| 389 - 409 + acgtgctgggcgcttcgcagc 9.13 E2F|M00516 E2F V$E2F_03| 420 - 431 - ccgggcgcgaaa 10.2 TBP|M00713 TBP F$TBP_Q6| 554 - 562 + cacatatat 6.12 Oct-1|M00138 V$OCT1_04 Oct-1| 566 - 588 - tgtatgtatctatatatatatat 6.56 Oct-1|M00138 V$OCT1_04 Oct-1| 571 - 593 + gtatctatatatatatatatgga 6.2 TBP|M00713 TBP F$TBP_Q6| 574 - 582 + tctatatat 6.69 TBP|M00713 TBP F$TBP_Q6| 576 - 584 + tatatatat 6.78 TBP|M00713 TBP F$TBP_Q6| 577 - 585 - atatatata 6.83 TBP|M00713 TBP F$TBP_Q6| 578 - 586 + tatatatat 6.78 TBP|M00713 TBP F$TBP_Q6| 579 - 587 - atatatata 6.83 TBP|M00713 TBP F$TBP_Q6| 580 - 588 + tatatatat 6.78 TBP|M00713 TBP F$TBP_Q6| 581 - 589 - atatatata 6.83 TBP|M00713 TBP F$TBP_Q6| 582 - 590 + tatatatat 6.78 TBP|M00713 TBP F$TBP_Q6| 583 - 591 - atatatatg 6.56 TBP|M00713 TBP F$TBP_Q6| 585 - 593 - atatatgga 6.12 IRF-1|M00747 IRF1| 617 - 623 + ttctctt 6.91 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H3.2_H4.2_IR_S_castellii.fasta (1 sequences, 516 bp, 40.3% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score SPT10|Spt10p| 4.21 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 2.29 Oct-1|M00138 V$OCT1_04 Oct-1| 1.56 IRF-7|M00453 V$IRF7_01 IRF-7| 1.53 HiNF-D|HiNF-D| 1.24 TBP|M00713 TBP F$TBP_Q6| 1.1 E2F|M00516 E2F V$E2F_03| 0.872 IRF-1|M00747 IRF1| 0.457 HEX|Hexamer| -0.083 TATA_box|M00252 TATA V$TATA_01| -0.183 NEG|Negative element| -0.473 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.07 GC_box|M00255 GC box V$GC_01| -2.03 AACCCT_box|AACCCT S. pombe| -5.67 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H3.2_H4.2_IR_S_castellii IRF-1|M00747 IRF1| 54 - 60 - aacagaa 6.02 IRF-1|M00747 IRF1| 60 - 66 - aaatgaa 6.26 TBP|M00713 TBP F$TBP_Q6| 99 - 107 - atataagaa 6.8 IRF-7|M00453 V$IRF7_01 IRF-7| 172 - 189 + acgaaaagggaaacaggc 6.61 E2F|M00516 E2F V$E2F_03| 184 - 195 - acaggcgcgaaa 7.65 SPT10|Spt10p| 187 - 207 - ggcgcgaaaaaaggggcacgt 9.1 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 205 - 216 - cgtttggccata 7.09 IRF-7|M00453 V$IRF7_01 IRF-7| 215 - 232 + tactaaagcgaatctgcc 8.01 SPT10|Spt10p| 219 - 239 - aaagcgaatctgccagcacgg 8.78 SPT10|Spt10p| 262 - 282 + ccgttccagaattttcggtct 6.77 HiNF-D|HiNF-D| 275 - 290 - ttcggtctctgtgggt 7.83 SPT10|Spt10p| 320 - 340 - cctgcgaaactcctggtacgg 10.8 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 385 - 396 - tgattggtcgct 9.07 TATA_box|M00252 TATA V$TATA_01| 406 - 420 + gtatatataaggatc 6.08 TBP|M00713 TBP F$TBP_Q6| 410 - 418 - atataagga 6.99 Oct-1|M00138 V$OCT1_04 Oct-1| 461 - 483 - ccttttattttacatttgccttt 8.34 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H3.2_H4.2_IR_S_cerevisiae.fasta (1 sequences, 678 bp, 42.3% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score SPT10|Spt10p| 8.36 NEG|Negative element| 3.57 E2F|M00516 E2F V$E2F_03| 3.33 IRF-7|M00453 V$IRF7_01 IRF-7| 1.97 TBP|M00713 TBP F$TBP_Q6| 1.61 HiNF-D|HiNF-D| 0.418 IRF-1|M00747 IRF1| 0.186 TATA_box|M00252 TATA V$TATA_01| 0.12 HEX|Hexamer| -0.0442 Oct-1|M00138 V$OCT1_04 Oct-1| -0.0786 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -1.08 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.33 GC_box|M00255 GC box V$GC_01| -1.76 AACCCT_box|AACCCT S. pombe| -4.42 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H3.2_H4.2_IR_S_cerevisiae SPT10|Spt10p| 34 - 54 - ggggaagaacagttggaaggg 6.71 HEX|Hexamer| 63 - 68 - gaagtc 6.63 TATA_box|M00252 TATA V$TATA_01| 83 - 97 + ctatataaaagaaca 6.22 TATA_box|M00252 TATA V$TATA_01| 85 - 99 + atataaaagaacaag 6.02 TBP|M00713 TBP F$TBP_Q6| 85 - 93 - atataaaag 7.27 Oct-1|M00138 V$OCT1_04 Oct-1| 101 - 123 + aaaagattatttatatacaactg 6.06 TBP|M00713 TBP F$TBP_Q6| 108 - 116 + tatttatat 7.85 NEG|Negative element| 212 - 226 - cacattgggcgataa 6.03 NEG|Negative element| 227 - 241 + tgaacgctaaatgac 10.7 SPT10|Spt10p| 270 - 290 + gcgtgccaatagtttcacgcg 12.9 SPT10|Spt10p| 294 - 314 - aatgcgaagtgctcggaacgg 15.3 SPT10|Spt10p| 349 - 369 + ctagaccgagagtttcgcatt 9.59 IRF-7|M00453 V$IRF7_01 IRF-7| 356 - 373 - gagagtttcgcatttgta 9.13 SPT10|Spt10p| 381 - 401 + acgttctgggagcttcgcgtc 13.7 E2F|M00516 E2F V$E2F_03| 410 - 421 + tttcgggcgcga 6.97 E2F|M00516 E2F V$E2F_03| 412 - 423 + tcgggcgcgaaa 7.08 E2F|M00516 E2F V$E2F_03| 412 - 423 - tcgggcgcgaaa 10.4 SPT10|Spt10p| 415 - 435 - ggcgcgaaatgcagaccagac 9.22 HiNF-D|HiNF-D| 488 - 503 - cgcctgggctgttgtt 6.38 TBP|M00713 TBP F$TBP_Q6| 549 - 557 - atataagta 7.13 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H3.2_H4.2_IR_S_kluyveri.fasta (1 sequences, 579 bp, 42% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score SPT10|Spt10p| 5.73 IRF-1|M00747 IRF1| 0.776 HiNF-D|HiNF-D| 0.538 TATA_box|M00252 TATA V$TATA_01| 0.432 TBP|M00713 TBP F$TBP_Q6| 0.181 HEX|Hexamer| -0.052 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.521 Oct-1|M00138 V$OCT1_04 Oct-1| -0.648 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.701 NEG|Negative element| -0.715 E2F|M00516 E2F V$E2F_03| -0.923 IRF-7|M00453 V$IRF7_01 IRF-7| -1.37 GC_box|M00255 GC box V$GC_01| -2.33 AACCCT_box|AACCCT S. pombe| -5.2 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H3.2_H4.2_IR_S_kluyveri IRF-1|M00747 IRF1| 69 - 75 - aactgaa 7.25 TATA_box|M00252 TATA V$TATA_01| 98 - 112 - tctgttcttatatac 6.43 TBP|M00713 TBP F$TBP_Q6| 102 - 110 + ttcttatat 6.83 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 206 - 217 - tcactggtccat 6.01 SPT10|Spt10p| 221 - 241 + ccgttccgaaattttcacagt 11.5 SPT10|Spt10p| 259 - 279 - gctgggaaatttatggtccgg 6.15 TATA_box|M00252 TATA V$TATA_01| 260 - 274 - ctgggaaatttatgg 6.02 SPT10|Spt10p| 322 - 342 - tgtgcgaataaactgggatga 6.26 SPT10|Spt10p| 346 - 366 + ccgttctcagtggttcgcagc 12.4 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 351 - 361 - ctcagtggttc 6.16 HiNF-D|HiNF-D| 360 - 375 - tcgcagctctatggtg 6.71 SPT10|Spt10p| 368 - 388 + ctatggtgtttttttcgcgct 6.3 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H3.2_H4.2_IR_S_kudriavzevii.fasta (1 sequences, 462 bp, 45.7% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score SPT10|Spt10p| 7.64 E2F|M00516 E2F V$E2F_03| 4.11 TBP|M00713 TBP F$TBP_Q6| 1.67 HiNF-D|HiNF-D| 1.2 TATA_box|M00252 TATA V$TATA_01| 0.885 Oct-1|M00138 V$OCT1_04 Oct-1| 0.585 NEG|Negative element| 0.514 IRF-7|M00453 V$IRF7_01 IRF-7| 0.374 HEX|Hexamer| -0.543 GC_box|M00255 GC box V$GC_01| -0.683 IRF-1|M00747 IRF1| -1.55 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.62 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -2.69 AACCCT_box|AACCCT S. pombe| -3.96 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H3.2_H4.2_IR_S_kudriavzevii GC_box|M00255 GC box V$GC_01| 112 - 125 - caactccacccgta 6.06 TATA_box|M00252 TATA V$TATA_01| 124 - 138 - tacgtgtttatatat 7.27 Oct-1|M00138 V$OCT1_04 Oct-1| 125 - 147 + acgtgtttatatatattatattt 6.8 TATA_box|M00252 TATA V$TATA_01| 126 - 140 - cgtgtttatatatat 6.29 TBP|M00713 TBP F$TBP_Q6| 128 - 136 + tgtttatat 7.52 TBP|M00713 TBP F$TBP_Q6| 130 - 138 + tttatatat 6.93 TBP|M00713 TBP F$TBP_Q6| 132 - 140 + tatatatat 6.92 HiNF-D|HiNF-D| 248 - 263 - ctgggccgcttcgcgt 7.7 E2F|M00516 E2F V$E2F_03| 263 - 274 + tttcgcgccaga 10.7 E2F|M00516 E2F V$E2F_03| 263 - 274 - tttcgcgccaga 9.22 TBP|M00713 TBP F$TBP_Q6| 276 - 284 - atatgaaga 6.06 SPT10|Spt10p| 283 - 303 - gatgcgaagcttttagaacgt 14.3 IRF-7|M00453 V$IRF7_01 IRF-7| 311 - 328 + tacaaatgcgaaacaccc 6.96 SPT10|Spt10p| 315 - 335 - aatgcgaaacacccggtccag 8.15 E2F|M00516 E2F V$E2F_03| 345 - 356 - ccaagcgccaaa 7.17 SPT10|Spt10p| 370 - 390 + acgttccgggcacttcgcatg 11.3 SPT10|Spt10p| 394 - 414 - cgggtgaagctgccggaacgc 12 NEG|Negative element| 439 - 453 - gatatctggcgtcga 7.03 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H3.2_H4.2_IR_S_mikatae.fasta (1 sequences, 678 bp, 40% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score SPT10|Spt10p| 8.9 E2F|M00516 E2F V$E2F_03| 4.15 TBP|M00713 TBP F$TBP_Q6| 1.37 IRF-7|M00453 V$IRF7_01 IRF-7| 1.22 HiNF-D|HiNF-D| 0.698 TATA_box|M00252 TATA V$TATA_01| 0.158 NEG|Negative element| -0.0235 HEX|Hexamer| -0.0682 Oct-1|M00138 V$OCT1_04 Oct-1| -0.151 IRF-1|M00747 IRF1| -0.316 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.756 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.98 GC_box|M00255 GC box V$GC_01| -2.24 AACCCT_box|AACCCT S. pombe| -5.02 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H3.2_H4.2_IR_S_mikatae TBP|M00713 TBP F$TBP_Q6| 121 - 129 + tacttatat 7.1 E2F|M00516 E2F V$E2F_03| 150 - 161 - ctgcgcgcgaca 10.1 E2F|M00516 E2F V$E2F_03| 150 - 161 + ctgcgcgcgaca 6.7 SPT10|Spt10p| 279 - 299 + gtgttccagtagcttcacgcg 12 SPT10|Spt10p| 303 - 323 - aatgcgaagtgctcggaacgg 15.9 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 358 - 369 + ctggaccaagcg 6.36 SPT10|Spt10p| 358 - 378 + ctggaccaagcgtttcgcatt 10.7 SPT10|Spt10p| 390 - 410 + acgttctgggaatttcgcatc 14.3 IRF-7|M00453 V$IRF7_01 IRF-7| 397 - 414 - gggaatttcgcatctcca 7.44 HiNF-D|HiNF-D| 410 - 425 - ctccagctctccgggc 7 E2F|M00516 E2F V$E2F_03| 420 - 431 + ccgggcgcgaaa 6.09 E2F|M00516 E2F V$E2F_03| 420 - 431 - ccgggcgcgaaa 11 NEG|Negative element| 421 - 435 + cgggcgcgaaatgta 6.55 IRF-7|M00453 V$IRF7_01 IRF-7| 425 - 442 + cgcgaaatgtaaagcgga 7.6 TBP|M00713 TBP F$TBP_Q6| 545 - 553 + tatttatat 7.37 TATA_box|M00252 TATA V$TATA_01| 563 - 577 + atatatataggagga 6.41 TBP|M00713 TBP F$TBP_Q6| 653 - 661 - atataaaca 6.56 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H3.2_H4.2_IR_S_paradoxus.fasta (1 sequences, 680 bp, 43.7% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score SPT10|Spt10p| 8.65 E2F|M00516 E2F V$E2F_03| 3.48 IRF-7|M00453 V$IRF7_01 IRF-7| 2.08 TBP|M00713 TBP F$TBP_Q6| 1.82 TATA_box|M00252 TATA V$TATA_01| 1.13 IRF-1|M00747 IRF1| 1.04 NEG|Negative element| 0.881 HiNF-D|HiNF-D| -0.000174 Oct-1|M00138 V$OCT1_04 Oct-1| -0.353 HEX|Hexamer| -0.572 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.71 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -1.98 GC_box|M00255 GC box V$GC_01| -3.28 AACCCT_box|AACCCT S. pombe| -5.88 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H3.2_H4.2_IR_S_paradoxus IRF-1|M00747 IRF1| 62 - 68 - aagtgaa 7.6 TATA_box|M00252 TATA V$TATA_01| 87 - 101 + ctatataaaaacagg 7.49 TATA_box|M00252 TATA V$TATA_01| 89 - 103 + atataaaaacaggaa 7.02 TBP|M00713 TBP F$TBP_Q6| 89 - 97 - atataaaaa 7.67 TBP|M00713 TBP F$TBP_Q6| 111 - 119 + tacttatat 7.61 TBP|M00713 TBP F$TBP_Q6| 113 - 121 + cttatatat 6.39 NEG|Negative element| 231 - 245 + tcgacgctagatgac 7.83 SPT10|Spt10p| 270 - 290 + gcgtgccaaaggtttcacgcg 9.02 SPT10|Spt10p| 294 - 314 - aatgcgaagtgttcggaacgg 14.4 E2F|M00516 E2F V$E2F_03| 328 - 339 + tttggcgccggg 9.41 SPT10|Spt10p| 349 - 369 + ttggtccgagagtttcgcatt 13.5 IRF-7|M00453 V$IRF7_01 IRF-7| 356 - 373 - gagagtttcgcatttgta 9.2 SPT10|Spt10p| 381 - 401 + acgttctgagagcttcgcatc 15.4 IRF-7|M00453 V$IRF7_01 IRF-7| 388 - 405 - gagagcttcgcatctcca 6.17 E2F|M00516 E2F V$E2F_03| 412 - 423 - ccgggcgcgaaa 10.3 Oct-1|M00138 V$OCT1_04 Oct-1| 520 - 542 + acgtgtttgtgcatatctaggta 6.19 TBP|M00713 TBP F$TBP_Q6| 547 - 555 - atatataag 6.11 TBP|M00713 TBP F$TBP_Q6| 549 - 557 - atataagta 7.32 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H3.2_H4.2_IR_S_pombe.fasta (1 sequences, 336 bp, 36.6% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score AACCCT_box|AACCCT S. pombe| 15.6 TATA_box|M00252 TATA V$TATA_01| 1.93 IRF-7|M00453 V$IRF7_01 IRF-7| 1.38 TBP|M00713 TBP F$TBP_Q6| 1.14 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.946 Oct-1|M00138 V$OCT1_04 Oct-1| 0.878 HEX|Hexamer| 0.49 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.577 IRF-1|M00747 IRF1| -0.824 NEG|Negative element| -0.889 HiNF-D|HiNF-D| -1.01 E2F|M00516 E2F V$E2F_03| -1.96 GC_box|M00255 GC box V$GC_01| -3.37 SPT10|Spt10p| -3.95 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H3.2_H4.2_IR_S_pombe Oct-1|M00138 V$OCT1_04 Oct-1| 102 - 124 - tcctatgatttgaatttcaatgg 6.87 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 118 - 129 - tcaatggcttct 7.33 TATA_box|M00252 TATA V$TATA_01| 176 - 190 - catctccatatatat 6.23 IRF-7|M00453 V$IRF7_01 IRF-7| 210 - 227 + ggggaagccgaaatcgca 7.45 IRF-7|M00453 V$IRF7_01 IRF-7| 216 - 233 + gccgaaatcgcaatctta 6.21 AACCCT_box|AACCCT S. pombe| 235 - 257 - atcagggttagggttgtgattga 22 TATA_box|M00252 TATA V$TATA_01| 258 - 272 - ctgaggtatatatag 6.97 TATA_box|M00252 TATA V$TATA_01| 263 - 277 + gtatatatagcagga 7.82 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H3_H4_S_purpuratus.fasta (1 sequences, 1015 bp, 34.3% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score CCAAT_box|M00254 V$CAAT_01 CCAAT box| 2.66 TATA_box|M00252 TATA V$TATA_01| 0.621 E2F|M00516 E2F V$E2F_03| 0.488 IRF-1|M00747 IRF1| 0.477 HEX|Hexamer| 0.402 Oct-1|M00138 V$OCT1_04 Oct-1| 0.17 HiNF-D|HiNF-D| -0.0325 TBP|M00713 TBP F$TBP_Q6| -0.213 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.229 NEG|Negative element| -0.876 IRF-7|M00453 V$IRF7_01 IRF-7| -0.905 SPT10|Spt10p| -2.77 AACCCT_box|AACCCT S. pombe| -3.61 GC_box|M00255 GC box V$GC_01| -4.25 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H3_H4_S_purpuratus ref|NW_783816.1|SpuUn_WGA29134_1:41995-43009 Strongylocentrotus purpuratus chromosome Un genomic contig, whole genome shotgun sequence TATA_box|M00252 TATA V$TATA_01| 47 - 61 - cactcgtatttatat 6.95 TBP|M00713 TBP F$TBP_Q6| 53 - 61 + tatttatat 6.45 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 78 - 89 - tgattggttagt 8.91 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 104 - 115 - tgattggccatt 9.6 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 106 - 117 + attggccattcg 8.48 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 137 - 148 - tgattgggtact 7.39 IRF-1|M00747 IRF1| 346 - 352 - aagagaa 6.67 IRF-1|M00747 IRF1| 392 - 398 - aaatgaa 6.09 IRF-1|M00747 IRF1| 493 - 499 - aaatgaa 6.09 E2F|M00516 E2F V$E2F_03| 589 - 600 + tttggcgagcaa 7.82 HEX|Hexamer| 603 - 608 + gacttc 7.03 IRF-1|M00747 IRF1| 686 - 692 + ttctctt 6.55 Oct-1|M00138 V$OCT1_04 Oct-1| 837 - 859 + gatagtttatgcaaatattgcat 7.12 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 937 - 947 + ccgcaaaggag 6.92 TATA_box|M00252 TATA V$TATA_01| 948 - 962 + ttatatatacccgcc 7.59 E2F|M00516 E2F V$E2F_03| 954 - 965 - atacccgccgaa 6.17 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H3f3a_M_musculus.fasta (1 sequences, 1000 bp, 69.9% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score CCAAT_box|M00254 V$CAAT_01 CCAAT box| 3.33 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 1.3 HiNF-D|HiNF-D| 0.775 GC_box|M00255 GC box V$GC_01| 0.687 HEX|Hexamer| 0.28 IRF-1|M00747 IRF1| 0.118 Oct-1|M00138 V$OCT1_04 Oct-1| 0.0574 NEG|Negative element| -0.159 TATA_box|M00252 TATA V$TATA_01| -0.302 IRF-7|M00453 V$IRF7_01 IRF-7| -0.414 TBP|M00713 TBP F$TBP_Q6| -0.633 E2F|M00516 E2F V$E2F_03| -0.785 AACCCT_box|AACCCT S. pombe| -2.21 SPT10|Spt10p| -3.51 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H3f3a_M_musculus mm6_dna range=chr1:180767424-180768423 NM_008210 NP_032236 - CCAAT_box|M00254 V$CAAT_01 CCAAT box| 18 - 29 + tccagccaatca 10.9 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 20 - 30 + cagccaatcac 8.57 GC_box|M00255 GC box V$GC_01| 77 - 90 - ccgcccctcccctc 6.69 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 101 - 111 - ctcgttcgctg 6.65 IRF-7|M00453 V$IRF7_01 IRF-7| 175 - 192 + tacaaacacaaaagacac 6.38 GC_box|M00255 GC box V$GC_01| 362 - 375 + ggggggaggggcat 6.94 IRF-1|M00747 IRF1| 491 - 497 - aagtgga 6.83 GC_box|M00255 GC box V$GC_01| 654 - 667 + gagaggaggggcag 6.44 IRF-7|M00453 V$IRF7_01 IRF-7| 769 - 786 - atggctgttattttgtaa 6.24 TATA_box|M00252 TATA V$TATA_01| 772 - 786 - gctgttattttgtaa 6.71 TBP|M00713 TBP F$TBP_Q6| 773 - 781 + ctgttattt 6.09 IRF-1|M00747 IRF1| 776 - 782 + ttatttt 6.36 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 853 - 863 - ctgtttggagg 6.1 HEX|Hexamer| 873 - 878 - gaaatc 7.06 HiNF-D|HiNF-D| 941 - 956 - gtttcccgctttcctt 6.25 HiNF-D|HiNF-D| 981 - 996 - ctgcatagctcaagtt 6.85 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H3f3b_M_musculus.fasta (1 sequences, 1000 bp, 41.5% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 4.1 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 3.21 GC_box|M00255 GC box V$GC_01| 2.51 Oct-1|M00138 V$OCT1_04 Oct-1| 1.17 TATA_box|M00252 TATA V$TATA_01| 1.16 NEG|Negative element| 0.85 TBP|M00713 TBP F$TBP_Q6| 0.471 IRF-1|M00747 IRF1| 0.239 E2F|M00516 E2F V$E2F_03| 0.011 HiNF-D|HiNF-D| -0.0732 HEX|Hexamer| -0.181 IRF-7|M00453 V$IRF7_01 IRF-7| -1.64 AACCCT_box|AACCCT S. pombe| -3.79 SPT10|Spt10p| -3.94 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H3f3b_M_musculus mm6_dna range=chr11:115845597-115846596 NM_008211 NP_032237 - TATA_box|M00252 TATA V$TATA_01| 16 - 30 - cctccatatttatag 8.48 TBP|M00713 TBP F$TBP_Q6| 22 - 30 + tatttatag 6.65 Oct-1|M00138 V$OCT1_04 Oct-1| 62 - 84 - aaccctgatttgcatacaccaac 7.53 E2F|M00516 E2F V$E2F_03| 95 - 106 + attggcgggagc 7.47 HiNF-D|HiNF-D| 98 - 113 - ggcgggagctttcgcc 6.59 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 162 - 172 - ctgattggccg 9.1 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 163 - 174 - tgattggccggt 10.2 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 177 - 188 + tcaggccactga 6.53 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 185 - 195 - ctgattggctg 11.6 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 186 - 197 - tgattggctgtt 9.5 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 210 - 221 - ggattggctgga 7.44 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 268 - 278 - ctgattggata 8.08 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 269 - 280 - tgattggataaa 7.81 IRF-1|M00747 IRF1| 301 - 307 + ttctctt 7.1 Oct-1|M00138 V$OCT1_04 Oct-1| 328 - 350 + gaaagtcaatgcaaatgaattgc 7.66 IRF-1|M00747 IRF1| 340 - 346 - aaatgaa 6.31 Oct-1|M00138 V$OCT1_04 Oct-1| 423 - 445 - agagagattttgcgtaaatataa 6.29 NEG|Negative element| 426 - 440 - gagattttgcgtaaa 8.09 GC_box|M00255 GC box V$GC_01| 680 - 693 + gttgggtggtgctg 7.38 GC_box|M00255 GC box V$GC_01| 769 - 782 + agggggtggggggt 10 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 784 - 795 + ccaggccaagca 7.72 GC_box|M00255 GC box V$GC_01| 794 - 807 - cagacctacctaca 6.48 TATA_box|M00252 TATA V$TATA_01| 812 - 826 - tcttgtcttttataa 6.16 TBP|M00713 TBP F$TBP_Q6| 961 - 969 - atataaaac 6.43 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H4.1_D_simulans.fasta (1 sequences, 259 bp, 39.8% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score TATA_box|M00252 TATA V$TATA_01| 3.09 TBP|M00713 TBP F$TBP_Q6| 1.49 IRF-1|M00747 IRF1| 0.604 NEG|Negative element| 0.37 HEX|Hexamer| -0.485 HiNF-D|HiNF-D| -0.558 SPT10|Spt10p| -1.19 IRF-7|M00453 V$IRF7_01 IRF-7| -1.44 Oct-1|M00138 V$OCT1_04 Oct-1| -1.57 E2F|M00516 E2F V$E2F_03| -2.14 GC_box|M00255 GC box V$GC_01| -2.38 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.42 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -4 AACCCT_box|AACCCT S. pombe| -7.26 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H4.1_D_simulans droSim1_dna range=chrU:13274632-13274890 CG31613-RA U.D_simulans.copy1 >droSim1_dna range=chrU:13274632-13274890 CG31613-RA U.D_simulans.copy1 NEG|Negative element| 52 - 66 + taaacgatcagagca 6.12 TATA_box|M00252 TATA V$TATA_01| 72 - 86 - tacctacttatatag 6.49 TBP|M00713 TBP F$TBP_Q6| 76 - 84 + tacttatat 7.06 IRF-1|M00747 IRF1| 129 - 135 + ttcattt 6.39 TBP|M00713 TBP F$TBP_Q6| 196 - 204 - ctataaata 6.53 TATA_box|M00252 TATA V$TATA_01| 196 - 210 + ctataaataggggca 9.2 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H4.1_D_virilis.fasta (1 sequences, 303 bp, 37% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-1|M00747 IRF1| 1.7 HiNF-D|HiNF-D| 1.51 TATA_box|M00252 TATA V$TATA_01| 1.3 TBP|M00713 TBP F$TBP_Q6| 0.909 IRF-7|M00453 V$IRF7_01 IRF-7| -0.27 HEX|Hexamer| -0.661 NEG|Negative element| -1.14 Oct-1|M00138 V$OCT1_04 Oct-1| -1.21 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.49 AACCCT_box|AACCCT S. pombe| -1.83 GC_box|M00255 GC box V$GC_01| -2.03 E2F|M00516 E2F V$E2F_03| -3.71 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -4.12 SPT10|Spt10p| -4.26 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H4.1_D_virilis droVir1_dna range=scaffold_2413:850-1152 CG31613-RA CG31611-RA >droVir1_dna range=scaffold_2413:850-1152 CG31613-RA CG31611-RA TATA_box|M00252 TATA V$TATA_01| 69 - 83 - gtatcgcttatatag 7.03 TBP|M00713 TBP F$TBP_Q6| 73 - 81 + cgcttatat 6.36 HiNF-D|HiNF-D| 124 - 139 - gttcgtcgctttgccg 7.66 TATA_box|M00252 TATA V$TATA_01| 212 - 226 + gtataaatataagcg 6.6 TBP|M00713 TBP F$TBP_Q6| 218 - 226 - atataagcg 6.02 IRF-1|M00747 IRF1| 273 - 279 - aagtgaa 7.3 IRF-1|M00747 IRF1| 294 - 300 - aagtgaa 7.3 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H4.1_D_yakuba.fasta (1 sequences, 291 bp, 39.5% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score TATA_box|M00252 TATA V$TATA_01| 1.94 NEG|Negative element| 1.45 TBP|M00713 TBP F$TBP_Q6| 1.25 IRF-1|M00747 IRF1| 0.94 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 0.76 HiNF-D|HiNF-D| 0.118 HEX|Hexamer| -0.487 IRF-7|M00453 V$IRF7_01 IRF-7| -0.671 Oct-1|M00138 V$OCT1_04 Oct-1| -1.43 SPT10|Spt10p| -2.21 E2F|M00516 E2F V$E2F_03| -2.43 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -4.04 GC_box|M00255 GC box V$GC_01| -6.58 AACCCT_box|AACCCT S. pombe| -7.31 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H4.1_D_yakuba droYak1_dna range=chr2R:1272947-1273237 CG31613-RA CG31611-RA >droYak1_dna range=chr2R:1272947-1273237 CG31613-RA CG31611-RA >droYak1_dna range=chrU:44961988-44962278 CG31611-RA CG31613-RA TATA_box|M00252 TATA V$TATA_01| 78 - 92 - tacctacttatatag 6.64 TBP|M00713 TBP F$TBP_Q6| 82 - 90 + tacttatat 7.29 IRF-1|M00747 IRF1| 111 - 117 - aagagaa 6.14 IRF-1|M00747 IRF1| 117 - 123 - aagagaa 6.14 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 135 - 145 - ctcattgacga 7.04 NEG|Negative element| 184 - 198 - ggtttttggcgtttt 7.15 NEG|Negative element| 191 - 205 - ggcgttttacgtata 6.01 TATA_box|M00252 TATA V$TATA_01| 201 - 215 + gtataaatagaggca 7.93 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H4.1_H3.1_IR_A_gossypii.fasta (1 sequences, 461 bp, 57.3% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score TATA_box|M00252 TATA V$TATA_01| 3.51 SPT10|Spt10p| 2.55 E2F|M00516 E2F V$E2F_03| 1.92 TBP|M00713 TBP F$TBP_Q6| 1.43 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 0.158 HiNF-D|HiNF-D| -0.289 HEX|Hexamer| -0.299 Oct-1|M00138 V$OCT1_04 Oct-1| -0.531 IRF-1|M00747 IRF1| -0.693 NEG|Negative element| -0.74 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -1.98 GC_box|M00255 GC box V$GC_01| -2.28 IRF-7|M00453 V$IRF7_01 IRF-7| -2.59 AACCCT_box|AACCCT S. pombe| -5.4 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H4.1_H3.1_IR_A_gossypii TBP|M00713 TBP F$TBP_Q6| 54 - 62 - ctttaaata 7 TATA_box|M00252 TATA V$TATA_01| 54 - 68 + ctttaaatatgctcc 6.53 E2F|M00516 E2F V$E2F_03| 178 - 189 + tggcgcgcgaaa 6.53 E2F|M00516 E2F V$E2F_03| 178 - 189 - tggcgcgcgaaa 8.54 SPT10|Spt10p| 202 - 222 + tcataccagtttcttcgcgca 7.2 SPT10|Spt10p| 252 - 272 + gcgtgctgtgcgtttctcaat 9.17 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 267 - 277 - ctcaatgcctg 6.75 TBP|M00713 TBP F$TBP_Q6| 368 - 376 + tgtgtatat 6.03 TATA_box|M00252 TATA V$TATA_01| 371 - 385 + gtatataaggcggcg 10.3 TBP|M00713 TBP F$TBP_Q6| 373 - 381 - atataaggc 7.25 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H4.1_H3.1_IR_A_nidulans.fasta (1 sequences, 1135 bp, 51.5% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score AACCCT_box|AACCCT S. pombe| 3.7 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 2.32 GC_box|M00255 GC box V$GC_01| 2.2 SPT10|Spt10p| 1.96 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1.47 E2F|M00516 E2F V$E2F_03| 0.627 NEG|Negative element| 0.458 HEX|Hexamer| 0.0755 HiNF-D|HiNF-D| -6.45e-05 IRF-1|M00747 IRF1| -0.508 Oct-1|M00138 V$OCT1_04 Oct-1| -0.75 TBP|M00713 TBP F$TBP_Q6| -0.813 IRF-7|M00453 V$IRF7_01 IRF-7| -1.38 TATA_box|M00252 TATA V$TATA_01| -1.73 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H4.1_H3.1_IR_A_nidulans NEG|Negative element| 72 - 86 - gagatttaaggttaa 7 AACCCT_box|AACCCT S. pombe| 76 - 98 - tttaaggttaaagttgtgaggtg 6.16 NEG|Negative element| 103 - 117 - taaattaaacgtcaa 6.77 SPT10|Spt10p| 124 - 144 - ggcgagagatgttgagaatgg 9.66 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 235 - 246 + atcgaccaatca 9.02 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 237 - 247 + cgaccaatcag 6.98 GC_box|M00255 GC box V$GC_01| 246 - 259 + agagggcggggcat 9.64 AACCCT_box|AACCCT S. pombe| 437 - 459 - ttcagggatggggttgggatcag 11.4 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 500 - 510 - cttattggctg 9.98 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 501 - 512 - ttattggctgcc 7.06 E2F|M00516 E2F V$E2F_03| 508 - 519 - ctgcccgggaaa 7.62 E2F|M00516 E2F V$E2F_03| 588 - 599 - tgggccgcgaaa 7.07 GC_box|M00255 GC box V$GC_01| 693 - 706 - accacccgcctctc 6.35 GC_box|M00255 GC box V$GC_01| 727 - 740 - cccacccgccccct 8.23 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H4.1_H3.1_IR_C_albicans.fasta (1 sequences, 970 bp, 33.4% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score SPT10|Spt10p| 4.64 E2F|M00516 E2F V$E2F_03| 3.22 AACCCT_box|AACCCT S. pombe| 0.775 GC_box|M00255 GC box V$GC_01| 0.52 HiNF-D|HiNF-D| 0.43 IRF-1|M00747 IRF1| 0.00612 NEG|Negative element| -0.0586 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.184 Oct-1|M00138 V$OCT1_04 Oct-1| -0.267 TBP|M00713 TBP F$TBP_Q6| -0.293 HEX|Hexamer| -0.543 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.36 IRF-7|M00453 V$IRF7_01 IRF-7| -1.73 TATA_box|M00252 TATA V$TATA_01| -1.81 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H4.1_H3.1_IR_C_albicans HiNF-D|HiNF-D| 205 - 220 - ctccttctctctcgtt 7.04 E2F|M00516 E2F V$E2F_03| 222 - 233 + tttcgcgcgttg 10.1 GC_box|M00255 GC box V$GC_01| 261 - 274 + tgagggtgtgtgtg 7.79 E2F|M00516 E2F V$E2F_03| 300 - 311 + atgcgcgcccaa 8.04 E2F|M00516 E2F V$E2F_03| 300 - 311 - atgcgcgcccaa 9.77 HiNF-D|HiNF-D| 352 - 367 - ctctctctctctccgt 6.27 Oct-1|M00138 V$OCT1_04 Oct-1| 400 - 422 - acaagtaatttgcagattactct 6.16 GC_box|M00255 GC box V$GC_01| 438 - 451 - cacacacaccccaa 6.64 E2F|M00516 E2F V$E2F_03| 613 - 624 + tttcgcggactc 6.99 NEG|Negative element| 628 - 642 + tttacgctcaccaca 6.63 SPT10|Spt10p| 680 - 700 + tcgtgctcttattttcgcgca 12.2 E2F|M00516 E2F V$E2F_03| 692 - 703 + tttcgcgcactc 7.8 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 769 - 780 + ccaaaccaaaca 7.01 AACCCT_box|AACCCT S. pombe| 788 - 810 - atcacggtttggatagtcattcc 8.29 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H4.1_H3.1_IR_K_waltii.fasta (1 sequences, 611 bp, 41.9% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score SPT10|Spt10p| 2.79 TATA_box|M00252 TATA V$TATA_01| 1.54 TBP|M00713 TBP F$TBP_Q6| 1.54 E2F|M00516 E2F V$E2F_03| 1.1 GC_box|M00255 GC box V$GC_01| 0.553 HiNF-D|HiNF-D| 0.229 IRF-1|M00747 IRF1| -0.242 NEG|Negative element| -0.301 Oct-1|M00138 V$OCT1_04 Oct-1| -0.547 HEX|Hexamer| -0.66 IRF-7|M00453 V$IRF7_01 IRF-7| -0.882 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.91 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -2.73 AACCCT_box|AACCCT S. pombe| -4.22 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H4.1_H3.1_IR_K_waltii TATA_box|M00252 TATA V$TATA_01| 87 - 101 - tgccggtctttatat 7.2 TBP|M00713 TBP F$TBP_Q6| 93 - 101 + tctttatat 7.5 GC_box|M00255 GC box V$GC_01| 132 - 145 - gcgccccgcccggc 7.59 E2F|M00516 E2F V$E2F_03| 217 - 228 - acacgcgcgaag 7.05 SPT10|Spt10p| 323 - 343 - agtataaaatgatgagaagaa 6.02 TATA_box|M00252 TATA V$TATA_01| 324 - 338 + gtataaaatgatgag 6.78 SPT10|Spt10p| 333 - 353 - gatgagaagaaactggaccgg 9.67 SPT10|Spt10p| 362 - 382 + gcagaccaaaatcttcgcata 7.68 E2F|M00516 E2F V$E2F_03| 402 - 413 - gctagcgcgaac 7.08 TATA_box|M00252 TATA V$TATA_01| 523 - 537 + ctatataaagaggaa 7.87 TBP|M00713 TBP F$TBP_Q6| 525 - 533 - atataaaga 7.95 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H4.1_H3.1_IR_M_grisea.fasta (1 sequences, 1481 bp, 49% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.974 GC_box|M00255 GC box V$GC_01| 0.776 E2F|M00516 E2F V$E2F_03| 0.421 IRF-7|M00453 V$IRF7_01 IRF-7| 0.308 HEX|Hexamer| 0.166 IRF-1|M00747 IRF1| 0.051 HiNF-D|HiNF-D| -0.186 Oct-1|M00138 V$OCT1_04 Oct-1| -0.192 NEG|Negative element| -0.421 TBP|M00713 TBP F$TBP_Q6| -0.516 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.961 SPT10|Spt10p| -1.89 TATA_box|M00252 TATA V$TATA_01| -2.1 AACCCT_box|AACCCT S. pombe| -3.53 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H4.1_H3.1_IR_M_grisea GC_box|M00255 GC box V$GC_01| 227 - 240 + gtggggcggtgtgt 6.65 E2F|M00516 E2F V$E2F_03| 397 - 408 + cttggcgcaaaa 7.45 E2F|M00516 E2F V$E2F_03| 397 - 408 - cttggcgcaaaa 7.08 GC_box|M00255 GC box V$GC_01| 406 - 419 - aaaacccgcctcat 8.29 TBP|M00713 TBP F$TBP_Q6| 489 - 497 + tccttattt 6.35 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 513 - 524 - tgattggacagt 8.38 IRF-7|M00453 V$IRF7_01 IRF-7| 994 - 1011 - ccaggtctcggtttcctt 7.67 IRF-7|M00453 V$IRF7_01 IRF-7| 1000 - 1017 - ctcggtttcctttcctca 7.03 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1082 - 1093 + taggaccaatca 7.88 GC_box|M00255 GC box V$GC_01| 1244 - 1257 + tttaggtggggcgg 6.8 HEX|Hexamer| 1333 - 1338 + gacttc 6.79 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1380 - 1391 + accaaccaaaaa 6.13 Oct-1|M00138 V$OCT1_04 Oct-1| 1387 - 1409 - aaaaaacatatacattcatccta 6.72 NEG|Negative element| 1431 - 1445 - catcttgagccttca 6.23 IRF-1|M00747 IRF1| 1442 - 1448 + ttcattt 7.3 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H4.1_H3.1_IR_S_bayanus.fasta (1 sequences, 657 bp, 42.2% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score SPT10|Spt10p| 9.65 E2F|M00516 E2F V$E2F_03| 1.99 TBP|M00713 TBP F$TBP_Q6| 1.84 TATA_box|M00252 TATA V$TATA_01| 1.6 HiNF-D|HiNF-D| 1.04 NEG|Negative element| 0.976 IRF-7|M00453 V$IRF7_01 IRF-7| 0.569 IRF-1|M00747 IRF1| 0.497 GC_box|M00255 GC box V$GC_01| -0.224 Oct-1|M00138 V$OCT1_04 Oct-1| -0.359 HEX|Hexamer| -0.65 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -2.19 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.4 AACCCT_box|AACCCT S. pombe| -5.59 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H4.1_H3.1_IR_S_bayanus IRF-1|M00747 IRF1| 67 - 73 - aagagaa 7.25 TATA_box|M00252 TATA V$TATA_01| 103 - 117 - cgcctgtatttataa 7.35 HiNF-D|HiNF-D| 179 - 194 + gcggagaacgggggtg 6.55 E2F|M00516 E2F V$E2F_03| 210 - 221 + attcgcgggcgt 6.78 E2F|M00516 E2F V$E2F_03| 246 - 257 - tttcccgccaac 8.59 E2F|M00516 E2F V$E2F_03| 246 - 257 + tttcccgccaac 7.9 GC_box|M00255 GC box V$GC_01| 262 - 275 + atggggcgaagcgg 6.49 SPT10|Spt10p| 264 - 284 - ggggcgaagcggctggaacag 15.2 SPT10|Spt10p| 299 - 319 - gatgcgaatttctcagaacgc 16.2 SPT10|Spt10p| 362 - 382 + tcgtgctcacaacttcgcatt 14 IRF-7|M00453 V$IRF7_01 IRF-7| 369 - 386 - cacaacttcgcattgccc 7.29 SPT10|Spt10p| 396 - 416 + ccgttctcgcaacttcgcaca 15.2 IRF-7|M00453 V$IRF7_01 IRF-7| 428 - 445 - agcacctttggattcctg 6.14 NEG|Negative element| 464 - 478 - gacttttagcgtggc 7.96 HiNF-D|HiNF-D| 483 - 498 + aacgaaaacgcccgag 7.57 TATA_box|M00252 TATA V$TATA_01| 540 - 554 + ccatataaaagagag 6.03 TATA_box|M00252 TATA V$TATA_01| 542 - 556 + atataaaagagagtg 7.83 TBP|M00713 TBP F$TBP_Q6| 542 - 550 - atataaaag 7.8 TBP|M00713 TBP F$TBP_Q6| 614 - 622 - atatataag 6.26 TBP|M00713 TBP F$TBP_Q6| 616 - 624 - atataagaa 7.46 TATA_box|M00252 TATA V$TATA_01| 640 - 654 + atatataaacacaag 6.72 TBP|M00713 TBP F$TBP_Q6| 640 - 648 - atatataaa 6.31 TBP|M00713 TBP F$TBP_Q6| 642 - 650 - atataaaca 6.91 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H4.1_H3.1_IR_S_castellii.fasta (1 sequences, 516 bp, 40.3% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score SPT10|Spt10p| 4.21 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 2.29 Oct-1|M00138 V$OCT1_04 Oct-1| 1.56 IRF-7|M00453 V$IRF7_01 IRF-7| 1.53 HiNF-D|HiNF-D| 1.24 TBP|M00713 TBP F$TBP_Q6| 1.1 E2F|M00516 E2F V$E2F_03| 0.872 IRF-1|M00747 IRF1| 0.457 HEX|Hexamer| -0.083 TATA_box|M00252 TATA V$TATA_01| -0.183 NEG|Negative element| -0.473 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.07 GC_box|M00255 GC box V$GC_01| -2.03 AACCCT_box|AACCCT S. pombe| -5.67 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H4.1_H3.1_IR_S_castellii IRF-1|M00747 IRF1| 54 - 60 - aacagaa 6.02 IRF-1|M00747 IRF1| 60 - 66 - aaatgaa 6.26 TBP|M00713 TBP F$TBP_Q6| 99 - 107 - atataagaa 6.8 IRF-7|M00453 V$IRF7_01 IRF-7| 172 - 189 + acgaaaagggaaacaggc 6.61 E2F|M00516 E2F V$E2F_03| 184 - 195 - acaggcgcgaaa 7.65 SPT10|Spt10p| 187 - 207 - ggcgcgaaaaaaggggcacgt 9.1 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 205 - 216 - cgtttggccata 7.09 IRF-7|M00453 V$IRF7_01 IRF-7| 215 - 232 + tactaaagcgaatctgcc 8.01 SPT10|Spt10p| 219 - 239 - aaagcgaatctgccagcacgg 8.78 SPT10|Spt10p| 262 - 282 + ccgttccagaattttcggtct 6.77 HiNF-D|HiNF-D| 275 - 290 - ttcggtctctgtgggt 7.83 SPT10|Spt10p| 320 - 340 - cctgcgaaactcctggtacgg 10.8 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 385 - 396 - tgattggtcgct 9.07 TATA_box|M00252 TATA V$TATA_01| 406 - 420 + gtatatataaggatc 6.08 TBP|M00713 TBP F$TBP_Q6| 410 - 418 - atataagga 6.99 Oct-1|M00138 V$OCT1_04 Oct-1| 461 - 483 - ccttttattttacatttgccttt 8.34 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H4.1_H3.1_IR_S_cerevisiae.fasta (1 sequences, 648 bp, 37.3% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score SPT10|Spt10p| 11.1 NEG|Negative element| 2.99 GC_box|M00255 GC box V$GC_01| 2.4 TATA_box|M00252 TATA V$TATA_01| 1.7 E2F|M00516 E2F V$E2F_03| 1.55 TBP|M00713 TBP F$TBP_Q6| 1.4 HiNF-D|HiNF-D| 1.36 IRF-7|M00453 V$IRF7_01 IRF-7| 0.369 Oct-1|M00138 V$OCT1_04 Oct-1| -0.285 IRF-1|M00747 IRF1| -0.321 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.511 HEX|Hexamer| -0.635 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.835 AACCCT_box|AACCCT S. pombe| -3.8 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H4.1_H3.1_IR_S_cerevisiae TATA_box|M00252 TATA V$TATA_01| 96 - 110 - tctcggtatttatag 8.43 TBP|M00713 TBP F$TBP_Q6| 102 - 110 + tatttatag 6.12 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 160 - 171 + tttacccaatga 6.57 GC_box|M00255 GC box V$GC_01| 172 - 185 + atggggaagggggg 9.33 HiNF-D|HiNF-D| 173 - 188 + tggggaagggggggtg 7.59 GC_box|M00255 GC box V$GC_01| 173 - 186 + tggggaaggggggg 7.64 E2F|M00516 E2F V$E2F_03| 204 - 215 + attcgcgggcat 7.46 SPT10|Spt10p| 258 - 278 - ggggagaagcgctcggaacag 17.7 HiNF-D|HiNF-D| 259 - 274 + gggagaagcgctcgga 7.01 SPT10|Spt10p| 293 - 313 - gatgcgaagttttcagaacgc 17.2 IRF-7|M00453 V$IRF7_01 IRF-7| 312 - 329 - gcggtttccaaattcggc 6 E2F|M00516 E2F V$E2F_03| 324 - 335 + ttcggcggggag 8.22 SPT10|Spt10p| 357 - 377 + tcgttctcacattttcgcatt 14.4 IRF-7|M00453 V$IRF7_01 IRF-7| 364 - 381 - cacattttcgcattgtcc 6.57 SPT10|Spt10p| 391 - 411 + tcgttctcacaatttctcaca 15.1 NEG|Negative element| 459 - 473 - gacttttagcgtgga 10.1 HiNF-D|HiNF-D| 479 - 494 + acgaaatgcccgggcg 6.25 TATA_box|M00252 TATA V$TATA_01| 539 - 553 + atataaaagactgtg 6.98 TBP|M00713 TBP F$TBP_Q6| 539 - 547 - atataaaag 7.42 TBP|M00713 TBP F$TBP_Q6| 584 - 592 + cttttatat 6.6 TATA_box|M00252 TATA V$TATA_01| 631 - 645 + atatataaacgcaaa 6.17 TBP|M00713 TBP F$TBP_Q6| 633 - 641 - atataaacg 6.65 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H4.1_H3.1_IR_S_kluyveri.fasta (1 sequences, 676 bp, 54.6% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score SPT10|Spt10p| 4.79 TATA_box|M00252 TATA V$TATA_01| 2.03 TBP|M00713 TBP F$TBP_Q6| 2 IRF-1|M00747 IRF1| 1.9 IRF-7|M00453 V$IRF7_01 IRF-7| 1.31 HiNF-D|HiNF-D| 0.565 E2F|M00516 E2F V$E2F_03| 0.335 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 0.237 Oct-1|M00138 V$OCT1_04 Oct-1| -0.237 NEG|Negative element| -0.506 HEX|Hexamer| -0.507 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.711 GC_box|M00255 GC box V$GC_01| -1.04 AACCCT_box|AACCCT S. pombe| -6.47 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H4.1_H3.1_IR_S_kluyveri IRF-1|M00747 IRF1| 50 - 56 - aagagaa 8.29 TBP|M00713 TBP F$TBP_Q6| 55 - 63 - aaataagaa 7.94 IRF-1|M00747 IRF1| 78 - 84 - aaaagaa 7.68 SPT10|Spt10p| 80 - 100 - aagaagaaaaaacgagagcaa 7.64 IRF-7|M00453 V$IRF7_01 IRF-7| 125 - 142 + aaggaaggcgaaaaagag 8.39 TATA_box|M00252 TATA V$TATA_01| 141 - 155 - agctttcttatatac 7.86 TBP|M00713 TBP F$TBP_Q6| 145 - 153 + ttcttatat 8.34 TBP|M00713 TBP F$TBP_Q6| 150 - 158 - atatacagg 6.42 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 165 - 176 + ggtggccaaaga 6.44 SPT10|Spt10p| 202 - 222 + gcgttcctgttttttctcgcg 7.86 E2F|M00516 E2F V$E2F_03| 214 - 225 + tttctcgcgcag 6.12 SPT10|Spt10p| 236 - 256 - catgcgaagaaactggtccgg 6.21 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 278 - 288 + acggcaatgag 7.35 SPT10|Spt10p| 406 - 426 + ccgtgcccgcagcttcgcacc 11.9 TATA_box|M00252 TATA V$TATA_01| 567 - 581 - cccggctatataaac 7.94 TBP|M00713 TBP F$TBP_Q6| 572 - 580 - ctatataaa 7.12 TATA_box|M00252 TATA V$TATA_01| 572 - 586 + ctatataaactcgtc 8.32 IRF-1|M00747 IRF1| 620 - 626 + ttctctt 6.83 IRF-1|M00747 IRF1| 626 - 632 + ttctctt 6.83 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H4.1_H3.1_IR_S_kudriavzevii.fasta (1 sequences, 652 bp, 39.4% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score SPT10|Spt10p| 10.5 TATA_box|M00252 TATA V$TATA_01| 1.66 TBP|M00713 TBP F$TBP_Q6| 1.09 IRF-7|M00453 V$IRF7_01 IRF-7| 1.07 NEG|Negative element| 1.03 IRF-1|M00747 IRF1| 1.03 HiNF-D|HiNF-D| 0.363 HEX|Hexamer| -0.449 Oct-1|M00138 V$OCT1_04 Oct-1| -0.532 AACCCT_box|AACCCT S. pombe| -0.858 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.51 E2F|M00516 E2F V$E2F_03| -1.77 GC_box|M00255 GC box V$GC_01| -2.43 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -2.74 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H4.1_H3.1_IR_S_kudriavzevii TATA_box|M00252 TATA V$TATA_01| 46 - 60 + gtataaataacggtt 7.26 IRF-1|M00747 IRF1| 63 - 69 - aagtgaa 7.84 TATA_box|M00252 TATA V$TATA_01| 103 - 117 - ccgccgtatttataa 8.38 SPT10|Spt10p| 264 - 284 - tgggcgaagcgctcggaacag 16.9 HiNF-D|HiNF-D| 265 - 280 + gggcgaagcgctcgga 6.46 SPT10|Spt10p| 299 - 319 - gatgcgaatttttcagaacgc 15.3 AACCCT_box|AACCCT S. pombe| 315 - 337 - aacgcggttaccgattcggtgga 6.28 SPT10|Spt10p| 360 - 380 + gcgttctcacaacttcgcaat 14.6 SPT10|Spt10p| 394 - 414 + tcgttcccacaatttcgcact 16.7 SPT10|Spt10p| 439 - 459 + tcctggccgtaatatctcccc 6.1 NEG|Negative element| 462 - 476 - gacttttagcgtggg 8.02 TBP|M00713 TBP F$TBP_Q6| 542 - 550 - atataagag 7.05 IRF-7|M00453 V$IRF7_01 IRF-7| 563 - 580 + tcggaatacaaaatttcc 7.82 TBP|M00713 TBP F$TBP_Q6| 637 - 645 - atataaaca 6.65 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H4.1_H3.1_IR_S_mikatae.fasta (1 sequences, 652 bp, 39.1% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score SPT10|Spt10p| 10.2 NEG|Negative element| 2.88 HiNF-D|HiNF-D| 1.97 E2F|M00516 E2F V$E2F_03| 1.81 TBP|M00713 TBP F$TBP_Q6| 1.07 TATA_box|M00252 TATA V$TATA_01| 1.03 IRF-1|M00747 IRF1| 0.926 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.667 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.456 Oct-1|M00138 V$OCT1_04 Oct-1| -0.61 HEX|Hexamer| -0.668 IRF-7|M00453 V$IRF7_01 IRF-7| -1.12 GC_box|M00255 GC box V$GC_01| -1.34 AACCCT_box|AACCCT S. pombe| -5.44 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H4.1_H3.1_IR_S_mikatae Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 67 - 77 + aagacaacgag 6.02 TATA_box|M00252 TATA V$TATA_01| 102 - 116 - tgtccgtatttataa 6.14 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 122 - 133 - ggattggctaat 7.66 HiNF-D|HiNF-D| 179 - 194 + acggagaacgggggtg 8.98 E2F|M00516 E2F V$E2F_03| 211 - 222 + attcgcgccatt 6.97 IRF-1|M00747 IRF1| 239 - 245 + ttcagtt 6.82 SPT10|Spt10p| 264 - 284 - ggggtgaagcgctcggaacag 16.5 SPT10|Spt10p| 299 - 319 - gatgcgaatttttcagaacgc 15.4 E2F|M00516 E2F V$E2F_03| 330 - 341 + ttcggcgggcag 8.75 SPT10|Spt10p| 360 - 380 + ccgttctcataacttcgcact 16.2 SPT10|Spt10p| 394 - 414 + tcgttcccacaatttctcact 14.8 NEG|Negative element| 462 - 476 - gacttttagcgtgga 10 TATA_box|M00252 TATA V$TATA_01| 540 - 554 + atatataagagacgg 7.69 TBP|M00713 TBP F$TBP_Q6| 542 - 550 - atataagag 7.25 TATA_box|M00252 TATA V$TATA_01| 542 - 556 + atataagagacggtg 6.09 IRF-1|M00747 IRF1| 594 - 600 + ttcactt 7.34 TBP|M00713 TBP F$TBP_Q6| 612 - 620 - ctataaaga 6.77 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H4.1_H3.1_IR_S_paradoxus.fasta (1 sequences, 649 bp, 38.8% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score SPT10|Spt10p| 10.2 NEG|Negative element| 1.36 E2F|M00516 E2F V$E2F_03| 1.26 TBP|M00713 TBP F$TBP_Q6| 1.08 IRF-7|M00453 V$IRF7_01 IRF-7| 1.05 TATA_box|M00252 TATA V$TATA_01| 1 HiNF-D|HiNF-D| 0.745 HEX|Hexamer| -0.186 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.411 IRF-1|M00747 IRF1| -0.545 Oct-1|M00138 V$OCT1_04 Oct-1| -0.592 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.765 GC_box|M00255 GC box V$GC_01| -0.978 AACCCT_box|AACCCT S. pombe| -5.73 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H4.1_H3.1_IR_S_paradoxus IRF-7|M00453 V$IRF7_01 IRF-7| 53 - 70 + tagaaatatgaaagaagg 7.41 TATA_box|M00252 TATA V$TATA_01| 99 - 113 - cgtctgtatttataa 6.4 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 164 - 175 + tttacccaatga 6.59 E2F|M00516 E2F V$E2F_03| 206 - 217 + attcgcgggcat 7.35 SPT10|Spt10p| 260 - 280 - ggggagaagcgctcggaacag 17 HiNF-D|HiNF-D| 261 - 276 + gggagaagcgctcgga 6.48 SPT10|Spt10p| 295 - 315 - gatgcgaatttttcagaacgc 15.4 HiNF-D|HiNF-D| 320 - 335 + accgaattcggcgggg 6.66 E2F|M00516 E2F V$E2F_03| 326 - 337 + ttcggcgggggg 7.89 SPT10|Spt10p| 357 - 377 + tcattctcacaatttcgcatt 13.3 IRF-7|M00453 V$IRF7_01 IRF-7| 364 - 381 - cacaatttcgcattgtcc 7.08 SPT10|Spt10p| 391 - 411 + tcgttcccacaatttctcaca 15.4 NEG|Negative element| 459 - 473 - gacttttagcgtggg 8.44 TATA_box|M00252 TATA V$TATA_01| 538 - 552 + atatataaaagaccg 6.54 TBP|M00713 TBP F$TBP_Q6| 540 - 548 - atataaaag 7.3 TATA_box|M00252 TATA V$TATA_01| 540 - 554 + atataaaagaccgta 7.06 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: H4.1_H3.1_IR_S_pombe.fasta (1 sequences, 432 bp, 32.4% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score AACCCT_box|AACCCT S. pombe| 18.4 HiNF-D|HiNF-D| 0.621 Oct-1|M00138 V$OCT1_04 Oct-1| 0.607 TBP|M00713 TBP F$TBP_Q6| 0.163 NEG|Negative element| -0.171 HEX|Hexamer| -0.333 IRF-1|M00747 IRF1| -0.516 TATA_box|M00252 TATA V$TATA_01| -0.991 IRF-7|M00453 V$IRF7_01 IRF-7| -1.09 E2F|M00516 E2F V$E2F_03| -1.27 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.57 GC_box|M00255 GC box V$GC_01| -1.99 SPT10|Spt10p| -2.69 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -2.75 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >H4.1_H3.1_IR_S_pombe HiNF-D|HiNF-D| 220 - 235 - gggcgacgctgtctat 6.2 AACCCT_box|AACCCT S. pombe| 248 - 270 + tgcatcaaaaccctaaccctgct 25.1 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST1H2AA_HIST1H2BA_H_sapiens.fasta (1 sequences, 348 bp, 47.4% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 4.33 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 3.46 TATA_box|M00252 TATA V$TATA_01| 3.42 TBP|M00713 TBP F$TBP_Q6| 1.74 Oct-1|M00138 V$OCT1_04 Oct-1| 1.58 IRF-1|M00747 IRF1| 0.92 HEX|Hexamer| -0.0902 IRF-7|M00453 V$IRF7_01 IRF-7| -0.204 GC_box|M00255 GC box V$GC_01| -0.688 HiNF-D|HiNF-D| -0.873 NEG|Negative element| -1.48 SPT10|Spt10p| -1.73 E2F|M00516 E2F V$E2F_03| -2.45 AACCCT_box|AACCCT S. pombe| -4.2 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST1H2AA_HIST1H2BA_H_sapiens NM_170745-NM_170610 hg17_dna range=chr6:25834769-25835116 NM_170745 NM_170610 TATA_box|M00252 TATA V$TATA_01| 19 - 33 - tgggcctatttatag 8.89 TBP|M00713 TBP F$TBP_Q6| 25 - 33 + tatttatag 7.07 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 59 - 69 - ctgattggctg 10.8 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 60 - 71 - tgattggctgat 9.4 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 77 - 88 + tctacccaatca 8.3 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 79 - 89 + tacccaatcag 7.74 Oct-1|M00138 V$OCT1_04 Oct-1| 105 - 127 - tcgcctcatttgcattcacgcca 8 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 134 - 145 + attgtccaatca 8.59 TATA_box|M00252 TATA V$TATA_01| 178 - 192 - cgtgcctataaatac 6.78 TBP|M00713 TBP F$TBP_Q6| 183 - 191 - ctataaata 7.8 TATA_box|M00252 TATA V$TATA_01| 183 - 197 + ctataaataccgcat 9.38 IRF-1|M00747 IRF1| 310 - 316 - aaaagaa 6.95 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST1H2AB_H_sapiens.fasta (1 sequences, 1000 bp, 45.3% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score CCAAT_box|M00254 V$CAAT_01 CCAAT box| 2.09 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 1.63 IRF-1|M00747 IRF1| 0.527 HiNF-D|HiNF-D| 0.374 Oct-1|M00138 V$OCT1_04 Oct-1| 0.195 SPT10|Spt10p| 0.0959 HEX|Hexamer| 0.0813 GC_box|M00255 GC box V$GC_01| -0.0174 IRF-7|M00453 V$IRF7_01 IRF-7| -0.12 TBP|M00713 TBP F$TBP_Q6| -0.144 TATA_box|M00252 TATA V$TATA_01| -0.823 NEG|Negative element| -0.915 E2F|M00516 E2F V$E2F_03| -2.87 AACCCT_box|AACCCT S. pombe| -3.09 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST1H2AB_H_sapiens hg17_dna range=chr6:26141775-26142774 NM_003513 NP_003504 H2A 1 bp downstream - 999 bp upstream - TATA_box|M00252 TATA V$TATA_01| 68 - 82 - gagaagtatttatac 6.13 TBP|M00713 TBP F$TBP_Q6| 74 - 82 + tatttatac 6.33 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 111 - 121 - cccattggcta 9.12 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 112 - 123 - ccattggctaat 9.58 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 128 - 139 + aatacccaatgg 6.04 IRF-7|M00453 V$IRF7_01 IRF-7| 137 - 154 + tgggaaatcagaatctgc 6.24 Oct-1|M00138 V$OCT1_04 Oct-1| 142 - 164 - aatcagaatctgcatccttcatt 6.39 Oct-1|M00138 V$OCT1_04 Oct-1| 155 - 177 - atccttcatttgcatgtaatcct 6.82 IRF-1|M00747 IRF1| 159 - 165 + ttcattt 7.42 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 253 - 264 - taattggccgaa 6.01 SPT10|Spt10p| 309 - 329 + ttgttctggttattttgactt 7.62 HiNF-D|HiNF-D| 329 - 344 - ttcagccgctcgtgct 7.06 GC_box|M00255 GC box V$GC_01| 737 - 750 + aaggggagggggag 6.73 IRF-7|M00453 V$IRF7_01 IRF-7| 759 - 776 + aagaaaagcgaatacccc 6.24 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST1H2AD_HIST1H2BF_H_sapiens.fasta (1 sequences, 317 bp, 35.3% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score CCAAT_box|M00254 V$CAAT_01 CCAAT box| 4.11 Oct-1|M00138 V$OCT1_04 Oct-1| 2.4 IRF-1|M00747 IRF1| 1.57 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 1.15 HEX|Hexamer| 0.0318 TBP|M00713 TBP F$TBP_Q6| -0.164 NEG|Negative element| -1.06 IRF-7|M00453 V$IRF7_01 IRF-7| -1.43 TATA_box|M00252 TATA V$TATA_01| -1.52 HiNF-D|HiNF-D| -1.91 SPT10|Spt10p| -2.88 E2F|M00516 E2F V$E2F_03| -3.37 GC_box|M00255 GC box V$GC_01| -4.47 AACCCT_box|AACCCT S. pombe| -5.62 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST1H2AD_HIST1H2BF_H_sapiens NM_021065-NM_003522 hg17_dna range=chr6:26307450-26307766 NM_021065 NM_003522 IRF-1|M00747 IRF1| 48 - 54 - aagtgaa 7.15 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 112 - 122 - ttgattggcta 6.69 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 113 - 124 - tgattggctaga 10.4 Oct-1|M00138 V$OCT1_04 Oct-1| 156 - 178 - tcacctaatttgcataccacagg 8.69 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 193 - 204 + ttcatccaatca 8.01 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 195 - 205 + catccaatcaa 6.5 IRF-1|M00747 IRF1| 282 - 288 + ttctctt 7.31 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST1H2AJ_HIST1H2BM_H_sapiens.fasta (1 sequences, 305 bp, 38.4% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score E2F|M00516 E2F V$E2F_03| 5.12 Oct-1|M00138 V$OCT1_04 Oct-1| 2.95 IRF-7|M00453 V$IRF7_01 IRF-7| 2.23 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1.82 NEG|Negative element| 0.902 TBP|M00713 TBP F$TBP_Q6| 0.777 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 0.723 IRF-1|M00747 IRF1| 0.352 HEX|Hexamer| -0.129 TATA_box|M00252 TATA V$TATA_01| -0.263 HiNF-D|HiNF-D| -0.449 AACCCT_box|AACCCT S. pombe| -1.32 SPT10|Spt10p| -3.4 GC_box|M00255 GC box V$GC_01| -4.05 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST1H2AJ_HIST1H2BM_H_sapiens NM_021066-NM_003521 hg17_dna range=chr6:27890497-27890801 NM_021066 NM_003521 IRF-1|M00747 IRF1| 40 - 46 - aaatgaa 6.19 E2F|M00516 E2F V$E2F_03| 77 - 88 + ctgggcgcgaaa 8.84 E2F|M00516 E2F V$E2F_03| 77 - 88 - ctgggcgcgaaa 11.4 NEG|Negative element| 78 - 92 + tgggcgcgaaaagga 6.68 IRF-7|M00453 V$IRF7_01 IRF-7| 82 - 99 + cgcgaaaaggaagctgtg 8.54 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 100 - 111 - cgattggcttac 7.48 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 163 - 174 - tgattgggcaaa 7.23 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 203 - 213 + tcaccaatcag 6.97 Oct-1|M00138 V$OCT1_04 Oct-1| 228 - 250 - actcctaatttgcataataacat 9.26 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST1H2AK_HIST1H2BN_H_sapiens.fasta (1 sequences, 324 bp, 41.7% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score CCAAT_box|M00254 V$CAAT_01 CCAAT box| 2.63 NEG|Negative element| 0.97 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 0.908 TATA_box|M00252 TATA V$TATA_01| 0.341 IRF-7|M00453 V$IRF7_01 IRF-7| 0.294 TBP|M00713 TBP F$TBP_Q6| 0.178 HiNF-D|HiNF-D| -0.183 IRF-1|M00747 IRF1| -0.348 HEX|Hexamer| -0.529 AACCCT_box|AACCCT S. pombe| -1.31 Oct-1|M00138 V$OCT1_04 Oct-1| -1.49 SPT10|Spt10p| -1.49 GC_box|M00255 GC box V$GC_01| -1.55 E2F|M00516 E2F V$E2F_03| -3.03 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST1H2AK_HIST1H2BN_H_sapiens NM_003510-NM_003520 hg17_dna range=chr6:27914096-27914419 NM_003510 NM_003520 NEG|Negative element| 41 - 55 + gtaacgctaaagctc 7.02 TATA_box|M00252 TATA V$TATA_01| 53 - 67 - ctccgctacttatag 6.74 TBP|M00713 TBP F$TBP_Q6| 59 - 67 + tacttatag 6.25 IRF-7|M00453 V$IRF7_01 IRF-7| 78 - 95 + cacgaaaactaagctgtg 6.4 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 96 - 107 - ctattggctaac 6.64 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 121 - 132 + tttaaccaatgg 8.13 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 123 - 133 + taaccaatggg 7.2 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 160 - 171 - tgattggacaaa 8.23 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 196 - 207 - ccactggttaaa 6.65 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST1H2AL_H_sapiens.fasta (1 sequences, 1000 bp, 50.1% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score E2F|M00516 E2F V$E2F_03| 3.29 Oct-1|M00138 V$OCT1_04 Oct-1| 2.36 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1.3 HiNF-D|HiNF-D| 0.903 TBP|M00713 TBP F$TBP_Q6| 0.263 IRF-1|M00747 IRF1| 0.207 GC_box|M00255 GC box V$GC_01| 0.0739 HEX|Hexamer| -0.168 IRF-7|M00453 V$IRF7_01 IRF-7| -0.233 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.614 TATA_box|M00252 TATA V$TATA_01| -1.02 NEG|Negative element| -1.32 SPT10|Spt10p| -3.67 AACCCT_box|AACCCT S. pombe| -3.99 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST1H2AL_H_sapiens hg17_dna range=chr6:27940087-27941086 NM_003511 NP_003502 H2A 1 bp downstream - 999 bp upstream + GC_box|M00255 GC box V$GC_01| 160 - 173 + gggaggcggaggcg 7.01 IRF-1|M00747 IRF1| 179 - 185 + atcactt 6.25 Oct-1|M00138 V$OCT1_04 Oct-1| 237 - 259 + tcaaacaaatgtaaaaaattagc 6.88 HiNF-D|HiNF-D| 282 - 297 + aaccccagctactggg 6.57 GC_box|M00255 GC box V$GC_01| 328 - 341 + ggaaggcggaggtt 6.37 E2F|M00516 E2F V$E2F_03| 354 - 365 - gatcgcgccact 6.02 E2F|M00516 E2F V$E2F_03| 376 - 387 - ctgggcggcaaa 7.84 HiNF-D|HiNF-D| 438 - 453 - gccgggcgctgtggct 7.63 IRF-1|M00747 IRF1| 633 - 639 + atcactt 6.25 Oct-1|M00138 V$OCT1_04 Oct-1| 774 - 796 + gaattcttatgcaaatgaggtga 9.84 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 851 - 862 + tttgtccaatcc 6.4 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 890 - 901 - ccattggttgaa 8.18 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 915 - 926 + ttgagccaatgg 7.93 IRF-7|M00453 V$IRF7_01 IRF-7| 927 - 944 - cacagctttattttcgcg 6.8 TBP|M00713 TBP F$TBP_Q6| 931 - 939 + gctttattt 6.31 E2F|M00516 E2F V$E2F_03| 938 - 949 + tttcgcgcccag 10.7 E2F|M00516 E2F V$E2F_03| 938 - 949 - tttcgcgcccag 8.16 TBP|M00713 TBP F$TBP_Q6| 956 - 964 - ctataagta 6.91 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST1H2AM_HIST1H2BO_H_sapiens.fasta (1 sequences, 241 bp, 41.1% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score E2F|M00516 E2F V$E2F_03| 4.95 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 3.56 TATA_box|M00252 TATA V$TATA_01| 2.54 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 1.32 HiNF-D|HiNF-D| 0.538 TBP|M00713 TBP F$TBP_Q6| 0.411 IRF-7|M00453 V$IRF7_01 IRF-7| 0.204 Oct-1|M00138 V$OCT1_04 Oct-1| 0.125 IRF-1|M00747 IRF1| -0.0327 NEG|Negative element| -0.254 HEX|Hexamer| -0.392 GC_box|M00255 GC box V$GC_01| -3.3 SPT10|Spt10p| -4.13 AACCCT_box|AACCCT S. pombe| -4.46 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST1H2AM_HIST1H2BO_H_sapiens NM_003514-NM_003527 hg17_dna range=chr6:27968942-27969182 NM_003514 NM_003527 TATA_box|M00252 TATA V$TATA_01| 19 - 33 - acgcgcattttatag 8.62 E2F|M00516 E2F V$E2F_03| 40 - 51 + ctgggcgcgaaa 8.43 E2F|M00516 E2F V$E2F_03| 40 - 51 - ctgggcgcgaaa 11 IRF-7|M00453 V$IRF7_01 IRF-7| 45 - 62 + cgcgaaaaagaagctggg 6.26 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 58 - 69 + ctgggccattgg 7.25 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 63 - 74 - ccattggctaag 9.52 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 123 - 134 - tgattggactat 6.92 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 160 - 170 + cttccaatcag 7.06 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST1H2BB_H_sapiens.fasta (1 sequences, 1000 bp, 47.2% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score GC_box|M00255 GC box V$GC_01| 2.44 TATA_box|M00252 TATA V$TATA_01| 1.65 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1.25 Oct-1|M00138 V$OCT1_04 Oct-1| 0.828 IRF-1|M00747 IRF1| 0.433 TBP|M00713 TBP F$TBP_Q6| 0.368 HiNF-D|HiNF-D| 0.0888 IRF-7|M00453 V$IRF7_01 IRF-7| -0.0347 NEG|Negative element| -0.516 HEX|Hexamer| -0.592 E2F|M00516 E2F V$E2F_03| -0.7 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.42 SPT10|Spt10p| -1.89 AACCCT_box|AACCCT S. pombe| -3.03 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST1H2BB_H_sapiens hg17_dna range=chr6:26151864-26152863 NM_021062 NP_066406 H2B 1 bp downstream - 999 bp upstream - IRF-1|M00747 IRF1| 13 - 19 - aacagaa 6.58 TATA_box|M00252 TATA V$TATA_01| 74 - 88 - cccatgtatttatag 8.68 TBP|M00713 TBP F$TBP_Q6| 80 - 88 + tatttatag 7.26 IRF-7|M00453 V$IRF7_01 IRF-7| 104 - 121 - gacggtttaagattcctc 6.59 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 127 - 138 - tgattggacaaa 8.37 IRF-1|M00747 IRF1| 136 - 142 - aaaagaa 6.25 GC_box|M00255 GC box V$GC_01| 156 - 169 + gaggggtggggttt 9.91 Oct-1|M00138 V$OCT1_04 Oct-1| 162 - 184 + tggggtttatgcaaatatggaat 7.81 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 200 - 211 - ctattggataaa 6.44 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 224 - 235 + attgaccaatag 7.24 TATA_box|M00252 TATA V$TATA_01| 265 - 279 + gtataaaaggatttg 8.15 TATA_box|M00252 TATA V$TATA_01| 319 - 333 - ccgctgctttcatag 6.21 HiNF-D|HiNF-D| 378 - 393 - gttcgtcgctaccggg 6.17 Oct-1|M00138 V$OCT1_04 Oct-1| 696 - 718 + aagtaaacactcaaatcagaaaa 6.42 NEG|Negative element| 699 - 713 + taaacactcaaatca 6.45 IRF-1|M00747 IRF1| 788 - 794 + ttctgtt 6.24 GC_box|M00255 GC box V$GC_01| 892 - 905 - aacctccaccccgc 7.34 GC_box|M00255 GC box V$GC_01| 897 - 910 - ccaccccgccgctt 6.19 Oct-1|M00138 V$OCT1_04 Oct-1| 974 - 996 - agctagtttttgtatttttatgc 6.93 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST1H2BC_HIST1H2AC_H_sapiens.fasta (1 sequences, 242 bp, 40.9% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score CCAAT_box|M00254 V$CAAT_01 CCAAT box| 3.28 GC_box|M00255 GC box V$GC_01| 2.07 TATA_box|M00252 TATA V$TATA_01| 1.08 Oct-1|M00138 V$OCT1_04 Oct-1| 1 TBP|M00713 TBP F$TBP_Q6| 0.39 HEX|Hexamer| 0.207 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.148 HiNF-D|HiNF-D| -0.527 IRF-1|M00747 IRF1| -0.727 NEG|Negative element| -1.17 IRF-7|M00453 V$IRF7_01 IRF-7| -1.49 SPT10|Spt10p| -3.14 E2F|M00516 E2F V$E2F_03| -3.59 AACCCT_box|AACCCT S. pombe| -5.32 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST1H2BC_HIST1H2AC_H_sapiens NM_003526-NM_003512 hg17_dna range=chr6:26232111-26232352 NM_003526 NM_003512 TBP|M00713 TBP F$TBP_Q6| 47 - 55 + tacttatag 6.27 TATA_box|M00252 TATA V$TATA_01| 52 - 66 - atagggcttttatgc 6.89 GC_box|M00255 GC box V$GC_01| 126 - 139 + cgtgggcagagcta 8.19 Oct-1|M00138 V$OCT1_04 Oct-1| 131 - 153 + gcagagctatgcaaatgaggtat 6.91 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 169 - 180 - ctattggctatc 6.61 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 196 - 207 + accgaccaatca 9.35 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST1H2BD_H_sapiens.fasta (1 sequences, 1000 bp, 46.8% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score GC_box|M00255 GC box V$GC_01| 2.34 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 2.19 TATA_box|M00252 TATA V$TATA_01| 1.84 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 1.7 IRF-1|M00747 IRF1| 0.608 TBP|M00713 TBP F$TBP_Q6| 0.598 HEX|Hexamer| 0.454 IRF-7|M00453 V$IRF7_01 IRF-7| 0.16 HiNF-D|HiNF-D| 0.088 Oct-1|M00138 V$OCT1_04 Oct-1| -0.493 E2F|M00516 E2F V$E2F_03| -0.628 NEG|Negative element| -1.1 SPT10|Spt10p| -2.74 AACCCT_box|AACCCT S. pombe| -4.44 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST1H2BD_H_sapiens hg17_dna range=chr6:26265329-26266328 NM_138720 NP_619790 H2B 1 bp downstream - 999 bp upstream + GC_box|M00255 GC box V$GC_01| 26 - 39 + agggggcgtggctc 9.54 GC_box|M00255 GC box V$GC_01| 57 - 70 + caggggcgggtctc 8.76 E2F|M00516 E2F V$E2F_03| 67 - 78 - tctcccgggaac 6.37 HiNF-D|HiNF-D| 111 - 126 - ctccggagctattttt 6.9 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 386 - 396 + caggcagtgag 6.67 HEX|Hexamer| 398 - 403 + gacttc 6.86 IRF-1|M00747 IRF1| 493 - 499 - aactgaa 7.36 IRF-7|M00453 V$IRF7_01 IRF-7| 502 - 519 + ttagaaaccgacactgca 7.17 TBP|M00713 TBP F$TBP_Q6| 533 - 541 + tccttaaat 6.2 TATA_box|M00252 TATA V$TATA_01| 787 - 801 - gaggcctatttatag 9.03 TBP|M00713 TBP F$TBP_Q6| 793 - 801 + tatttatag 7.13 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 830 - 840 - ctcattgggta 8.61 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 831 - 842 - tcattgggtaca 7.02 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 856 - 867 + aatagccaatga 9.54 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 858 - 868 + tagccaatgaa 8.29 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 922 - 933 + ttaatccaatca 7.79 TATA_box|M00252 TATA V$TATA_01| 971 - 985 + ctataaatgaacagg 8.21 TBP|M00713 TBP F$TBP_Q6| 971 - 979 - ctataaatg 7.02 IRF-1|M00747 IRF1| 975 - 981 - aaatgaa 6.82 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST1H2BE_H_sapiens.fasta (1 sequences, 1000 bp, 41.1% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-1|M00747 IRF1| 0.89 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.741 IRF-7|M00453 V$IRF7_01 IRF-7| 0.739 HiNF-D|HiNF-D| 0.659 TBP|M00713 TBP F$TBP_Q6| 0.599 Oct-1|M00138 V$OCT1_04 Oct-1| 0.382 TATA_box|M00252 TATA V$TATA_01| 0.259 HEX|Hexamer| 0.211 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.0515 GC_box|M00255 GC box V$GC_01| -0.672 E2F|M00516 E2F V$E2F_03| -1.25 NEG|Negative element| -1.4 SPT10|Spt10p| -2.52 AACCCT_box|AACCCT S. pombe| -2.72 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST1H2BE_H_sapiens hg17_dna range=chr6:26291004-26292003 NM_003523 NP_003514 H2B 1 bp downstream - 999 bp upstream + IRF-1|M00747 IRF1| 186 - 192 - aactgaa 7.26 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 211 - 222 + ttcagccaaaga 7.57 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 213 - 223 + cagccaaagat 7.15 IRF-1|M00747 IRF1| 266 - 272 + ttcattt 6.4 HiNF-D|HiNF-D| 551 - 566 - tcgcctagcttgccgt 7.72 TATA_box|M00252 TATA V$TATA_01| 626 - 640 - caggagcttttaaac 6.39 IRF-7|M00453 V$IRF7_01 IRF-7| 640 - 657 - ccgacctttcaattcgaa 7.72 TATA_box|M00252 TATA V$TATA_01| 692 - 706 + atataaaagcataga 6.56 TBP|M00713 TBP F$TBP_Q6| 692 - 700 - atataaaag 7.48 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 823 - 834 + tatgaccaatgg 7.64 IRF-1|M00747 IRF1| 854 - 860 + ttcattt 6.4 Oct-1|M00138 V$OCT1_04 Oct-1| 855 - 877 + tcatttgcatgcagacttcacga 6.34 HEX|Hexamer| 868 - 873 + gacttc 6.86 Oct-1|M00138 V$OCT1_04 Oct-1| 908 - 930 - aatcttcatttacataacattgt 6.77 IRF-1|M00747 IRF1| 912 - 918 + ttcattt 6.4 IRF-7|M00453 V$IRF7_01 IRF-7| 956 - 973 - gtagatttcattttcttt 7.01 IRF-1|M00747 IRF1| 962 - 968 + ttcattt 6.4 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST1H2BG_HIST1H2AE_H_sapiens.fasta (1 sequences, 277 bp, 38.3% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score CCAAT_box|M00254 V$CAAT_01 CCAAT box| 2.57 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 2.48 TATA_box|M00252 TATA V$TATA_01| 2.21 TBP|M00713 TBP F$TBP_Q6| 0.888 HEX|Hexamer| -0.181 Oct-1|M00138 V$OCT1_04 Oct-1| -0.236 IRF-1|M00747 IRF1| -0.915 NEG|Negative element| -1.16 IRF-7|M00453 V$IRF7_01 IRF-7| -1.28 HiNF-D|HiNF-D| -1.51 SPT10|Spt10p| -2.05 E2F|M00516 E2F V$E2F_03| -3.42 GC_box|M00255 GC box V$GC_01| -4.05 AACCCT_box|AACCCT S. pombe| -4.89 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST1H2BG_HIST1H2AE_H_sapiens NM_003518-NM_021052 hg17_dna range=chr6:26324851-26325127 NM_003518 NM_021052 TATA_box|M00252 TATA V$TATA_01| 64 - 78 - tctctccttttatag 8.44 TBP|M00713 TBP F$TBP_Q6| 70 - 78 + cttttatag 6.32 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 117 - 128 - tgattgggcaat 7.98 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 176 - 186 - ctaattggttg 8.67 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 204 - 215 + tttaaccaatca 8.2 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST1H2BH_H_sapiens.fasta (1 sequences, 1000 bp, 34.4% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score E2F|M00516 E2F V$E2F_03| 3.6 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 2.31 HiNF-D|HiNF-D| 2.01 IRF-1|M00747 IRF1| 0.882 TATA_box|M00252 TATA V$TATA_01| 0.812 Oct-1|M00138 V$OCT1_04 Oct-1| 0.529 TBP|M00713 TBP F$TBP_Q6| 0.525 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.0163 IRF-7|M00453 V$IRF7_01 IRF-7| -0.25 NEG|Negative element| -0.259 HEX|Hexamer| -0.362 SPT10|Spt10p| -1.79 GC_box|M00255 GC box V$GC_01| -2.16 AACCCT_box|AACCCT S. pombe| -4.38 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST1H2BH_H_sapiens hg17_dna range=chr6:26358859-26359858 NM_003524 NP_003515 H2B 1 bp downstream - 999 bp upstream + CCAAT_box|M00254 V$CAAT_01 CCAAT box| 31 - 42 - tgattggtccga 8.78 E2F|M00516 E2F V$E2F_03| 52 - 63 - tttcgcgccctg 6.15 E2F|M00516 E2F V$E2F_03| 52 - 63 + tttcgcgccctg 11.2 IRF-1|M00747 IRF1| 248 - 254 - aaatgaa 6.49 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 299 - 310 - tgattggtccag 8.75 TBP|M00713 TBP F$TBP_Q6| 321 - 329 + cctttatat 6.9 TBP|M00713 TBP F$TBP_Q6| 371 - 379 - atataagta 6.76 IRF-1|M00747 IRF1| 420 - 426 + ttcactt 7.25 HiNF-D|HiNF-D| 458 - 473 - tcccatcgctcttgag 7.42 TATA_box|M00252 TATA V$TATA_01| 543 - 557 + ttataaaagaaagcc 6.23 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 551 - 562 + gaaagccaatgg 7.39 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 829 - 840 + aatatccaatca 7.6 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 865 - 875 - tttattggctg 6.02 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 866 - 877 - ttattggctgat 7.61 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 878 - 889 + ttggtccaatca 7.2 Oct-1|M00138 V$OCT1_04 Oct-1| 907 - 929 - agcacctatttgcataaaagacc 7.38 TATA_box|M00252 TATA V$TATA_01| 918 - 932 + gcataaaagacctac 7.01 TATA_box|M00252 TATA V$TATA_01| 929 - 943 + ctacaaaaacggcca 7.59 HiNF-D|HiNF-D| 937 - 952 + acggccagctgtgctg 9.32 HiNF-D|HiNF-D| 937 - 952 - acggccagctgtgctg 6.23 HiNF-D|HiNF-D| 939 - 954 - ggccagctgtgctgtt 6.24 NEG|Negative element| 949 - 963 - gctgttgagccttca 6.74 IRF-1|M00747 IRF1| 960 - 966 + ttcactt 7.25 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST1H2BI_H_sapiens.fasta (1 sequences, 284 bp, 38.4% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-7|M00453 V$IRF7_01 IRF-7| 3.56 Oct-1|M00138 V$OCT1_04 Oct-1| 2.48 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 2.4 TBP|M00713 TBP F$TBP_Q6| 0.65 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.35 HEX|Hexamer| 0.184 HiNF-D|HiNF-D| 0.0929 IRF-1|M00747 IRF1| 0.0901 GC_box|M00255 GC box V$GC_01| -0.678 NEG|Negative element| -0.687 TATA_box|M00252 TATA V$TATA_01| -1.04 E2F|M00516 E2F V$E2F_03| -1.68 AACCCT_box|AACCCT S. pombe| -1.92 SPT10|Spt10p| -5.05 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST1H2BI_H_sapiens hg17_dna range=chr6:26380900-26381183 NM_003525 NP_003516 H2B 1 bp downstream + Oct-1|M00138 V$OCT1_04 Oct-1| 45 - 67 - acttctgacttacatacttatag 6.5 TBP|M00713 TBP F$TBP_Q6| 59 - 67 + tacttatag 6.34 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 105 - 115 + gagccgatgag 7.65 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 159 - 170 + aagaaccaatga 6.29 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 161 - 171 + gaaccaatgag 8.1 IRF-7|M00453 V$IRF7_01 IRF-7| 168 - 185 + tgagaaaccgaaactcag 9.84 Oct-1|M00138 V$OCT1_04 Oct-1| 187 - 209 - cagcctcatttgcatatacacga 8.56 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 191 - 201 - ctcatttgcat 6.02 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST1H2BJ_HIST1H2AG_H_sapiens.fasta (1 sequences, 247 bp, 43.7% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score E2F|M00516 E2F V$E2F_03| 5.06 TATA_box|M00252 TATA V$TATA_01| 3.59 Oct-1|M00138 V$OCT1_04 Oct-1| 3.16 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1.91 TBP|M00713 TBP F$TBP_Q6| 1.86 IRF-1|M00747 IRF1| 1.85 HiNF-D|HiNF-D| 1.17 HEX|Hexamer| 0.993 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 0.891 GC_box|M00255 GC box V$GC_01| 0.205 NEG|Negative element| 0.0797 IRF-7|M00453 V$IRF7_01 IRF-7| -1.28 AACCCT_box|AACCCT S. pombe| -3.71 SPT10|Spt10p| -6.38 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST1H2BJ_HIST1H2AG_H_sapiens NM_021058-NM_021064 hg17_dna range=chr6:27208554-27208800 NM_021058 NM_021064 TATA_box|M00252 TATA V$TATA_01| 15 - 29 - aaggcgcttttatat 8.17 TATA_box|M00252 TATA V$TATA_01| 17 - 31 - ggcgcttttatatag 8.36 TBP|M00713 TBP F$TBP_Q6| 21 - 29 + cttttatat 7.67 Oct-1|M00138 V$OCT1_04 Oct-1| 32 - 54 + aatcgcttatgcaaataaggtga 9.26 HEX|Hexamer| 61 - 66 - gaagtc 6.72 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 73 - 83 - ctgattggtag 6.93 GC_box|M00255 GC box V$GC_01| 107 - 120 - caggtctgcccaat 6.21 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 111 - 122 + tctgcccaatca 7.62 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 150 - 161 - ctattggttgaa 6.7 E2F|M00516 E2F V$E2F_03| 198 - 209 + tttcgcgcccaa 10.9 E2F|M00516 E2F V$E2F_03| 198 - 209 - tttcgcgcccaa 9.87 TATA_box|M00252 TATA V$TATA_01| 216 - 230 + ttataaaaagcgccg 9.07 HiNF-D|HiNF-D| 226 - 241 - cgccgcctttcccgtt 7.13 IRF-1|M00747 IRF1| 240 - 246 + ttcactt 7.86 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST1H2BK_HIST1H2AH_H_sapiens.fasta (1 sequences, 290 bp, 41.7% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score E2F|M00516 E2F V$E2F_03| 5.16 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 3.42 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 3.16 TATA_box|M00252 TATA V$TATA_01| 2.81 TBP|M00713 TBP F$TBP_Q6| 1.61 Oct-1|M00138 V$OCT1_04 Oct-1| 0.414 HEX|Hexamer| 0.305 SPT10|Spt10p| 0.106 IRF-1|M00747 IRF1| -0.012 NEG|Negative element| -0.134 IRF-7|M00453 V$IRF7_01 IRF-7| -0.677 HiNF-D|HiNF-D| -0.696 AACCCT_box|AACCCT S. pombe| -0.788 GC_box|M00255 GC box V$GC_01| -1.66 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST1H2BK_HIST1H2AH_H_sapiens NM_080593-NM_080596 hg17_dna range=chr6:27222598-27222887 NM_080593 NM_080596 SPT10|Spt10p| 4 - 24 - aacgggaagtaatgggagcaa 6.39 TATA_box|M00252 TATA V$TATA_01| 33 - 47 - gagtcgtttttatat 7.73 TATA_box|M00252 TATA V$TATA_01| 35 - 49 - gtcgtttttatatag 6.91 TBP|M00713 TBP F$TBP_Q6| 39 - 47 + tttttatat 7.66 Oct-1|M00138 V$OCT1_04 Oct-1| 50 - 72 + gacctctcatgcaaataaggtga 6.52 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 91 - 101 - ctgattggtgg 8.58 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 128 - 139 + tatacccaatca 6.95 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 170 - 181 - ccattggttaaa 8.11 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 195 - 206 + cctaaccaatga 9.42 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 197 - 207 + taaccaatgac 6.71 E2F|M00516 E2F V$E2F_03| 218 - 229 + tttcgcgcccaa 11.2 E2F|M00516 E2F V$E2F_03| 218 - 229 - tttcgcgcccaa 10.1 TATA_box|M00252 TATA V$TATA_01| 234 - 248 + gtttataaaaggcgc 6.22 TATA_box|M00252 TATA V$TATA_01| 236 - 250 + ttataaaaggcgctg 8.57 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 257 - 267 - ctcgttggcta 8.84 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST1H2BL_HIST1H2AI_H_sapiens.fasta (1 sequences, 269 bp, 40.1% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score E2F|M00516 E2F V$E2F_03| 4.98 IRF-7|M00453 V$IRF7_01 IRF-7| 2.1 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1.92 TATA_box|M00252 TATA V$TATA_01| 1.72 IRF-1|M00747 IRF1| 1.49 TBP|M00713 TBP F$TBP_Q6| 1.33 HEX|Hexamer| 0.842 NEG|Negative element| 0.576 GC_box|M00255 GC box V$GC_01| 0.396 HiNF-D|HiNF-D| 0.0679 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.494 Oct-1|M00138 V$OCT1_04 Oct-1| -0.888 SPT10|Spt10p| -1.84 AACCCT_box|AACCCT S. pombe| -2.99 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST1H2BL_HIST1H2AI_H_sapiens NM_003519-NM_003509 hg17_dna range=chr6:27883688-27883956 NM_003519 NM_003509 HEX|Hexamer| 7 - 12 - gaagtc 6.83 TATA_box|M00252 TATA V$TATA_01| 16 - 30 - ctcctctttttatat 7.72 TBP|M00713 TBP F$TBP_Q6| 22 - 30 + tttttatat 7.06 GC_box|M00255 GC box V$GC_01| 52 - 65 + agtgggaaggtctc 6.62 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 107 - 118 + tttgcccaatca 7.22 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 170 - 181 + gtaagccaatcg 7.44 IRF-7|M00453 V$IRF7_01 IRF-7| 182 - 199 - cacagcttccttttcgcg 8.28 NEG|Negative element| 189 - 203 - tccttttcgcgccca 6.41 E2F|M00516 E2F V$E2F_03| 193 - 204 + tttcgcgcccag 11.2 E2F|M00516 E2F V$E2F_03| 193 - 204 - tttcgcgcccag 8.58 IRF-1|M00747 IRF1| 235 - 241 + ttcactt 7.62 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST1H3A_H_sapiens.fasta (1 sequences, 1000 bp, 40.2% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1.16 TATA_box|M00252 TATA V$TATA_01| 0.916 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 0.743 IRF-1|M00747 IRF1| 0.559 NEG|Negative element| 0.469 HiNF-D|HiNF-D| 0.457 GC_box|M00255 GC box V$GC_01| 0.219 IRF-7|M00453 V$IRF7_01 IRF-7| 0.0308 HEX|Hexamer| -0.0885 TBP|M00713 TBP F$TBP_Q6| -0.101 Oct-1|M00138 V$OCT1_04 Oct-1| -0.659 E2F|M00516 E2F V$E2F_03| -1.63 SPT10|Spt10p| -2.8 AACCCT_box|AACCCT S. pombe| -3.35 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST1H3A_H_sapiens hg17_dna range=chr6:26127698-26128697 NM_003529 NP_003520 H3 1 bp downstream - 999 bp upstream + IRF-1|M00747 IRF1| 42 - 48 + tccactt 6.01 IRF-1|M00747 IRF1| 130 - 136 + ttctctt 6.98 GC_box|M00255 GC box V$GC_01| 141 - 154 - caagtccacctcct 7.39 IRF-7|M00453 V$IRF7_01 IRF-7| 245 - 262 + ttagaaaacaaaagctgc 7.23 IRF-1|M00747 IRF1| 299 - 305 - aagagaa 6.53 HiNF-D|HiNF-D| 729 - 744 + aagaccagcttgggga 6.17 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 863 - 874 + atagaccaatca 7.91 NEG|Negative element| 888 - 902 - catatttagcgtctt 7.79 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 905 - 916 + atcatccaatca 8.11 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 907 - 917 + catccaatcac 7.23 TBP|M00713 TBP F$TBP_Q6| 931 - 939 - ctataaata 6.52 TATA_box|M00252 TATA V$TATA_01| 931 - 945 + ctataaatagagcag 8.39 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 946 - 956 - ctcatgggcgt 7.68 GC_box|M00255 GC box V$GC_01| 948 - 961 + catgggcgtatttg 6.17 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST1H3B_H_sapiens.fasta (1 sequences, 1000 bp, 42.9% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score HiNF-D|HiNF-D| 1.71 Oct-1|M00138 V$OCT1_04 Oct-1| 1.47 GC_box|M00255 GC box V$GC_01| 0.956 TBP|M00713 TBP F$TBP_Q6| 0.538 TATA_box|M00252 TATA V$TATA_01| 0.487 HEX|Hexamer| 0.377 IRF-1|M00747 IRF1| -0.332 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.38 NEG|Negative element| -0.751 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.854 E2F|M00516 E2F V$E2F_03| -1.06 IRF-7|M00453 V$IRF7_01 IRF-7| -1.83 AACCCT_box|AACCCT S. pombe| -2.81 SPT10|Spt10p| -3.49 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST1H3B_H_sapiens hg17_dna range=chr6:26140267-26141266 NM_003537 NP_003528 H3 1 bp downstream - 999 bp upstream - TATA_box|M00252 TATA V$TATA_01| 59 - 73 - actcttcttttatag 7.91 TBP|M00713 TBP F$TBP_Q6| 65 - 73 + cttttatag 6.71 HiNF-D|HiNF-D| 114 - 129 - tccccgcgcccttctt 7.12 HiNF-D|HiNF-D| 136 - 151 - gtccatctctgtgcct 8.2 HiNF-D|HiNF-D| 182 - 197 - taccgtagctactctg 7.43 HEX|Hexamer| 266 - 271 - gaagtc 6.72 TBP|M00713 TBP F$TBP_Q6| 328 - 336 - atataaaaa 7.45 Oct-1|M00138 V$OCT1_04 Oct-1| 363 - 385 - tagggaaatttgcatatgcgctt 8.86 GC_box|M00255 GC box V$GC_01| 450 - 463 + gccgggcgtggcgg 7.14 HiNF-D|HiNF-D| 458 - 473 - tggcggctctcgcctg 7.81 GC_box|M00255 GC box V$GC_01| 578 - 591 - agactccaccccaa 8.14 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST1H3C_H_sapiens.fasta (1 sequences, 1000 bp, 43.6% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 2.58 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 2.45 GC_box|M00255 GC box V$GC_01| 2.36 SPT10|Spt10p| 1.12 IRF-1|M00747 IRF1| 1.07 E2F|M00516 E2F V$E2F_03| 0.523 HiNF-D|HiNF-D| 0.307 Oct-1|M00138 V$OCT1_04 Oct-1| 0.121 TBP|M00713 TBP F$TBP_Q6| -0.0797 IRF-7|M00453 V$IRF7_01 IRF-7| -0.364 HEX|Hexamer| -0.454 NEG|Negative element| -0.482 TATA_box|M00252 TATA V$TATA_01| -1.03 AACCCT_box|AACCCT S. pombe| -3.84 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST1H3C_H_sapiens hg17_dna range=chr6:26152619-26153618 NM_003531 NP_003522 H3 1 bp downstream - 999 bp upstream + GC_box|M00255 GC box V$GC_01| 137 - 150 - aacctccaccccgc 8.01 GC_box|M00255 GC box V$GC_01| 142 - 155 - ccaccccgccgctt 6.94 HiNF-D|HiNF-D| 145 - 160 - ccccgccgcttcacgc 6.32 E2F|M00516 E2F V$E2F_03| 209 - 220 - taccgcgcccag 6.53 Oct-1|M00138 V$OCT1_04 Oct-1| 219 - 241 - agctagtttttgtatttttatgc 6.13 GC_box|M00255 GC box V$GC_01| 341 - 354 - agccaccgcccccc 9.54 IRF-1|M00747 IRF1| 430 - 436 - aagtgaa 7.99 SPT10|Spt10p| 453 - 473 - aataagacattttgagaacag 8.68 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 555 - 565 - ctcattctctg 6.58 TBP|M00713 TBP F$TBP_Q6| 567 - 575 - atataagcg 6.42 Oct-1|M00138 V$OCT1_04 Oct-1| 690 - 712 - aatcggaatttacattttaaaaa 6.52 IRF-1|M00747 IRF1| 790 - 796 - aactgaa 7.34 GC_box|M00255 GC box V$GC_01| 810 - 823 + gatgggcggtgggg 7.69 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 827 - 838 + ctcatccaataa 6.73 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 829 - 839 + catccaataag 8.43 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 851 - 862 + atgaaccaatca 8.51 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 853 - 863 + gaaccaatcag 7.37 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 875 - 886 + ttcagccaatga 9.45 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 877 - 887 + cagccaatgat 9.85 E2F|M00516 E2F V$E2F_03| 890 - 901 + tatcgcgcggga 7.34 E2F|M00516 E2F V$E2F_03| 890 - 901 - tatcgcgcggga 6.03 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 916 - 927 + caggaccaatca 8.23 TBP|M00713 TBP F$TBP_Q6| 944 - 952 - atttaaagg 6.04 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST1H3D_HIST1H2BF_H_sapiens.fasta (1 sequences, 328 bp, 36.6% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score CCAAT_box|M00254 V$CAAT_01 CCAAT box| 4.1 Oct-1|M00138 V$OCT1_04 Oct-1| 2.23 IRF-1|M00747 IRF1| 1.56 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 1.09 HEX|Hexamer| -0.0137 TBP|M00713 TBP F$TBP_Q6| -0.0873 IRF-7|M00453 V$IRF7_01 IRF-7| -0.481 NEG|Negative element| -0.992 TATA_box|M00252 TATA V$TATA_01| -1.46 HiNF-D|HiNF-D| -2.07 SPT10|Spt10p| -2.87 E2F|M00516 E2F V$E2F_03| -3.49 GC_box|M00255 GC box V$GC_01| -4.5 AACCCT_box|AACCCT S. pombe| -5.61 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST1H3D_HIST1H2BF_H_sapiens NM_003530-NM_003522 hg17_dna range=chr6:26307443-26307770 NM_003530 NM_003522 IRF-1|M00747 IRF1| 55 - 61 - aagtgaa 7.21 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 119 - 129 - ttgattggcta 6.74 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 120 - 131 - tgattggctaga 10.5 Oct-1|M00138 V$OCT1_04 Oct-1| 163 - 185 - tcacctaatttgcataccacagg 8.5 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 200 - 211 + ttcatccaatca 7.93 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 202 - 212 + catccaatcaa 6.4 IRF-1|M00747 IRF1| 289 - 295 + ttctctt 7.31 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST1H3E_H_sapiens.fasta (1 sequences, 1000 bp, 36.9% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score HiNF-D|HiNF-D| 0.709 TATA_box|M00252 TATA V$TATA_01| 0.667 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 0.575 IRF-1|M00747 IRF1| 0.434 Oct-1|M00138 V$OCT1_04 Oct-1| 0.373 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.341 HEX|Hexamer| 0.0903 TBP|M00713 TBP F$TBP_Q6| -0.0696 NEG|Negative element| -0.176 IRF-7|M00453 V$IRF7_01 IRF-7| -0.272 E2F|M00516 E2F V$E2F_03| -0.904 SPT10|Spt10p| -1.49 AACCCT_box|AACCCT S. pombe| -2.55 GC_box|M00255 GC box V$GC_01| -3.2 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST1H3E_H_sapiens hg17_dna range=chr6:26332363-26333362 NM_003532 NP_003523 H3 1 bp downstream - 999 bp upstream + HEX|Hexamer| 134 - 139 - gaagtc 6.84 TBP|M00713 TBP F$TBP_Q6| 164 - 172 - ctataaaag 6.01 IRF-1|M00747 IRF1| 173 - 179 + ttctgtt 6.27 HiNF-D|HiNF-D| 206 - 221 - cctcagctctctcccg 7.44 HiNF-D|HiNF-D| 219 - 234 + ccgcagggatccggag 6.43 E2F|M00516 E2F V$E2F_03| 283 - 294 + ttcgccgccatc 6.22 Oct-1|M00138 V$OCT1_04 Oct-1| 607 - 629 + tcaggaaaatgcagaaaaaagca 7.26 IRF-7|M00453 V$IRF7_01 IRF-7| 673 - 690 - aacacattcgatttttta 6.55 TBP|M00713 TBP F$TBP_Q6| 685 - 693 + tttttatag 6.21 NEG|Negative element| 725 - 739 + taaatgatcaatgtc 6.6 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 853 - 864 + ataaaccaatcg 7.14 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 921 - 932 + acaatccaatca 7.07 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 923 - 933 + aatccaatcag 7.97 IRF-1|M00747 IRF1| 939 - 945 + ttctgtt 6.27 TATA_box|M00252 TATA V$TATA_01| 947 - 961 + ctatatagaggggca 7.92 Oct-1|M00138 V$OCT1_04 Oct-1| 978 - 1000 - tcatttactttgcagatgaacta 6.51 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST1H3F_H_sapiens.fasta (1 sequences, 1000 bp, 34.5% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score E2F|M00516 E2F V$E2F_03| 3.7 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 2.31 HiNF-D|HiNF-D| 2 IRF-1|M00747 IRF1| 0.873 TATA_box|M00252 TATA V$TATA_01| 0.698 TBP|M00713 TBP F$TBP_Q6| 0.517 Oct-1|M00138 V$OCT1_04 Oct-1| 0.454 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.0262 HEX|Hexamer| -0.47 IRF-7|M00453 V$IRF7_01 IRF-7| -0.519 NEG|Negative element| -1.1 SPT10|Spt10p| -1.69 GC_box|M00255 GC box V$GC_01| -2.67 AACCCT_box|AACCCT S. pombe| -4.48 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST1H3F_H_sapiens hg17_dna range=chr6:26358814-26359813 NM_021018 NP_066298 H3 1 bp downstream - 999 bp upstream - IRF-1|M00747 IRF1| 26 - 32 - aactgaa 7.19 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 76 - 87 - tgattggtccga 8.78 E2F|M00516 E2F V$E2F_03| 97 - 108 - tttcgcgccctg 6.26 E2F|M00516 E2F V$E2F_03| 97 - 108 + tttcgcgccctg 11.3 IRF-1|M00747 IRF1| 293 - 299 - aaatgaa 6.37 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 344 - 355 - tgattggtccag 8.75 TBP|M00713 TBP F$TBP_Q6| 366 - 374 + cctttatat 6.99 TBP|M00713 TBP F$TBP_Q6| 416 - 424 - atataagta 6.68 IRF-1|M00747 IRF1| 465 - 471 + ttcactt 7.34 HiNF-D|HiNF-D| 503 - 518 - tcccatcgctcttgag 7.51 TATA_box|M00252 TATA V$TATA_01| 588 - 602 + ttataaaagaaagcc 6.08 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 596 - 607 + gaaagccaatgg 7.23 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 874 - 885 + aatatccaatca 7.55 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 910 - 920 - tttattggctg 6.11 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 911 - 922 - ttattggctgat 7.67 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 923 - 934 + ttggtccaatca 7.22 Oct-1|M00138 V$OCT1_04 Oct-1| 952 - 974 - agcacctatttgcataaaagacc 7.28 TATA_box|M00252 TATA V$TATA_01| 963 - 977 + gcataaaagacctac 6.88 TATA_box|M00252 TATA V$TATA_01| 974 - 988 + ctacaaaaacggcca 7.45 HiNF-D|HiNF-D| 982 - 997 + acggccagctgtgctg 9.3 HiNF-D|HiNF-D| 982 - 997 - acggccagctgtgctg 6.2 HiNF-D|HiNF-D| 984 - 999 - ggccagctgtgctgtt 6.28 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST1H3G_H_sapiens.fasta (1 sequences, 1000 bp, 45.1% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 2.22 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1.78 E2F|M00516 E2F V$E2F_03| 1.14 TATA_box|M00252 TATA V$TATA_01| 0.689 IRF-1|M00747 IRF1| 0.615 HEX|Hexamer| 0.425 TBP|M00713 TBP F$TBP_Q6| 0.294 Oct-1|M00138 V$OCT1_04 Oct-1| -0.304 NEG|Negative element| -0.387 IRF-7|M00453 V$IRF7_01 IRF-7| -0.496 HiNF-D|HiNF-D| -0.511 GC_box|M00255 GC box V$GC_01| -0.993 AACCCT_box|AACCCT S. pombe| -1.07 SPT10|Spt10p| -4.25 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST1H3G_H_sapiens hg17_dna range=chr6:26379591-26380590 NM_003534 NP_003525 H3 1 bp downstream - 999 bp upstream - TATA_box|M00252 TATA V$TATA_01| 47 - 61 - actgcccttatatat 7.67 TATA_box|M00252 TATA V$TATA_01| 49 - 63 - tgcccttatatatac 7.25 TBP|M00713 TBP F$TBP_Q6| 51 - 59 + cccttatat 7.16 TBP|M00713 TBP F$TBP_Q6| 53 - 61 + cttatatat 6.25 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 116 - 126 - accattggctg 6.89 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 117 - 128 - ccattggctgaa 8.83 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 165 - 175 - ctgattggatg 9.71 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 166 - 177 - tgattggatgaa 8.1 IRF-1|M00747 IRF1| 182 - 188 + ttcattt 6.45 NEG|Negative element| 298 - 312 + aagacgctaattctc 6.56 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 463 - 474 + acgagccaagaa 6.49 HEX|Hexamer| 472 - 477 - gaagtc 6.83 IRF-1|M00747 IRF1| 508 - 514 - aactgaa 7.54 Oct-1|M00138 V$OCT1_04 Oct-1| 559 - 581 + taaggcacaggctaattttaggt 6.4 IRF-7|M00453 V$IRF7_01 IRF-7| 570 - 587 - ctaattttaggttttcca 6.8 AACCCT_box|AACCCT S. pombe| 922 - 944 - tgcaggcgtcggggggtgacgcg 6.19 E2F|M00516 E2F V$E2F_03| 967 - 978 - ttgcccgccaac 8.44 E2F|M00516 E2F V$E2F_03| 987 - 998 + cttggcggtcag 6.71 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST1H3H_H_sapiens.fasta (1 sequences, 1000 bp, 32.6% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score TATA_box|M00252 TATA V$TATA_01| 1.47 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1.32 IRF-1|M00747 IRF1| 1.23 HiNF-D|HiNF-D| 0.467 IRF-7|M00453 V$IRF7_01 IRF-7| 0.426 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 0.122 TBP|M00713 TBP F$TBP_Q6| -0.0163 HEX|Hexamer| -0.0317 Oct-1|M00138 V$OCT1_04 Oct-1| -0.659 GC_box|M00255 GC box V$GC_01| -0.767 NEG|Negative element| -0.786 E2F|M00516 E2F V$E2F_03| -1.58 SPT10|Spt10p| -2.08 AACCCT_box|AACCCT S. pombe| -3.37 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST1H3H_H_sapiens hg17_dna range=chr6:27884822-27885821 NM_003536 NP_003527 H3 1 bp downstream - 999 bp upstream + IRF-1|M00747 IRF1| 98 - 104 + ttctctt 6.66 HiNF-D|HiNF-D| 140 - 155 - ttcccgagctttccca 7.36 IRF-7|M00453 V$IRF7_01 IRF-7| 144 - 161 - cgagctttcccaccccca 7.2 HiNF-D|HiNF-D| 155 - 170 + acccccagccacacaa 6.06 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 158 - 169 + cccagccacaca 7.88 IRF-1|M00747 IRF1| 220 - 226 + tccactt 6.05 IRF-1|M00747 IRF1| 360 - 366 - aagtgaa 7.44 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 525 - 536 + tgcagccactag 6.62 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 532 - 543 + actagccaattg 6.66 TBP|M00713 TBP F$TBP_Q6| 750 - 758 + tacttatat 6.36 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 888 - 898 + tcgccaatccg 7.31 GC_box|M00255 GC box V$GC_01| 905 - 918 + gttgggtaggcctt 6 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 928 - 939 + tttgtccaatca 7.9 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 930 - 940 + tgtccaatcag 6.07 TATA_box|M00252 TATA V$TATA_01| 954 - 968 + ctataaataagcggc 9.02 HiNF-D|HiNF-D| 964 - 979 - gcggctagctttctct 6.26 IRF-7|M00453 V$IRF7_01 IRF-7| 968 - 985 - ctagctttctctttctcc 6.96 IRF-1|M00747 IRF1| 974 - 980 + ttctctt 6.66 IRF-1|M00747 IRF1| 988 - 994 - aagtgaa 7.44 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST1H3I_HIST1H4L_H_sapiens.fasta (1 sequences, 846 bp, 39.7% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score TATA_box|M00252 TATA V$TATA_01| 2.47 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1.05 GC_box|M00255 GC box V$GC_01| 0.462 HiNF-D|HiNF-D| 0.378 IRF-1|M00747 IRF1| 0.346 HEX|Hexamer| 0.303 IRF-7|M00453 V$IRF7_01 IRF-7| 0.154 TBP|M00713 TBP F$TBP_Q6| -0.121 Oct-1|M00138 V$OCT1_04 Oct-1| -0.134 NEG|Negative element| -0.362 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.429 E2F|M00516 E2F V$E2F_03| -2.08 AACCCT_box|AACCCT S. pombe| -3.03 SPT10|Spt10p| -4.8 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST1H3I_HIST1H4L_H_sapiens NM_003533-NM_003546 hg17_dna range=chr6:27948072-27948917 NM_003533 NM_003546 TATA_box|M00252 TATA V$TATA_01| 52 - 66 - tcccggtatttatag 9.83 TBP|M00713 TBP F$TBP_Q6| 58 - 66 + tatttatag 6.54 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 81 - 92 - tgattggacagt 8.41 GC_box|M00255 GC box V$GC_01| 159 - 172 - acattccgcctctg 6.96 HiNF-D|HiNF-D| 162 - 177 - ttccgcctctgttttg 6.43 Oct-1|M00138 V$OCT1_04 Oct-1| 251 - 273 - tctaggatttttcatgcatcaaa 6.58 IRF-7|M00453 V$IRF7_01 IRF-7| 372 - 389 + aggaaaagtgaaactaga 6.43 IRF-1|M00747 IRF1| 377 - 383 - aagtgaa 7.38 IRF-7|M00453 V$IRF7_01 IRF-7| 415 - 432 + aggggatatgaaattcga 6.46 GC_box|M00255 GC box V$GC_01| 525 - 538 + tttgggcgttgcgg 7.33 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 566 - 576 - cgcattggtag 6.02 HEX|Hexamer| 827 - 832 + gacttc 6.96 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST1H3J_H_sapiens.fasta (1 sequences, 1000 bp, 41.1% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score CCAAT_box|M00254 V$CAAT_01 CCAAT box| 2.47 GC_box|M00255 GC box V$GC_01| 2.31 Oct-1|M00138 V$OCT1_04 Oct-1| 1.09 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 1.09 HiNF-D|HiNF-D| 0.259 HEX|Hexamer| 0.15 E2F|M00516 E2F V$E2F_03| -0.0329 IRF-1|M00747 IRF1| -0.359 TBP|M00713 TBP F$TBP_Q6| -0.703 NEG|Negative element| -1.49 AACCCT_box|AACCCT S. pombe| -1.58 TATA_box|M00252 TATA V$TATA_01| -1.73 IRF-7|M00453 V$IRF7_01 IRF-7| -1.76 SPT10|Spt10p| -2.25 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST1H3J_H_sapiens hg17_dna range=chr6:27966549-27967548 NM_003535 NP_003526 H3 1 bp downstream - 999 bp upstream - CCAAT_box|M00254 V$CAAT_01 CCAAT box| 82 - 93 - tgattggtcaga 9.24 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 111 - 121 - ctggttggttg 6.58 IRF-1|M00747 IRF1| 133 - 139 + ttcattt 6.02 E2F|M00516 E2F V$E2F_03| 215 - 226 + ggtggcgcgatc 6.81 GC_box|M00255 GC box V$GC_01| 239 - 252 - aacctccgcctccc 9.87 HiNF-D|HiNF-D| 242 - 257 - ctccgcctcccgggtt 6.92 HEX|Hexamer| 406 - 411 + gacttc 6.7 E2F|M00516 E2F V$E2F_03| 452 - 463 - ctccgcgccact 6.66 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 477 - 488 + ttcaaccaatca 9.17 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 479 - 489 + caaccaatcat 7.03 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 499 - 509 + cccccaatgaa 6.44 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 854 - 865 - ccaatggctgat 7.6 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 861 - 871 - ctgattggatt 7.78 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 862 - 873 - tgattggattaa 6.72 Oct-1|M00138 V$OCT1_04 Oct-1| 868 - 890 + gattaattatgtaaattattgct 8.51 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST1H4A_H_sapiens.fasta (1 sequences, 1000 bp, 51.8% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score TBP|M00713 TBP F$TBP_Q6| 1.78 GC_box|M00255 GC box V$GC_01| 1.73 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1.25 IRF-1|M00747 IRF1| 1.03 TATA_box|M00252 TATA V$TATA_01| 0.995 HEX|Hexamer| 0.442 HiNF-D|HiNF-D| 0.396 IRF-7|M00453 V$IRF7_01 IRF-7| -0.241 Oct-1|M00138 V$OCT1_04 Oct-1| -0.348 NEG|Negative element| -0.553 E2F|M00516 E2F V$E2F_03| -1.06 AACCCT_box|AACCCT S. pombe| -1.12 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.7 SPT10|Spt10p| -1.92 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST1H4A_H_sapiens hg17_dna range=chr6:26128887-26129886 NM_003538 NP_003529 H4 1 bp downstream - 999 bp upstream + HiNF-D|HiNF-D| 63 - 78 - ttccagagctccgctg 6.04 HiNF-D|HiNF-D| 203 - 218 + ccgcggagagagggcg 6.19 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 363 - 374 + caaaaccaatcg 7.52 GC_box|M00255 GC box V$GC_01| 589 - 602 + gagaggcagaggtt 6.51 AACCCT_box|AACCCT S. pombe| 705 - 727 + tacatttaattcttaacccagtt 6.42 TBP|M00713 TBP F$TBP_Q6| 754 - 762 - aaataaagg 6.6 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 763 - 774 - ccattggtcaag 8.3 GC_box|M00255 GC box V$GC_01| 781 - 794 - tggtcccaccctca 6.59 GC_box|M00255 GC box V$GC_01| 799 - 812 - cccaccctccccca 7.18 GC_box|M00255 GC box V$GC_01| 841 - 854 + tggaggaggggtta 8.2 GC_box|M00255 GC box V$GC_01| 915 - 928 + tggaggtgggggca 6.95 GC_box|M00255 GC box V$GC_01| 921 - 934 + tgggggcaggggta 8.01 TATA_box|M00252 TATA V$TATA_01| 941 - 955 + atatataaagatcgg 8.16 TBP|M00713 TBP F$TBP_Q6| 941 - 949 - atatataaa 7.71 TATA_box|M00252 TATA V$TATA_01| 943 - 957 + atataaagatcggtt 6.51 TBP|M00713 TBP F$TBP_Q6| 943 - 951 - atataaaga 8.89 IRF-7|M00453 V$IRF7_01 IRF-7| 951 - 968 - atcggtttcctattctct 6.64 IRF-1|M00747 IRF1| 982 - 988 + ttcactt 8.37 HEX|Hexamer| 994 - 999 - gaagtc 6.66 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST1H4B_H_sapiens.fasta (1 sequences, 1000 bp, 39.7% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score GC_box|M00255 GC box V$GC_01| 2.61 HiNF-D|HiNF-D| 1.73 IRF-1|M00747 IRF1| 1.11 TATA_box|M00252 TATA V$TATA_01| 0.775 TBP|M00713 TBP F$TBP_Q6| 0.598 IRF-7|M00453 V$IRF7_01 IRF-7| 0.284 Oct-1|M00138 V$OCT1_04 Oct-1| -0.275 HEX|Hexamer| -0.327 NEG|Negative element| -0.72 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.36 SPT10|Spt10p| -1.69 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -1.89 E2F|M00516 E2F V$E2F_03| -2.54 AACCCT_box|AACCCT S. pombe| -3.72 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST1H4B_H_sapiens hg17_dna range=chr6:26135459-26136458 NM_003544 NP_003535 H4 1 bp downstream - 999 bp upstream - TATA_box|M00252 TATA V$TATA_01| 50 - 64 - cacgagcatttatac 8.13 IRF-7|M00453 V$IRF7_01 IRF-7| 82 - 99 + ttgagaactgaaagcggg 7.64 IRF-1|M00747 IRF1| 87 - 93 - aactgaa 7.13 HiNF-D|HiNF-D| 88 - 103 + actgaaagcgggagcg 6.18 HiNF-D|HiNF-D| 94 - 109 + agcgggagcgaggata 7.44 GC_box|M00255 GC box V$GC_01| 110 - 123 + aggaggcgttgctg 9.05 GC_box|M00255 GC box V$GC_01| 133 - 146 - ttgctccgcccctc 9.81 HiNF-D|HiNF-D| 136 - 151 - ctccgcccctcgaggg 6.51 HiNF-D|HiNF-D| 162 - 177 + aaggactgcgagggag 8.82 IRF-1|M00747 IRF1| 189 - 195 + ttcactt 7.64 IRF-1|M00747 IRF1| 527 - 533 - aagagaa 6.84 TBP|M00713 TBP F$TBP_Q6| 650 - 658 - atataagta 7.05 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST1H4C_H_sapiens.fasta (1 sequences, 1000 bp, 38.1% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score CCAAT_box|M00254 V$CAAT_01 CCAAT box| 2.88 HiNF-D|HiNF-D| 0.887 IRF-1|M00747 IRF1| 0.542 GC_box|M00255 GC box V$GC_01| 0.475 E2F|M00516 E2F V$E2F_03| 0.293 HEX|Hexamer| 0.229 TBP|M00713 TBP F$TBP_Q6| -0.106 Oct-1|M00138 V$OCT1_04 Oct-1| -0.298 TATA_box|M00252 TATA V$TATA_01| -0.427 IRF-7|M00453 V$IRF7_01 IRF-7| -0.477 NEG|Negative element| -0.496 SPT10|Spt10p| -0.719 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.84 AACCCT_box|AACCCT S. pombe| -2.28 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST1H4C_H_sapiens hg17_dna range=chr6:26211156-26212155 NM_003542 NP_003533 H4 1 bp downstream - 999 bp upstream + HEX|Hexamer| 32 - 37 - gaagtc 6.85 SPT10|Spt10p| 260 - 280 - gattaaaaacggagggaaggg 6.39 GC_box|M00255 GC box V$GC_01| 275 - 288 + gaagggaagagtgt 6.09 HiNF-D|HiNF-D| 326 - 341 + aggaagagcgtcccgg 7.77 E2F|M00516 E2F V$E2F_03| 334 - 345 - cgtcccgggaaa 7.11 HiNF-D|HiNF-D| 435 - 450 + agggaaagtgacgagg 6.67 HiNF-D|HiNF-D| 563 - 578 + cagcacagagaaggcc 6.81 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 823 - 834 - tcactggccaat 8.3 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 825 - 836 + actggccaatca 10.3 GC_box|M00255 GC box V$GC_01| 867 - 880 - ttgctccacccact 7.75 E2F|M00516 E2F V$E2F_03| 908 - 919 - aaccgcgccaac 6.99 IRF-1|M00747 IRF1| 968 - 974 + ttcagtt 7.31 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST1H4D_H_sapiens.fasta (1 sequences, 1000 bp, 44.3% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score SPT10|Spt10p| 1.48 TBP|M00713 TBP F$TBP_Q6| 1.46 Oct-1|M00138 V$OCT1_04 Oct-1| 1.42 HiNF-D|HiNF-D| 0.832 TATA_box|M00252 TATA V$TATA_01| 0.398 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.13 NEG|Negative element| -0.275 IRF-1|M00747 IRF1| -0.5 HEX|Hexamer| -0.514 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.578 GC_box|M00255 GC box V$GC_01| -0.613 IRF-7|M00453 V$IRF7_01 IRF-7| -1.03 E2F|M00516 E2F V$E2F_03| -1.47 AACCCT_box|AACCCT S. pombe| -3.43 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST1H4D_H_sapiens hg17_dna range=chr6:26297283-26298282 NM_003539 NP_003530 H4 1 bp downstream - 999 bp upstream - TATA_box|M00252 TATA V$TATA_01| 53 - 67 - gcagcacttttataa 6.82 SPT10|Spt10p| 129 - 149 + cccttctgtgcaattctccct 8.78 TATA_box|M00252 TATA V$TATA_01| 221 - 235 - gctaggtatatatat 6.51 Oct-1|M00138 V$OCT1_04 Oct-1| 222 - 244 + ctaggtatatatatatatataca 6.29 Oct-1|M00138 V$OCT1_04 Oct-1| 226 - 248 + gtatatatatatatatacacaca 6.53 TBP|M00713 TBP F$TBP_Q6| 227 - 235 + tatatatat 6.57 Oct-1|M00138 V$OCT1_04 Oct-1| 227 - 249 - tatatatatatatatacacacac 6.35 TBP|M00713 TBP F$TBP_Q6| 228 - 236 - atatatata 6.66 TBP|M00713 TBP F$TBP_Q6| 229 - 237 + tatatatat 6.57 TBP|M00713 TBP F$TBP_Q6| 230 - 238 - atatatata 6.66 TBP|M00713 TBP F$TBP_Q6| 231 - 239 + tatatatat 6.57 TBP|M00713 TBP F$TBP_Q6| 232 - 240 - atatatata 6.66 TBP|M00713 TBP F$TBP_Q6| 233 - 241 + tatatatat 6.57 TBP|M00713 TBP F$TBP_Q6| 234 - 242 - atatatata 6.66 TATA_box|M00252 TATA V$TATA_01| 234 - 248 + atatatatacacaca 6.08 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 258 - 269 + tgcagccattaa 6.9 SPT10|Spt10p| 323 - 343 + cttttcccagaatatcaaata 7.45 HiNF-D|HiNF-D| 505 - 520 - ccgagtagctggggtt 6.22 HiNF-D|HiNF-D| 663 - 678 + agccaccgcgccgggc 7.49 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 760 - 771 + gttaaccaagca 6.11 TBP|M00713 TBP F$TBP_Q6| 821 - 829 - atatgaaag 6.03 NEG|Negative element| 833 - 847 - cacatttagaggtca 6.51 IRF-1|M00747 IRF1| 901 - 907 - aaaagaa 6.12 Oct-1|M00138 V$OCT1_04 Oct-1| 921 - 943 + tgaaatttatgaaaatttatgct 8.13 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST1H4E_H_sapiens.fasta (1 sequences, 1000 bp, 47.3% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score Oct-1|M00138 V$OCT1_04 Oct-1| 2.03 TBP|M00713 TBP F$TBP_Q6| 0.973 GC_box|M00255 GC box V$GC_01| 0.747 IRF-1|M00747 IRF1| 0.613 HiNF-D|HiNF-D| 0.335 HEX|Hexamer| 0.199 IRF-7|M00453 V$IRF7_01 IRF-7| -0.197 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.433 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.524 E2F|M00516 E2F V$E2F_03| -1.18 NEG|Negative element| -1.18 TATA_box|M00252 TATA V$TATA_01| -1.43 SPT10|Spt10p| -3.52 AACCCT_box|AACCCT S. pombe| -4.08 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST1H4E_H_sapiens hg17_dna range=chr6:26311853-26312852 NM_003545 NP_003536 H4 1 bp downstream - 999 bp upstream + Oct-1|M00138 V$OCT1_04 Oct-1| 20 - 42 - gctagatatttaaatgataatta 6.46 Oct-1|M00138 V$OCT1_04 Oct-1| 25 - 47 + atatttaaatgataattataaat 7.66 TBP|M00713 TBP F$TBP_Q6| 26 - 34 + tatttaaat 6.69 TBP|M00713 TBP F$TBP_Q6| 27 - 35 - atttaaatg 6.41 Oct-1|M00138 V$OCT1_04 Oct-1| 31 - 53 + aaatgataattataaattttaat 6.04 Oct-1|M00138 V$OCT1_04 Oct-1| 33 - 55 - atgataattataaattttaataa 6.86 Oct-1|M00138 V$OCT1_04 Oct-1| 39 - 61 - attataaattttaataaacaggg 6.48 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 73 - 84 + ataagccaaaaa 6.27 GC_box|M00255 GC box V$GC_01| 213 - 226 - aacctctgcctcct 7.96 IRF-7|M00453 V$IRF7_01 IRF-7| 296 - 313 - gctaattttgtattctta 7.15 HiNF-D|HiNF-D| 414 - 429 + agccacaacgcccggc 6.16 IRF-1|M00747 IRF1| 453 - 459 + ttctctt 6.85 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 692 - 702 + cagcaaatgat 6.91 Oct-1|M00138 V$OCT1_04 Oct-1| 702 - 724 + ttttaaacatgttaatgtattta 6.99 Oct-1|M00138 V$OCT1_04 Oct-1| 737 - 759 - tgttaaaatatgcctaaatttcc 8.77 Oct-1|M00138 V$OCT1_04 Oct-1| 738 - 760 + gttaaaatatgcctaaatttcct 6.62 GC_box|M00255 GC box V$GC_01| 858 - 871 + gaagggtagggcca 6.7 IRF-1|M00747 IRF1| 911 - 917 + ttcattt 6.79 TBP|M00713 TBP F$TBP_Q6| 935 - 943 - atataagaa 8.04 HiNF-D|HiNF-D| 947 - 962 - taccgtcgcttgtttt 6.65 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST1H4F_H_sapiens.fasta (1 sequences, 1000 bp, 48.9% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score GC_box|M00255 GC box V$GC_01| 1.2 IRF-1|M00747 IRF1| 0.911 TBP|M00713 TBP F$TBP_Q6| 0.629 TATA_box|M00252 TATA V$TATA_01| 0.532 HiNF-D|HiNF-D| 0.414 HEX|Hexamer| 0.272 Oct-1|M00138 V$OCT1_04 Oct-1| 0.197 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.227 IRF-7|M00453 V$IRF7_01 IRF-7| -0.48 NEG|Negative element| -1.07 E2F|M00516 E2F V$E2F_03| -2.2 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.74 SPT10|Spt10p| -4.27 AACCCT_box|AACCCT S. pombe| -4.84 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST1H4F_H_sapiens hg17_dna range=chr6:26347634-26348633 NM_003540 NP_003531 H4 1 bp downstream - 999 bp upstream + HEX|Hexamer| 59 - 64 - gaagtc 6.54 GC_box|M00255 GC box V$GC_01| 202 - 215 + agaaggcggaggtt 7.68 Oct-1|M00138 V$OCT1_04 Oct-1| 306 - 328 - tcaaagaatcttcacatttaaaa 6.14 TBP|M00713 TBP F$TBP_Q6| 321 - 329 - atttaaaaa 6.5 HiNF-D|HiNF-D| 524 - 539 + aacccgagaggcggag 7.38 GC_box|M00255 GC box V$GC_01| 529 - 542 + gagaggcggaggtt 8.14 IRF-1|M00747 IRF1| 619 - 625 + ttctctt 8.13 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 627 - 638 + tctatccattcg 7.3 IRF-7|M00453 V$IRF7_01 IRF-7| 788 - 805 - atcaacttgcatttcccc 6.23 TBP|M00713 TBP F$TBP_Q6| 935 - 943 - atatataag 6.66 TATA_box|M00252 TATA V$TATA_01| 935 - 949 + atatataaggggctt 8.04 TBP|M00713 TBP F$TBP_Q6| 937 - 945 - atataaggg 7.25 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST1H4G_H_sapiens.fasta (1 sequences, 1000 bp, 44.7% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score TATA_box|M00252 TATA V$TATA_01| 1.75 GC_box|M00255 GC box V$GC_01| 1.7 TBP|M00713 TBP F$TBP_Q6| 0.915 IRF-7|M00453 V$IRF7_01 IRF-7| 0.911 IRF-1|M00747 IRF1| 0.791 HiNF-D|HiNF-D| 0.296 NEG|Negative element| 0.0339 HEX|Hexamer| -0.0667 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.423 Oct-1|M00138 V$OCT1_04 Oct-1| -0.678 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.679 E2F|M00516 E2F V$E2F_03| -1.13 AACCCT_box|AACCCT S. pombe| -2.97 SPT10|Spt10p| -3.58 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST1H4G_H_sapiens hg17_dna range=chr6:26355184-26356183 NM_003547 NP_003538 H4 1 bp downstream - 999 bp upstream - TATA_box|M00252 TATA V$TATA_01| 49 - 63 - cgcagccttttatat 9.23 TATA_box|M00252 TATA V$TATA_01| 51 - 65 - cagccttttatataa 6.53 TBP|M00713 TBP F$TBP_Q6| 55 - 63 + cttttatat 8.14 IRF-1|M00747 IRF1| 88 - 94 - aactgaa 7.03 IRF-1|M00747 IRF1| 166 - 172 + ttctctt 7.36 NEG|Negative element| 191 - 205 - ggcatttagagaata 7.36 HiNF-D|HiNF-D| 294 - 309 - gccgggcgcggtggct 6.53 GC_box|M00255 GC box V$GC_01| 500 - 513 + gtggggtggagcct 9.12 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 692 - 702 + cagctaaagag 6.46 IRF-1|M00747 IRF1| 698 - 704 - aagagaa 6.53 IRF-7|M00453 V$IRF7_01 IRF-7| 710 - 727 - ctggtttttggtttcgaa 8.24 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 777 - 788 - tcaatggcccta 6.76 GC_box|M00255 GC box V$GC_01| 936 - 949 - aacctccaccttct 7.08 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST1H4H_H_sapiens.fasta (1 sequences, 1000 bp, 46.3% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score GC_box|M00255 GC box V$GC_01| 2 Oct-1|M00138 V$OCT1_04 Oct-1| 1.05 TBP|M00713 TBP F$TBP_Q6| 0.78 IRF-1|M00747 IRF1| 0.559 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.299 HiNF-D|HiNF-D| 0.271 HEX|Hexamer| 0.151 TATA_box|M00252 TATA V$TATA_01| -0.179 IRF-7|M00453 V$IRF7_01 IRF-7| -0.419 E2F|M00516 E2F V$E2F_03| -0.613 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.776 NEG|Negative element| -1.57 SPT10|Spt10p| -2.14 AACCCT_box|AACCCT S. pombe| -2.31 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST1H4H_H_sapiens hg17_dna range=chr6:26393706-26394705 NM_003543 NP_003534 H4 1 bp downstream - 999 bp upstream - HiNF-D|HiNF-D| 45 - 60 + aggcaaagcaacgccc 6.79 GC_box|M00255 GC box V$GC_01| 50 - 63 - aagcaacgccctta 7.87 TATA_box|M00252 TATA V$TATA_01| 54 - 68 - aacgcccttatatgc 7.05 TBP|M00713 TBP F$TBP_Q6| 58 - 66 + cccttatat 7.18 GC_box|M00255 GC box V$GC_01| 130 - 143 - tggccccaccccgc 8.77 IRF-7|M00453 V$IRF7_01 IRF-7| 230 - 247 + gggaaataggaatgagag 6.08 Oct-1|M00138 V$OCT1_04 Oct-1| 279 - 301 - taaataaattaacatgtttaaat 8.28 IRF-1|M00747 IRF1| 318 - 324 + ttcagtt 7.05 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 498 - 509 + ccaagccaaggg 6.76 IRF-1|M00747 IRF1| 618 - 624 + ttctctt 6.51 TBP|M00713 TBP F$TBP_Q6| 655 - 663 + catttaaat 6.34 TBP|M00713 TBP F$TBP_Q6| 656 - 664 - atttaaata 6.71 GC_box|M00255 GC box V$GC_01| 703 - 716 + tcggggtgggggtt 8.59 TBP|M00713 TBP F$TBP_Q6| 836 - 844 + tatttattt 6.14 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 914 - 925 + ggtagccaaaga 6.89 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST1H4I_H_sapiens.fasta (1 sequences, 1000 bp, 39.3% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score E2F|M00516 E2F V$E2F_03| 3.88 IRF-1|M00747 IRF1| 1.02 GC_box|M00255 GC box V$GC_01| 0.836 HiNF-D|HiNF-D| 0.31 HEX|Hexamer| 0.184 TBP|M00713 TBP F$TBP_Q6| -0.267 Oct-1|M00138 V$OCT1_04 Oct-1| -0.304 IRF-7|M00453 V$IRF7_01 IRF-7| -0.366 TATA_box|M00252 TATA V$TATA_01| -0.37 NEG|Negative element| -0.757 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -1.26 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.4 SPT10|Spt10p| -2.85 AACCCT_box|AACCCT S. pombe| -3.55 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST1H4I_H_sapiens hg17_dna range=chr6:27214068-27215067 NM_003495 NP_003486 H4 1 bp downstream - 999 bp upstream + GC_box|M00255 GC box V$GC_01| 39 - 52 - taccccaacccccc 6.12 TATA_box|M00252 TATA V$TATA_01| 62 - 76 - cagaagcttatatac 6.41 IRF-1|M00747 IRF1| 191 - 197 + ttctctt 7.34 IRF-7|M00453 V$IRF7_01 IRF-7| 197 - 214 + ttggaatctgaatgagat 6.61 IRF-1|M00747 IRF1| 272 - 278 + ttctttt 6.02 IRF-1|M00747 IRF1| 316 - 322 + ttctttt 6.02 GC_box|M00255 GC box V$GC_01| 363 - 376 - aagtccctccctgt 8.16 IRF-1|M00747 IRF1| 385 - 391 - aagagaa 6.16 E2F|M00516 E2F V$E2F_03| 481 - 492 + tttggggggata 6.03 IRF-1|M00747 IRF1| 711 - 717 + ttctttt 6.02 GC_box|M00255 GC box V$GC_01| 870 - 883 - ggtcccctccccca 6.04 HEX|Hexamer| 893 - 898 + gacttc 7 E2F|M00516 E2F V$E2F_03| 895 - 906 + cttcccgccaaa 8.07 E2F|M00516 E2F V$E2F_03| 895 - 906 - cttcccgccaaa 11.4 HiNF-D|HiNF-D| 900 - 915 - cgccaaagctcttccg 6.92 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST1H4J_H_sapiens.fasta (1 sequences, 1000 bp, 38.9% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score GC_box|M00255 GC box V$GC_01| 2.77 IRF-7|M00453 V$IRF7_01 IRF-7| 1.46 TATA_box|M00252 TATA V$TATA_01| 1.42 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 0.804 HiNF-D|HiNF-D| 0.655 HEX|Hexamer| 0.554 TBP|M00713 TBP F$TBP_Q6| 0.0689 IRF-1|M00747 IRF1| -0.0904 E2F|M00516 E2F V$E2F_03| -0.152 Oct-1|M00138 V$OCT1_04 Oct-1| -0.608 NEG|Negative element| -0.654 SPT10|Spt10p| -1.78 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -1.87 AACCCT_box|AACCCT S. pombe| -2.96 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST1H4J_H_sapiens hg17_dna range=chr6:27898883-27899882 NM_021968 NP_068803 H4 1 bp downstream - 999 bp upstream + IRF-7|M00453 V$IRF7_01 IRF-7| 79 - 96 - catagattccctttggca 6.4 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 679 - 689 + cagccaccgag 8.33 IRF-1|M00747 IRF1| 774 - 780 - aacagaa 6.25 IRF-7|M00453 V$IRF7_01 IRF-7| 838 - 855 - ccctatttcggtttggcc 8.56 IRF-7|M00453 V$IRF7_01 IRF-7| 852 - 869 - ggccctttagatttcccc 7.5 HiNF-D|HiNF-D| 872 - 887 + ccccaccggggcggga 6.08 GC_box|M00255 GC box V$GC_01| 877 - 890 + ccggggcgggactt 10.3 HEX|Hexamer| 886 - 891 + gacttc 6.8 E2F|M00516 E2F V$E2F_03| 888 - 899 + cttcccgccgac 6.07 E2F|M00516 E2F V$E2F_03| 888 - 899 - cttcccgccgac 6.86 HEX|Hexamer| 897 - 902 + gacttc 6.8 TATA_box|M00252 TATA V$TATA_01| 935 - 949 + gtataaaggcgctgc 8.96 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST1H4K_H_sapiens.fasta (1 sequences, 1000 bp, 36.5% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score GC_box|M00255 GC box V$GC_01| 3.82 IRF-7|M00453 V$IRF7_01 IRF-7| 1.97 TATA_box|M00252 TATA V$TATA_01| 1.81 HiNF-D|HiNF-D| 0.948 HEX|Hexamer| 0.593 TBP|M00713 TBP F$TBP_Q6| 0.25 E2F|M00516 E2F V$E2F_03| -0.0911 NEG|Negative element| -0.407 IRF-1|M00747 IRF1| -0.56 Oct-1|M00138 V$OCT1_04 Oct-1| -0.596 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.2 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -2.28 SPT10|Spt10p| -2.44 AACCCT_box|AACCCT S. pombe| -3.76 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST1H4K_H_sapiens hg17_dna range=chr6:27907284-27908283 NM_003541 NP_003532 H4 1 bp downstream - 999 bp upstream - TATA_box|M00252 TATA V$TATA_01| 52 - 66 - gcagcgcctttatac 9.36 NEG|Negative element| 67 - 81 - gacagttggcggacc 6 HEX|Hexamer| 99 - 104 - gaagtc 6.89 E2F|M00516 E2F V$E2F_03| 102 - 113 + gtcggcgggaag 6.94 E2F|M00516 E2F V$E2F_03| 102 - 113 - gtcggcgggaag 6.15 HEX|Hexamer| 110 - 115 - gaagtc 6.89 GC_box|M00255 GC box V$GC_01| 111 - 124 - aagtcccgccccgg 11.4 HiNF-D|HiNF-D| 111 - 126 + aagtcccgccccggtg 6.13 HiNF-D|HiNF-D| 114 - 129 - tcccgccccggtgggg 6.79 HiNF-D|HiNF-D| 116 - 131 - ccgccccggtggggga 6.15 IRF-7|M00453 V$IRF7_01 IRF-7| 132 - 149 + ggggaaatctaaagggcc 7.85 IRF-7|M00453 V$IRF7_01 IRF-7| 146 - 163 + ggccaaaccgaaataggg 9.3 TBP|M00713 TBP F$TBP_Q6| 430 - 438 + tccttatat 7.02 GC_box|M00255 GC box V$GC_01| 962 - 975 + ggagggcagtggtg 7.14 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST1H4L_H_sapiens.fasta (1 sequences, 1000 bp, 46.1% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score TBP|M00713 TBP F$TBP_Q6| 0.623 IRF-1|M00747 IRF1| 0.302 HEX|Hexamer| 0.226 HiNF-D|HiNF-D| 0.151 GC_box|M00255 GC box V$GC_01| 0.0931 TATA_box|M00252 TATA V$TATA_01| -0.139 Oct-1|M00138 V$OCT1_04 Oct-1| -0.403 IRF-7|M00453 V$IRF7_01 IRF-7| -0.474 NEG|Negative element| -0.849 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.56 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -1.57 E2F|M00516 E2F V$E2F_03| -1.59 SPT10|Spt10p| -2.4 AACCCT_box|AACCCT S. pombe| -4.03 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST1H4L_H_sapiens hg17_dna range=chr6:27949268-27950267 NM_003546 NP_003537 H4 1 bp downstream - 999 bp upstream - TATA_box|M00252 TATA V$TATA_01| 41 - 55 - cagtactttatatag 7.17 GC_box|M00255 GC box V$GC_01| 123 - 136 - gcgccctgcccacg 7.59 HEX|Hexamer| 136 - 141 + gacttc 6.6 IRF-7|M00453 V$IRF7_01 IRF-7| 144 - 161 + gaaaaaatggaaaagggg 6.47 TBP|M00713 TBP F$TBP_Q6| 525 - 533 + tccttatat 7.37 HiNF-D|HiNF-D| 542 - 557 - ttctgtagctgtcctt 6.41 IRF-1|M00747 IRF1| 557 - 563 + ttctgtt 6.04 IRF-1|M00747 IRF1| 732 - 738 + ttctgtt 6.04 Oct-1|M00138 V$OCT1_04 Oct-1| 767 - 789 - ccctgtcttttacatttacaaat 6.15 TBP|M00713 TBP F$TBP_Q6| 967 - 975 - aaataaaga 6.87 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST2H2AA_H_sapiens.fasta (1 sequences, 230 bp, 51.3% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score CCAAT_box|M00254 V$CAAT_01 CCAAT box| 3.64 Oct-1|M00138 V$OCT1_04 Oct-1| 3.18 TATA_box|M00252 TATA V$TATA_01| 2.97 TBP|M00713 TBP F$TBP_Q6| 2.19 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 0.615 HiNF-D|HiNF-D| 0.0894 E2F|M00516 E2F V$E2F_03| -0.662 HEX|Hexamer| -0.896 IRF-1|M00747 IRF1| -1.02 NEG|Negative element| -1.58 IRF-7|M00453 V$IRF7_01 IRF-7| -1.69 GC_box|M00255 GC box V$GC_01| -3.54 SPT10|Spt10p| -4.51 AACCCT_box|AACCCT S. pombe| -8.31 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST2H2AA_H_sapiens hg17_dna range=chr1:146627391-146627620 NM_003516 NP_003507 H2A 1 bp downstream + TATA_box|M00252 TATA V$TATA_01| 18 - 32 - ttcacctttttatag 9.03 TBP|M00713 TBP F$TBP_Q6| 24 - 32 + tttttatag 8.16 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 61 - 71 - ttgattggctc 6.08 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 62 - 73 - tgattggctcaa 9.67 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 88 - 99 + gatagccaatag 6.64 Oct-1|M00138 V$OCT1_04 Oct-1| 116 - 138 - tccactcatttacataatctcgt 9.21 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST2H2BE_HIST2H2AC_H_sapiens.fasta (1 sequences, 294 bp, 44.6% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score GC_box|M00255 GC box V$GC_01| 4.24 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 3.57 IRF-1|M00747 IRF1| 2.01 TBP|M00713 TBP F$TBP_Q6| 0.64 HEX|Hexamer| 0.26 HiNF-D|HiNF-D| 0.215 IRF-7|M00453 V$IRF7_01 IRF-7| -0.0242 Oct-1|M00138 V$OCT1_04 Oct-1| -0.0433 TATA_box|M00252 TATA V$TATA_01| -0.378 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.613 NEG|Negative element| -0.995 AACCCT_box|AACCCT S. pombe| -1.46 SPT10|Spt10p| -1.77 E2F|M00516 E2F V$E2F_03| -2.18 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST2H2BE_HIST2H2AC_H_sapiens NM_003528-NM_003517 hg17_dna range=chr1:146671305-146671598 NM_003528 NM_003517 IRF-1|M00747 IRF1| 2 - 8 - aagagaa 8.06 GC_box|M00255 GC box V$GC_01| 7 - 20 + aatgggcgggcctg 10.2 IRF-1|M00747 IRF1| 65 - 71 + ttcattt 6.06 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 72 - 83 - ccattggtccgt 6.98 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 137 - 148 - tgattggccggt 9.67 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 162 - 173 + taggaccaatga 8.05 GC_box|M00255 GC box V$GC_01| 186 - 199 - tgaccccaccccta 9.47 TBP|M00713 TBP F$TBP_Q6| 207 - 215 - ttataaagg 6.32 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST2H3C.1_H_sapiens.fasta (1 sequences, 1000 bp, 60.4% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-7|M00453 V$IRF7_01 IRF-7| 3.07 GC_box|M00255 GC box V$GC_01| 0.942 TBP|M00713 TBP F$TBP_Q6| 0.918 TATA_box|M00252 TATA V$TATA_01| 0.899 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.837 IRF-1|M00747 IRF1| 0.791 HEX|Hexamer| 0.434 HiNF-D|HiNF-D| 0.0547 Oct-1|M00138 V$OCT1_04 Oct-1| -0.0656 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.43 E2F|M00516 E2F V$E2F_03| -0.576 NEG|Negative element| -0.613 SPT10|Spt10p| -1.43 AACCCT_box|AACCCT S. pombe| -1.7 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST2H3C.1_H_sapiens hg17_dna range=chr1:146625838-146626837 NM_021059 NP_066403 H3 1 bp downstream - 999 bp upstream - TATA_box|M00252 TATA V$TATA_01| 31 - 45 - cagccgtctttataa 7.79 Oct-1|M00138 V$OCT1_04 Oct-1| 35 - 57 - cgtctttataagcacagtctttt 6.5 TBP|M00713 TBP F$TBP_Q6| 37 - 45 + tctttataa 8.23 TATA_box|M00252 TATA V$TATA_01| 38 - 52 + ctttataagcacagt 7.63 TBP|M00713 TBP F$TBP_Q6| 40 - 48 - ttataagca 6.46 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 60 - 71 - cgattgggcgga 6.2 Oct-1|M00138 V$OCT1_04 Oct-1| 70 - 92 + gaacaataattgaaaatcccgcg 6.33 IRF-1|M00747 IRF1| 77 - 83 - aattgaa 6.59 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 100 - 110 - tccattggctg 6.68 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 101 - 112 - ccattggctgtg 8.24 SPT10|Spt10p| 194 - 214 + cagttggcgaagtttcgcaag 6.07 IRF-7|M00453 V$IRF7_01 IRF-7| 239 - 256 - gtgaaagtcattttccat 7.66 IRF-7|M00453 V$IRF7_01 IRF-7| 507 - 524 + ttggaaaacaaaacagaa 10.5 IRF-7|M00453 V$IRF7_01 IRF-7| 513 - 530 + aacaaaacagaaactaag 7.85 IRF-1|M00747 IRF1| 518 - 524 - aacagaa 7.76 GC_box|M00255 GC box V$GC_01| 593 - 606 - agggccctccccat 6.1 E2F|M00516 E2F V$E2F_03| 698 - 709 - ctccgcgcgcaa 6.22 HiNF-D|HiNF-D| 733 - 748 - ccgcggcgctggtgtt 6.86 HEX|Hexamer| 811 - 816 - gaagtc 7.07 GC_box|M00255 GC box V$GC_01| 892 - 905 - acaccccgccccgc 6.29 GC_box|M00255 GC box V$GC_01| 897 - 910 - ccgccccgccccgc 6.2 GC_box|M00255 GC box V$GC_01| 902 - 915 - ccgccccgccccgt 7.39 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST2H3C.2_H_sapiens.fasta (1 sequences, 1000 bp, 60.4% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-7|M00453 V$IRF7_01 IRF-7| 3.07 GC_box|M00255 GC box V$GC_01| 0.942 TBP|M00713 TBP F$TBP_Q6| 0.918 TATA_box|M00252 TATA V$TATA_01| 0.899 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.837 IRF-1|M00747 IRF1| 0.791 HEX|Hexamer| 0.434 HiNF-D|HiNF-D| 0.0547 Oct-1|M00138 V$OCT1_04 Oct-1| -0.0656 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.43 E2F|M00516 E2F V$E2F_03| -0.576 NEG|Negative element| -0.613 SPT10|Spt10p| -1.43 AACCCT_box|AACCCT S. pombe| -1.7 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST2H3C.2_H_sapiens hg17_dna range=chr1:146636255-146637254 NM_021059 NP_066403 H3 1 bp downstream - 999 bp upstream + GC_box|M00255 GC box V$GC_01| 86 - 99 + acggggcggggcgg 7.39 GC_box|M00255 GC box V$GC_01| 91 - 104 + gcggggcggggcgg 6.2 GC_box|M00255 GC box V$GC_01| 96 - 109 + gcggggcggggtgt 6.29 HEX|Hexamer| 185 - 190 + gacttc 7.07 HiNF-D|HiNF-D| 253 - 268 + aacaccagcgccgcgg 6.86 E2F|M00516 E2F V$E2F_03| 292 - 303 + ttgcgcgcggag 6.22 GC_box|M00255 GC box V$GC_01| 395 - 408 + atggggagggccct 6.1 IRF-7|M00453 V$IRF7_01 IRF-7| 471 - 488 - cttagtttctgttttgtt 7.85 IRF-1|M00747 IRF1| 477 - 483 + ttctgtt 7.76 IRF-7|M00453 V$IRF7_01 IRF-7| 477 - 494 - ttctgttttgttttccaa 10.5 IRF-7|M00453 V$IRF7_01 IRF-7| 745 - 762 + atggaaaatgactttcac 7.66 SPT10|Spt10p| 787 - 807 - cttgcgaaacttcgccaactg 6.07 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 889 - 900 + cacagccaatgg 8.24 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 891 - 901 + cagccaatgga 6.68 Oct-1|M00138 V$OCT1_04 Oct-1| 909 - 931 - cgcgggattttcaattattgttc 6.33 IRF-1|M00747 IRF1| 918 - 924 + ttcaatt 6.59 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 930 - 941 + tccgcccaatcg 6.2 Oct-1|M00138 V$OCT1_04 Oct-1| 944 - 966 + aaaagactgtgcttataaagacg 6.5 TATA_box|M00252 TATA V$TATA_01| 949 - 963 - actgtgcttataaag 7.63 TBP|M00713 TBP F$TBP_Q6| 953 - 961 + tgcttataa 6.46 TATA_box|M00252 TATA V$TATA_01| 956 - 970 + ttataaagacggctg 7.79 TBP|M00713 TBP F$TBP_Q6| 956 - 964 - ttataaaga 8.23 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST2H4.1_H_sapiens.fasta (1 sequences, 1000 bp, 50.7% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-7|M00453 V$IRF7_01 IRF-7| 1.99 TBP|M00713 TBP F$TBP_Q6| 1.26 TATA_box|M00252 TATA V$TATA_01| 0.859 HiNF-D|HiNF-D| 0.822 IRF-1|M00747 IRF1| 0.746 Oct-1|M00138 V$OCT1_04 Oct-1| 0.503 HEX|Hexamer| -0.0703 E2F|M00516 E2F V$E2F_03| -0.647 NEG|Negative element| -1.02 GC_box|M00255 GC box V$GC_01| -1.04 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.4 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -1.49 SPT10|Spt10p| -1.97 AACCCT_box|AACCCT S. pombe| -4.39 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST2H4.1_H_sapiens hg17_dna range=chr1:146645798-146646797 NM_003548 NP_003539 H4 1 bp downstream - 999 bp upstream - TBP|M00713 TBP F$TBP_Q6| 28 - 36 - atatacaag 6.16 IRF-7|M00453 V$IRF7_01 IRF-7| 51 - 68 + ttgaaaaccgaaagcgcg 9.52 HiNF-D|HiNF-D| 57 - 72 + accgaaagcgcgccgg 7.33 IRF-1|M00747 IRF1| 118 - 124 + ttctttt 6.03 IRF-1|M00747 IRF1| 123 - 129 + ttctgtt 6.32 IRF-7|M00453 V$IRF7_01 IRF-7| 207 - 224 - ggagaattcagatcccaa 6.26 TATA_box|M00252 TATA V$TATA_01| 403 - 417 - gccgtgcttatataa 7.86 TBP|M00713 TBP F$TBP_Q6| 407 - 415 + tgcttatat 6.92 TATA_box|M00252 TATA V$TATA_01| 410 - 424 + ttatataaagcttca 6.51 TBP|M00713 TBP F$TBP_Q6| 412 - 420 - atataaagc 7.7 HiNF-D|HiNF-D| 468 - 483 + ctcaagagcggcggcg 6.81 E2F|M00516 E2F V$E2F_03| 492 - 503 - ctgtgcgccaag 6.56 Oct-1|M00138 V$OCT1_04 Oct-1| 790 - 812 - gcgtagtatttgcacataactat 7.13 TBP|M00713 TBP F$TBP_Q6| 830 - 838 - ctttaaata 6 TBP|M00713 TBP F$TBP_Q6| 902 - 910 + tttttattt 6.82 IRF-1|M00747 IRF1| 940 - 946 - aaaagaa 6.74 IRF-1|M00747 IRF1| 948 - 954 + ttcattt 7.1 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST2H4.2_H_sapiens.fasta (1 sequences, 1000 bp, 50.7% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-7|M00453 V$IRF7_01 IRF-7| 1.99 TBP|M00713 TBP F$TBP_Q6| 1.26 TATA_box|M00252 TATA V$TATA_01| 0.859 HiNF-D|HiNF-D| 0.822 IRF-1|M00747 IRF1| 0.746 Oct-1|M00138 V$OCT1_04 Oct-1| 0.503 HEX|Hexamer| -0.0703 E2F|M00516 E2F V$E2F_03| -0.647 NEG|Negative element| -1.02 GC_box|M00255 GC box V$GC_01| -1.04 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.4 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -1.49 SPT10|Spt10p| -1.97 AACCCT_box|AACCCT S. pombe| -4.39 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST2H4.2_H_sapiens hg17_dna range=chr1:146616295-146617294 NM_003548 NP_003539 H4 1 bp downstream - 999 bp upstream + IRF-1|M00747 IRF1| 47 - 53 - aaatgaa 7.1 IRF-1|M00747 IRF1| 55 - 61 + ttctttt 6.74 TBP|M00713 TBP F$TBP_Q6| 91 - 99 - aaataaaaa 6.82 TBP|M00713 TBP F$TBP_Q6| 163 - 171 + tatttaaag 6 Oct-1|M00138 V$OCT1_04 Oct-1| 189 - 211 + atagttatgtgcaaatactacgc 7.13 E2F|M00516 E2F V$E2F_03| 498 - 509 + cttggcgcacag 6.56 HiNF-D|HiNF-D| 518 - 533 - cgccgccgctcttgag 6.81 TATA_box|M00252 TATA V$TATA_01| 577 - 591 - tgaagctttatataa 6.51 TBP|M00713 TBP F$TBP_Q6| 581 - 589 + gctttatat 7.7 TATA_box|M00252 TATA V$TATA_01| 584 - 598 + ttatataagcacggc 7.86 TBP|M00713 TBP F$TBP_Q6| 586 - 594 - atataagca 6.92 IRF-7|M00453 V$IRF7_01 IRF-7| 777 - 794 + ttgggatctgaattctcc 6.26 IRF-1|M00747 IRF1| 872 - 878 - aacagaa 6.32 IRF-1|M00747 IRF1| 877 - 883 - aaaagaa 6.03 HiNF-D|HiNF-D| 929 - 944 - ccggcgcgctttcggt 7.33 IRF-7|M00453 V$IRF7_01 IRF-7| 933 - 950 - cgcgctttcggttttcaa 9.52 TBP|M00713 TBP F$TBP_Q6| 965 - 973 + cttgtatat 6.16 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST3H2A_HIST3H2BB_H_sapiens.fasta (1 sequences, 249 bp, 47.8% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score Oct-1|M00138 V$OCT1_04 Oct-1| 4.15 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 3.55 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 2.93 IRF-7|M00453 V$IRF7_01 IRF-7| 1.8 IRF-1|M00747 IRF1| 1.77 HiNF-D|HiNF-D| 0.698 TBP|M00713 TBP F$TBP_Q6| 0.0259 HEX|Hexamer| -0.0753 TATA_box|M00252 TATA V$TATA_01| -0.588 NEG|Negative element| -1.06 GC_box|M00255 GC box V$GC_01| -2.63 E2F|M00516 E2F V$E2F_03| -2.68 AACCCT_box|AACCCT S. pombe| -3.31 SPT10|Spt10p| -4.37 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST3H2A_HIST3H2BB_H_sapiens NM_033445-NM_175055 hg17_dna range=chr1:224952295-224952543 NM_033445 NM_175055 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 75 - 86 - cgattggatggc 6.37 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 90 - 101 + ggtagccaatca 8.71 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 92 - 102 + tagccaatcag 9.64 Oct-1|M00138 V$OCT1_04 Oct-1| 117 - 139 - actcctaatttgcgtattccttt 10.3 IRF-7|M00453 V$IRF7_01 IRF-7| 121 - 138 - ctaatttgcgtattcctt 7.87 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 164 - 175 + ttgatccaatca 7.69 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 166 - 176 + gatccaatcag 6.98 IRF-1|M00747 IRF1| 197 - 203 + ttcattt 7.78 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST3H3_H_sapiens.fasta (1 sequences, 1000 bp, 54.4% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score GC_box|M00255 GC box V$GC_01| 1.66 TATA_box|M00252 TATA V$TATA_01| 1.6 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 1.59 TBP|M00713 TBP F$TBP_Q6| 0.994 IRF-1|M00747 IRF1| 0.594 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.579 Oct-1|M00138 V$OCT1_04 Oct-1| 0.433 HEX|Hexamer| -0.157 HiNF-D|HiNF-D| -0.399 NEG|Negative element| -1.37 SPT10|Spt10p| -1.79 IRF-7|M00453 V$IRF7_01 IRF-7| -2.03 E2F|M00516 E2F V$E2F_03| -2.14 AACCCT_box|AACCCT S. pombe| -4.07 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST3H3_H_sapiens hg17_dna range=chr1:224919761-224920760 NM_003493 NP_003484 H3 1 bp downstream - 999 bp upstream - TATA_box|M00252 TATA V$TATA_01| 53 - 67 - tgctcgcttttatag 9.06 TBP|M00713 TBP F$TBP_Q6| 59 - 67 + cttttatag 7.14 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 81 - 91 - cccattggctg 9.14 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 82 - 93 - ccattggctggc 6.75 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 123 - 134 - tgattggcccac 7.2 TBP|M00713 TBP F$TBP_Q6| 159 - 167 + cccttatat 7.36 Oct-1|M00138 V$OCT1_04 Oct-1| 351 - 373 - tccacttttttaaaaaattaatt 6.75 TBP|M00713 TBP F$TBP_Q6| 358 - 366 - ttttaaaaa 6.47 TBP|M00713 TBP F$TBP_Q6| 378 - 386 + tttttattt 6.51 GC_box|M00255 GC box V$GC_01| 452 - 465 - aacctccacctccc 6.52 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 538 - 549 - tgcctggctaat 6.37 IRF-1|M00747 IRF1| 688 - 694 + ttcactt 7.72 GC_box|M00255 GC box V$GC_01| 772 - 785 - aagctccgcctccc 9.1 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 849 - 860 - tgcctggctaat 6.37 Oct-1|M00138 V$OCT1_04 Oct-1| 858 - 880 - aattttgttttgtatttttagta 6.25 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: HIST4H4_H_sapiens.fasta (1 sequences, 1000 bp, 41% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score GC_box|M00255 GC box V$GC_01| 4.07 IRF-7|M00453 V$IRF7_01 IRF-7| 1.45 IRF-1|M00747 IRF1| 0.823 TATA_box|M00252 TATA V$TATA_01| 0.636 TBP|M00713 TBP F$TBP_Q6| 0.0855 HEX|Hexamer| 0.071 HiNF-D|HiNF-D| -0.124 Oct-1|M00138 V$OCT1_04 Oct-1| -0.248 NEG|Negative element| -1.13 SPT10|Spt10p| -1.22 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.4 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -2.71 E2F|M00516 E2F V$E2F_03| -2.82 AACCCT_box|AACCCT S. pombe| -3.15 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >HIST4H4_H_sapiens hg17_dna range=chr12:14815332-14816331 NM_175054 NP_778224 H4 1 bp downstream - 999 bp upstream - GC_box|M00255 GC box V$GC_01| 66 - 79 + agtgggcggagctc 11.3 GC_box|M00255 GC box V$GC_01| 81 - 94 - aggccccacctctg 9.79 IRF-1|M00747 IRF1| 239 - 245 - aaaagaa 6.11 TBP|M00713 TBP F$TBP_Q6| 271 - 279 - aaataaaag 6.18 GC_box|M00255 GC box V$GC_01| 309 - 322 - ctgtccctccctcc 6.01 TBP|M00713 TBP F$TBP_Q6| 364 - 372 - ctataaaaa 6.67 TATA_box|M00252 TATA V$TATA_01| 364 - 378 + ctataaaaacctgaa 8.08 IRF-1|M00747 IRF1| 473 - 479 + ttctctt 6.2 IRF-1|M00747 IRF1| 518 - 524 - aaaagaa 6.11 GC_box|M00255 GC box V$GC_01| 549 - 562 - acactccaccccca 9.01 GC_box|M00255 GC box V$GC_01| 555 - 568 - cacccccacctccc 8.67 GC_box|M00255 GC box V$GC_01| 558 - 571 - ccccacctcccccc 7.3 GC_box|M00255 GC box V$GC_01| 577 - 590 - ccgccattcccctt 7.47 IRF-1|M00747 IRF1| 845 - 851 - aagagaa 7.41 IRF-7|M00453 V$IRF7_01 IRF-7| 858 - 875 + aacaaaaacgaaagtttc 8.98 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: His2B_CG17949_D_melanogaster.fasta (1 sequences, 133 bp, 46.6% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-1|M00747 IRF1| 1.97 TBP|M00713 TBP F$TBP_Q6| 0.9 TATA_box|M00252 TATA V$TATA_01| 0.854 Oct-1|M00138 V$OCT1_04 Oct-1| 0.27 HEX|Hexamer| 0.0556 GC_box|M00255 GC box V$GC_01| -0.194 IRF-7|M00453 V$IRF7_01 IRF-7| -0.879 E2F|M00516 E2F V$E2F_03| -1.17 HiNF-D|HiNF-D| -1.36 NEG|Negative element| -1.59 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -1.74 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.87 AACCCT_box|AACCCT S. pombe| -2.84 SPT10|Spt10p| -5.8 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >His2B_CG17949_D_melanogaster dm2_dna range=chr2L:21411198-21411330 NM_165381 NM_165382 >dm2_dna range=chr2L:21411198-21411330 NM_165381 NM_165382 IRF-1|M00747 IRF1| 76 - 82 - aactgaa 7.37 TBP|M00713 TBP F$TBP_Q6| 102 - 110 - gtataaata 6.08 TATA_box|M00252 TATA V$TATA_01| 102 - 116 + gtataaatatttcgc 6.19 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: His2B_CG33876_D_melanogaster.fasta (1 sequences, 228 bp, 40.8% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-1|M00747 IRF1| 2.92 TATA_box|M00252 TATA V$TATA_01| 1.61 TBP|M00713 TBP F$TBP_Q6| 1.52 GC_box|M00255 GC box V$GC_01| 1.29 Oct-1|M00138 V$OCT1_04 Oct-1| 0.265 IRF-7|M00453 V$IRF7_01 IRF-7| -0.0865 HEX|Hexamer| -0.122 HiNF-D|HiNF-D| -0.757 E2F|M00516 E2F V$E2F_03| -0.939 NEG|Negative element| -1.2 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -2.25 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.35 SPT10|Spt10p| -2.83 AACCCT_box|AACCCT S. pombe| -4.68 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >His2B_CG33876_D_melanogaster dm2_dna range=chr2L:21506073-21506300 TBP|M00713 TBP F$TBP_Q6| 11 - 19 + tacttatat 7.14 IRF-1|M00747 IRF1| 34 - 40 + ttcactt 7.73 TATA_box|M00252 TATA V$TATA_01| 62 - 76 - cgttcacatttatac 7.5 GC_box|M00255 GC box V$GC_01| 106 - 119 - gtcccccaccccta 7.35 IRF-1|M00747 IRF1| 119 - 125 - aactgaa 7.01 IRF-1|M00747 IRF1| 196 - 202 - aagtgaa 7.73 IRF-1|M00747 IRF1| 205 - 211 - aagtgaa 7.73 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: His2B_CG33888_D_melanogaster.fasta (1 sequences, 228 bp, 41.7% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-1|M00747 IRF1| 2.94 TBP|M00713 TBP F$TBP_Q6| 1.52 E2F|M00516 E2F V$E2F_03| 1.02 Oct-1|M00138 V$OCT1_04 Oct-1| 0.299 TATA_box|M00252 TATA V$TATA_01| -0.0325 IRF-7|M00453 V$IRF7_01 IRF-7| -0.119 HEX|Hexamer| -0.172 HiNF-D|HiNF-D| -0.291 GC_box|M00255 GC box V$GC_01| -0.546 NEG|Negative element| -1.1 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -2.37 SPT10|Spt10p| -2.84 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.92 AACCCT_box|AACCCT S. pombe| -3.77 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >His2B_CG33888_D_melanogaster dm2_dna range=chr2L:21490939-21491166 TBP|M00713 TBP F$TBP_Q6| 11 - 19 + tacttatat 7.26 IRF-1|M00747 IRF1| 34 - 40 + ttcactt 7.81 IRF-1|M00747 IRF1| 119 - 125 - aactgaa 7.04 E2F|M00516 E2F V$E2F_03| 125 - 136 + atgcgcgggcaa 6.31 E2F|M00516 E2F V$E2F_03| 125 - 136 - atgcgcgggcaa 6.23 IRF-1|M00747 IRF1| 196 - 202 - aagtgaa 7.72 IRF-1|M00747 IRF1| 205 - 211 - aagtgaa 7.72 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: His2B_CG33890_D_melanogaster.fasta (1 sequences, 226 bp, 41.6% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-1|M00747 IRF1| 2.96 TBP|M00713 TBP F$TBP_Q6| 1.51 Oct-1|M00138 V$OCT1_04 Oct-1| 0.303 TATA_box|M00252 TATA V$TATA_01| -0.03 HEX|Hexamer| -0.134 IRF-7|M00453 V$IRF7_01 IRF-7| -0.239 GC_box|M00255 GC box V$GC_01| -0.753 HiNF-D|HiNF-D| -0.756 NEG|Negative element| -0.914 E2F|M00516 E2F V$E2F_03| -0.943 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -1.82 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.22 SPT10|Spt10p| -2.87 AACCCT_box|AACCCT S. pombe| -3.78 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >His2B_CG33890_D_melanogaster dm2_dna range=chr2L:21465603-21465828 5'pad=0 3'pad=0 revComp=FALSE strand=? repeatMasking=none TBP|M00713 TBP F$TBP_Q6| 10 - 18 + tacttatat 7.24 IRF-1|M00747 IRF1| 33 - 39 + ttcactt 7.77 IRF-1|M00747 IRF1| 118 - 124 - aactgaa 7.02 IRF-1|M00747 IRF1| 195 - 201 - aagtgaa 7.76 IRF-1|M00747 IRF1| 204 - 210 - aagtgaa 7.76 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: His2B_CG33910_D_melanogaster.fasta (1 sequences, 198 bp, 42.9% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-1|M00747 IRF1| 2.28 TBP|M00713 TBP F$TBP_Q6| 1.59 Oct-1|M00138 V$OCT1_04 Oct-1| 1.08 TATA_box|M00252 TATA V$TATA_01| 0.0927 HEX|Hexamer| -0.139 IRF-7|M00453 V$IRF7_01 IRF-7| -0.185 HiNF-D|HiNF-D| -0.747 GC_box|M00255 GC box V$GC_01| -0.763 E2F|M00516 E2F V$E2F_03| -0.992 NEG|Negative element| -1.08 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -1.73 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2 SPT10|Spt10p| -4.23 AACCCT_box|AACCCT S. pombe| -4.3 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >His2B_CG33910_D_melanogaster dm2_dna range=chr2L:21406253-21406450 TBP|M00713 TBP F$TBP_Q6| 11 - 19 + tacttatat 7.18 Oct-1|M00138 V$OCT1_04 Oct-1| 11 - 33 - tacttatattttcacaaacacaa 6.12 IRF-1|M00747 IRF1| 34 - 40 + ttcactt 7.47 IRF-1|M00747 IRF1| 119 - 125 - aactgaa 7.42 Oct-1|M00138 V$OCT1_04 Oct-1| 129 - 151 + gcaggcaaacggaaaagtataaa 6.05 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: His3_CG33803_D_melanogaster.fasta (1 sequences, 274 bp, 41.2% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score TATA_box|M00252 TATA V$TATA_01| 2.9 TBP|M00713 TBP F$TBP_Q6| 1.62 IRF-1|M00747 IRF1| 0.95 NEG|Negative element| 0.307 HiNF-D|HiNF-D| 0.0911 HEX|Hexamer| -0.319 IRF-7|M00453 V$IRF7_01 IRF-7| -0.675 Oct-1|M00138 V$OCT1_04 Oct-1| -1.6 E2F|M00516 E2F V$E2F_03| -1.9 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.25 SPT10|Spt10p| -3.46 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -3.84 AACCCT_box|AACCCT S. pombe| -6.53 GC_box|M00255 GC box V$GC_01| -7.88 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >His3_CG33803_D_melanogaster dm2_dna range=chr2L:21472058-21472331 NM_165383 NM_165384 >dm2_dna range=chr2L:21472058-21472331 NM_165383 NM_165384 >dm2_dna range=chr2L:21487297-21487570 NM_165383 NM_165384 TATA_box|M00252 TATA V$TATA_01| 50 - 64 - tgcccctatttatag 9.03 TBP|M00713 TBP F$TBP_Q6| 56 - 64 + tatttatag 6.64 IRF-1|M00747 IRF1| 124 - 130 - aaatgaa 6.71 TATA_box|M00252 TATA V$TATA_01| 183 - 197 + ctatataagtaggta 6.74 TBP|M00713 TBP F$TBP_Q6| 185 - 193 - atataagta 7.35 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: His4_CG31611_D_melanogaster.fasta (1 sequences, 278 bp, 41.7% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score TATA_box|M00252 TATA V$TATA_01| 2.86 TBP|M00713 TBP F$TBP_Q6| 1.69 IRF-1|M00747 IRF1| 0.993 NEG|Negative element| 0.289 HiNF-D|HiNF-D| 0.139 HEX|Hexamer| -0.287 IRF-7|M00453 V$IRF7_01 IRF-7| -0.633 Oct-1|M00138 V$OCT1_04 Oct-1| -1.56 E2F|M00516 E2F V$E2F_03| -1.95 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.27 SPT10|Spt10p| -3.46 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -4.19 AACCCT_box|AACCCT S. pombe| -6.46 GC_box|M00255 GC box V$GC_01| -7.88 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >His4_CG31611_D_melanogaster dm2_dna range=chr2L:21412566-21412843 NM_165383 NM_165384 >dm2_dna range=chr2L:21412566-21412843 NM_165383 NM_165384 TATA_box|M00252 TATA V$TATA_01| 50 - 64 - tgcccctatttatag 8.99 TBP|M00713 TBP F$TBP_Q6| 56 - 64 + tatttatag 6.71 IRF-1|M00747 IRF1| 124 - 130 - aaatgaa 6.8 TATA_box|M00252 TATA V$TATA_01| 187 - 201 + ctatataagtaggta 6.85 TBP|M00713 TBP F$TBP_Q6| 189 - 197 - atataagta 7.44 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: His4_CG33885_D_melanogaster.fasta (1 sequences, 299 bp, 40.1% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score TATA_box|M00252 TATA V$TATA_01| 2.66 TBP|M00713 TBP F$TBP_Q6| 1.54 IRF-1|M00747 IRF1| 1.05 NEG|Negative element| 0.222 HiNF-D|HiNF-D| 0.0933 HEX|Hexamer| -0.307 IRF-7|M00453 V$IRF7_01 IRF-7| -0.425 Oct-1|M00138 V$OCT1_04 Oct-1| -1.58 E2F|M00516 E2F V$E2F_03| -1.86 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.34 SPT10|Spt10p| -3.04 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -3.82 AACCCT_box|AACCCT S. pombe| -6.49 GC_box|M00255 GC box V$GC_01| -7.2 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >His4_CG33885_D_melanogaster dm2_dna range=chr2L:21512303-21512601 H4.D_melanogaster.copy6 H3.D_melanogaster.copy14 >dm2_dna range=chr2L:21512303-21512601 H4.D_melanogaster.copy6 H3.D_melanogaster.copy14 TATA_box|M00252 TATA V$TATA_01| 74 - 88 - tgcccctatttatag 8.83 TBP|M00713 TBP F$TBP_Q6| 80 - 88 + tatttatag 6.49 IRF-1|M00747 IRF1| 148 - 154 - aaatgaa 6.92 TATA_box|M00252 TATA V$TATA_01| 209 - 223 + ctatataagtaggta 6.86 TBP|M00713 TBP F$TBP_Q6| 211 - 219 - atataagta 7.41 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: His4_CG33887_D_melanogaster.fasta (1 sequences, 300 bp, 40% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score TATA_box|M00252 TATA V$TATA_01| 2.66 TBP|M00713 TBP F$TBP_Q6| 1.52 IRF-1|M00747 IRF1| 1.02 NEG|Negative element| 0.214 HiNF-D|HiNF-D| 0.0969 HEX|Hexamer| -0.319 IRF-7|M00453 V$IRF7_01 IRF-7| -0.461 Oct-1|M00138 V$OCT1_04 Oct-1| -1.61 E2F|M00516 E2F V$E2F_03| -1.88 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.33 SPT10|Spt10p| -3.07 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -3.82 AACCCT_box|AACCCT S. pombe| -6.16 GC_box|M00255 GC box V$GC_01| -7.2 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >His4_CG33887_D_melanogaster dm2_dna range=chr2L:21517146-21517445 H4.D_melanogaster.copy7 H3.D_melanogaster.copy12 >dm2_dna range=chr2L:21517146-21517445 H4.D_melanogaster.copy7 H3.D_melanogaster.copy12 TATA_box|M00252 TATA V$TATA_01| 74 - 88 - tgcccctatttatag 8.84 TBP|M00713 TBP F$TBP_Q6| 80 - 88 + tatttatag 6.49 IRF-1|M00747 IRF1| 148 - 154 - aaatgaa 6.88 TATA_box|M00252 TATA V$TATA_01| 209 - 223 + ctatataagtaggta 6.84 TBP|M00713 TBP F$TBP_Q6| 211 - 219 - atataagta 7.38 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: His4_CG33897_D_melanogaster.fasta (1 sequences, 295 bp, 39.7% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score TATA_box|M00252 TATA V$TATA_01| 2.72 TBP|M00713 TBP F$TBP_Q6| 1.44 IRF-1|M00747 IRF1| 0.967 NEG|Negative element| 0.313 HiNF-D|HiNF-D| 0.0189 HEX|Hexamer| -0.34 IRF-7|M00453 V$IRF7_01 IRF-7| -0.479 Oct-1|M00138 V$OCT1_04 Oct-1| -1.63 E2F|M00516 E2F V$E2F_03| -1.78 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.31 SPT10|Spt10p| -3.22 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -3.8 AACCCT_box|AACCCT S. pombe| -6.55 GC_box|M00255 GC box V$GC_01| -7.85 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >His4_CG33897_D_melanogaster dm2_dna range=chr2L:21451862-21452156 H4.D_melanogaster.copy2 H3.D_melanogaster.copy13 >dm2_dna range=chr2L:21451862-21452156 H4.D_melanogaster.copy2 H3.D_melanogaster.copy13 TATA_box|M00252 TATA V$TATA_01| 74 - 88 - tgcccctatttatag 8.91 TBP|M00713 TBP F$TBP_Q6| 80 - 88 + tatttatag 6.39 IRF-1|M00747 IRF1| 148 - 154 - aaatgaa 6.79 TATA_box|M00252 TATA V$TATA_01| 205 - 219 + ctatataagtaggta 6.67 TBP|M00713 TBP F$TBP_Q6| 207 - 215 - atataagta 7.29 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: His4_CG33899_D_melanogaster.fasta (1 sequences, 296 bp, 39.5% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score TATA_box|M00252 TATA V$TATA_01| 2.73 TBP|M00713 TBP F$TBP_Q6| 1.42 IRF-1|M00747 IRF1| 0.941 NEG|Negative element| 0.309 HiNF-D|HiNF-D| 0.0221 HEX|Hexamer| -0.351 IRF-7|M00453 V$IRF7_01 IRF-7| -0.513 Oct-1|M00138 V$OCT1_04 Oct-1| -1.66 E2F|M00516 E2F V$E2F_03| -1.79 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.3 SPT10|Spt10p| -3.25 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -3.8 AACCCT_box|AACCCT S. pombe| -6.24 GC_box|M00255 GC box V$GC_01| -7.87 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >His4_CG33899_D_melanogaster dm2_dna range=chr2L:21446802-21447097 H4.D_melanogaster.copy1 H3.D_melanogaster.copy7 >dm2_dna range=chr2L:21446802-21447097 H4.D_melanogaster.copy1 H3.D_melanogaster.copy7 >dm2_dna range=chr2L:21456905-21457200 H4.D_melanogaster.copy3 H3.D_melanogaster.copy8 TATA_box|M00252 TATA V$TATA_01| 74 - 88 - tgcccctatttatag 8.93 TBP|M00713 TBP F$TBP_Q6| 80 - 88 + tatttatag 6.38 IRF-1|M00747 IRF1| 148 - 154 - aaatgaa 6.76 TATA_box|M00252 TATA V$TATA_01| 205 - 219 + ctatataagtaggta 6.65 TBP|M00713 TBP F$TBP_Q6| 207 - 215 - atataagta 7.26 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: His4_CG33901_D_melanogaster.fasta (1 sequences, 274 bp, 41.6% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score TATA_box|M00252 TATA V$TATA_01| 2.9 TBP|M00713 TBP F$TBP_Q6| 1.68 IRF-1|M00747 IRF1| 0.979 NEG|Negative element| 0.23 HiNF-D|HiNF-D| 0.132 HEX|Hexamer| -0.307 IRF-7|M00453 V$IRF7_01 IRF-7| -0.688 Oct-1|M00138 V$OCT1_04 Oct-1| -1.57 E2F|M00516 E2F V$E2F_03| -1.95 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.28 SPT10|Spt10p| -3.36 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -3.85 AACCCT_box|AACCCT S. pombe| -6.55 GC_box|M00255 GC box V$GC_01| -7.15 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >His4_CG33901_D_melanogaster dm2_dna range=chr2L:21477207-21477480 NM_165383 NM_165384 >dm2_dna range=chr2L:21477207-21477480 NM_165383 NM_165384 >dm2_dna range=chr2L:21482252-21482525 NM_165383 NM_165384 TATA_box|M00252 TATA V$TATA_01| 50 - 64 - tgcccctatttatag 9.02 TBP|M00713 TBP F$TBP_Q6| 56 - 64 + tatttatag 6.72 IRF-1|M00747 IRF1| 124 - 130 - aaatgaa 6.74 TATA_box|M00252 TATA V$TATA_01| 183 - 197 + ctatataagtaggta 6.82 TBP|M00713 TBP F$TBP_Q6| 185 - 193 - atataagta 7.4 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: His4_CG33909_D_melanogaster.fasta (1 sequences, 276 bp, 41.7% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score TATA_box|M00252 TATA V$TATA_01| 2.89 TBP|M00713 TBP F$TBP_Q6| 1.68 IRF-1|M00747 IRF1| 0.974 NEG|Negative element| 0.303 HiNF-D|HiNF-D| 0.117 HEX|Hexamer| -0.291 IRF-7|M00453 V$IRF7_01 IRF-7| -0.656 Oct-1|M00138 V$OCT1_04 Oct-1| -1.57 E2F|M00516 E2F V$E2F_03| -1.94 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.26 SPT10|Spt10p| -3.5 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -4.19 AACCCT_box|AACCCT S. pombe| -6.51 GC_box|M00255 GC box V$GC_01| -7.89 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >His4_CG33909_D_melanogaster dm2_dna range=chr2L:21407504-21407779 NM_165383 NM_165384 >dm2_dna range=chr2L:21407504-21407779 NM_165383 NM_165384 >dm2_dna range=chr2L:21441763-21442038 NM_165383 NM_165384 TATA_box|M00252 TATA V$TATA_01| 50 - 64 - tgcccctatttatag 9.01 TBP|M00713 TBP F$TBP_Q6| 56 - 64 + tatttatag 6.7 IRF-1|M00747 IRF1| 124 - 130 - aaatgaa 6.76 TATA_box|M00252 TATA V$TATA_01| 185 - 199 + ctatataagtaggta 6.81 TBP|M00713 TBP F$TBP_Q6| 187 - 195 - atataagta 7.41 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: Hist1h2ab_M_musculus.fasta (1 sequences, 1000 bp, 36.8% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score GC_box|M00255 GC box V$GC_01| 3.22 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1.01 IRF-1|M00747 IRF1| 0.631 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 0.368 TATA_box|M00252 TATA V$TATA_01| 0.281 Oct-1|M00138 V$OCT1_04 Oct-1| 0.0505 TBP|M00713 TBP F$TBP_Q6| -0.0181 HEX|Hexamer| -0.239 HiNF-D|HiNF-D| -0.396 NEG|Negative element| -0.475 IRF-7|M00453 V$IRF7_01 IRF-7| -0.693 E2F|M00516 E2F V$E2F_03| -3.41 SPT10|Spt10p| -3.65 AACCCT_box|AACCCT S. pombe| -3.84 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >Hist1h2ab_M_musculus mm6_dna range=chr13:23229967-23230966 NM_175660 NP_783591 + GC_box|M00255 GC box V$GC_01| 32 - 45 - cagcaacgcctttc 7.04 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 65 - 75 - ctccttggcct 6.98 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 66 - 77 - tccttggcctca 7.32 HiNF-D|HiNF-D| 95 - 110 + tgggtcagtgacgggg 6.22 GC_box|M00255 GC box V$GC_01| 105 - 118 + acggggcagggtct 10.8 IRF-7|M00453 V$IRF7_01 IRF-7| 111 - 128 - cagggtctccttttcccc 6.19 Oct-1|M00138 V$OCT1_04 Oct-1| 174 - 196 - agaataatttggcatgcttatac 6.84 IRF-1|M00747 IRF1| 384 - 390 + ttctgtt 6.3 GC_box|M00255 GC box V$GC_01| 550 - 563 + tggaggaagtgcca 6.32 TATA_box|M00252 TATA V$TATA_01| 860 - 874 - tgcaggcctttatgc 6.87 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 901 - 912 - ctattgggtacg 6.13 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 917 - 928 + attaaccaatgg 7.93 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 919 - 929 + taaccaatggg 7.1 TATA_box|M00252 TATA V$TATA_01| 958 - 972 + gtataaatgcttgct 6.49 IRF-1|M00747 IRF1| 974 - 980 + ttcagtt 7.14 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: Hist1h2ac_Hist1h2bc_M_musculus.fasta (1 sequences, 241 bp, 42.7% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score CCAAT_box|M00254 V$CAAT_01 CCAAT box| 3.57 TATA_box|M00252 TATA V$TATA_01| 3.32 Oct-1|M00138 V$OCT1_04 Oct-1| 2.22 HEX|Hexamer| 1.19 TBP|M00713 TBP F$TBP_Q6| 1.08 IRF-1|M00747 IRF1| 0.661 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 0.163 GC_box|M00255 GC box V$GC_01| -1.04 IRF-7|M00453 V$IRF7_01 IRF-7| -1.1 HiNF-D|HiNF-D| -1.27 NEG|Negative element| -1.36 E2F|M00516 E2F V$E2F_03| -3.98 AACCCT_box|AACCCT S. pombe| -5.11 SPT10|Spt10p| -5.36 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >Hist1h2ac_Hist1h2bc_M_musculus NM_178189-NM_023422 mm6_dna range=chr13:23163837-23164077 NM_178189 NM_023422 TATA_box|M00252 TATA V$TATA_01| 20 - 34 - cggcagcttttatag 9.41 TBP|M00713 TBP F$TBP_Q6| 26 - 34 + cttttatag 6.52 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 64 - 75 - tgattggttaca 9.57 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 90 - 101 + tatagccaatag 7.55 Oct-1|M00138 V$OCT1_04 Oct-1| 117 - 139 - aaacttcatttgcataatcccac 8.22 IRF-1|M00747 IRF1| 121 - 127 + ttcattt 6.41 TBP|M00713 TBP F$TBP_Q6| 212 - 220 - ctataagta 6.36 HEX|Hexamer| 224 - 229 - gaagtc 6.94 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: Hist1h2ae_Hist1h2bg_M_musculus.fasta (1 sequences, 177 bp, 37.9% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 4.13 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 3.62 TATA_box|M00252 TATA V$TATA_01| 1.92 HEX|Hexamer| 0.0532 TBP|M00713 TBP F$TBP_Q6| 0.0349 Oct-1|M00138 V$OCT1_04 Oct-1| -0.375 HiNF-D|HiNF-D| -0.387 NEG|Negative element| -1 GC_box|M00255 GC box V$GC_01| -1.36 IRF-1|M00747 IRF1| -1.43 IRF-7|M00453 V$IRF7_01 IRF-7| -1.78 E2F|M00516 E2F V$E2F_03| -2.55 SPT10|Spt10p| -3.17 AACCCT_box|AACCCT S. pombe| -6.35 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >Hist1h2ae_Hist1h2bg_M_musculus NM_178187-NM_178196 mm6_dna range=chr13:23051289-23051465 NM_178187 NM_178196 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1 - 12 - tgattggttaaa 9.04 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 26 - 37 + tgcagccaataa 8.3 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 28 - 38 + cagccaataag 9.94 TATA_box|M00252 TATA V$TATA_01| 137 - 151 + ctataaaatggcaag 7.69 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: Hist1h2ag_Hist1h2bj_M_musculus.fasta (1 sequences, 282 bp, 43.3% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score E2F|M00516 E2F V$E2F_03| 4.67 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 2.96 GC_box|M00255 GC box V$GC_01| 1.91 IRF-7|M00453 V$IRF7_01 IRF-7| 1.57 TATA_box|M00252 TATA V$TATA_01| 0.913 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 0.898 TBP|M00713 TBP F$TBP_Q6| 0.666 HiNF-D|HiNF-D| 0.51 IRF-1|M00747 IRF1| 0.344 NEG|Negative element| 0.207 Oct-1|M00138 V$OCT1_04 Oct-1| 0.0555 HEX|Hexamer| -0.0351 AACCCT_box|AACCCT S. pombe| -1.86 SPT10|Spt10p| -2.06 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >Hist1h2ag_Hist1h2bj_M_musculus NM_178186-NM_178198 mm6_dna range=chr13:21523014-21523295 NM_178186 NM_178198 TBP|M00713 TBP F$TBP_Q6| 37 - 45 + tccttatag 6.29 E2F|M00516 E2F V$E2F_03| 52 - 63 + ctgggcgcgaaa 8.32 E2F|M00516 E2F V$E2F_03| 52 - 63 - ctgggcgcgaaa 10.9 NEG|Negative element| 53 - 67 + tgggcgcgaaaagga 6.29 IRF-7|M00453 V$IRF7_01 IRF-7| 57 - 74 + cgcgaaaaggaacgttcg 7.44 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 75 - 86 - ggattggctgcg 7.59 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 97 - 108 + ctagaccaatgg 7.34 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 134 - 145 - tgattgggccaa 6.3 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 162 - 173 + tcaaaccaatca 8.49 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 170 - 181 + atcacccaatca 7.25 IRF-7|M00453 V$IRF7_01 IRF-7| 180 - 197 - catcattttgctttccta 6.51 Oct-1|M00138 V$OCT1_04 Oct-1| 197 - 219 - aagctttatttgaataaggcctc 6.03 TATA_box|M00252 TATA V$TATA_01| 219 - 233 + ctttaaaagggaaga 6.89 GC_box|M00255 GC box V$GC_01| 224 - 237 + aaagggaagagccg 8.19 HiNF-D|HiNF-D| 225 - 240 + aagggaagagccgatc 6.51 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 232 - 242 + gagccgatcag 6.17 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: Hist1h2ah_Hist1h2bk_M_musculus.fasta (1 sequences, 336 bp, 42.6% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score E2F|M00516 E2F V$E2F_03| 4.17 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 2.62 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 2.18 Oct-1|M00138 V$OCT1_04 Oct-1| 1.65 IRF-1|M00747 IRF1| 1.62 NEG|Negative element| 0.189 TBP|M00713 TBP F$TBP_Q6| 0.167 IRF-7|M00453 V$IRF7_01 IRF-7| 0.0484 TATA_box|M00252 TATA V$TATA_01| -0.105 HEX|Hexamer| -0.255 HiNF-D|HiNF-D| -0.296 SPT10|Spt10p| -0.876 GC_box|M00255 GC box V$GC_01| -1.16 AACCCT_box|AACCCT S. pombe| -1.78 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >Hist1h2ah_Hist1h2bk_M_musculus NM_175659-NM_175665 mm6_dna range=chr13:21515617-21515952 NM_175659 NM_175665 IRF-7|M00453 V$IRF7_01 IRF-7| 48 - 65 + aaacaaagggaaactctg 6.38 Oct-1|M00138 V$OCT1_04 Oct-1| 62 - 84 - tctgtagatttttatagtcaagc 6.06 TATA_box|M00252 TATA V$TATA_01| 64 - 78 - tgtagatttttatag 6.21 NEG|Negative element| 68 - 82 - gatttttatagtcaa 6.08 TBP|M00713 TBP F$TBP_Q6| 70 - 78 + tttttatag 6.27 E2F|M00516 E2F V$E2F_03| 85 - 96 - cagggcgcgaaa 10.6 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 107 - 117 - gtcattggtta 6.4 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 108 - 119 - tcattggttagc 7.61 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 133 - 144 + cttaaccaatgg 8.67 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 171 - 181 - ctcattgggta 8.52 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 172 - 183 - tcattgggtaaa 6.76 IRF-1|M00747 IRF1| 232 - 238 + ttcactt 7.71 Oct-1|M00138 V$OCT1_04 Oct-1| 233 - 255 - tcactttatttgcatacgaagtt 7.83 IRF-1|M00747 IRF1| 322 - 328 + ttcattt 6.36 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: Hist1h2ak_Hist1h2bn_M_musculus.fasta (1 sequences, 297 bp, 40.1% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score CCAAT_box|M00254 V$CAAT_01 CCAAT box| 2.59 TATA_box|M00252 TATA V$TATA_01| 1.88 TBP|M00713 TBP F$TBP_Q6| 0.488 IRF-7|M00453 V$IRF7_01 IRF-7| 0.192 HiNF-D|HiNF-D| 0.0697 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.0144 HEX|Hexamer| -0.15 IRF-1|M00747 IRF1| -0.374 Oct-1|M00138 V$OCT1_04 Oct-1| -0.908 NEG|Negative element| -0.992 AACCCT_box|AACCCT S. pombe| -2.87 GC_box|M00255 GC box V$GC_01| -3.24 E2F|M00516 E2F V$E2F_03| -3.27 SPT10|Spt10p| -3.41 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >Hist1h2ak_Hist1h2bn_M_musculus NM_178183-NM_178201 mm6_dna range=chr13:21233892-21234188 NM_178183 NM_178201 TATA_box|M00252 TATA V$TATA_01| 52 - 66 - tgacagtatttatag 6 TBP|M00713 TBP F$TBP_Q6| 58 - 66 + tatttatag 6.3 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 95 - 105 - ttcattggtta 6.05 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 96 - 107 - tcattggttaca 8.7 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 122 - 133 + ctagaccaataa 6.83 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 161 - 172 - tgattgggtatt 6.3 TATA_box|M00252 TATA V$TATA_01| 219 - 233 + gtttaaaaggcagcc 8.02 IRF-7|M00453 V$IRF7_01 IRF-7| 242 - 259 - cacactttacatttcttt 6.45 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: Hist1h2an_Hist1h2bp_M_musculus.fasta (1 sequences, 298 bp, 44.3% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score CCAAT_box|M00254 V$CAAT_01 CCAAT box| 3.45 TATA_box|M00252 TATA V$TATA_01| 2.36 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 1.85 E2F|M00516 E2F V$E2F_03| 1.13 TBP|M00713 TBP F$TBP_Q6| 0.939 IRF-1|M00747 IRF1| 0.833 IRF-7|M00453 V$IRF7_01 IRF-7| 0.0877 Oct-1|M00138 V$OCT1_04 Oct-1| -0.187 HEX|Hexamer| -0.268 HiNF-D|HiNF-D| -0.432 NEG|Negative element| -0.966 SPT10|Spt10p| -1.06 GC_box|M00255 GC box V$GC_01| -1.85 AACCCT_box|AACCCT S. pombe| -6.06 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >Hist1h2an_Hist1h2bp_M_musculus NM_178184-NM_178202 mm6_dna range=chr13:21267283-21267580 NM_178184 NM_178202 TATA_box|M00252 TATA V$TATA_01| 51 - 65 - gcttggcctttatag 8.69 TBP|M00713 TBP F$TBP_Q6| 57 - 65 + cctttatag 7.06 E2F|M00516 E2F V$E2F_03| 72 - 83 - ccaagcgcgaaa 7.16 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 95 - 106 - cgattggctggc 8.48 IRF-1|M00747 IRF1| 110 - 116 + ttctttt 6.53 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 120 - 131 + ctagaccaatgg 7.06 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 157 - 168 - ccattgggcgct 6.39 IRF-7|M00453 V$IRF7_01 IRF-7| 175 - 192 + tgaaaatttgaaaatttt 6.23 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 190 - 201 + tttaaccaatca 9.35 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 192 - 202 + taaccaatcag 8.07 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: Hist1h2ao.1_M_musculus.fasta (1 sequences, 283 bp, 48.1% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score CCAAT_box|M00254 V$CAAT_01 CCAAT box| 2.57 HEX|Hexamer| 1.41 E2F|M00516 E2F V$E2F_03| 1.07 TBP|M00713 TBP F$TBP_Q6| 0.764 IRF-1|M00747 IRF1| 0.428 IRF-7|M00453 V$IRF7_01 IRF-7| 0.0711 Oct-1|M00138 V$OCT1_04 Oct-1| 0.0617 HiNF-D|HiNF-D| -0.0798 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.247 TATA_box|M00252 TATA V$TATA_01| -0.492 NEG|Negative element| -1.29 GC_box|M00255 GC box V$GC_01| -2.23 AACCCT_box|AACCCT S. pombe| -4.2 SPT10|Spt10p| -4.65 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >Hist1h2ao.1_M_musculus mm6_dna range=chr13:21290250-21290532 NM_178185 NP_835492 + Oct-1|M00138 V$OCT1_04 Oct-1| 46 - 68 + gaggtcttattcaaatgaggcat 6.08 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 84 - 95 - tgattggttcat 8.39 HEX|Hexamer| 115 - 120 - gaagtc 6.74 E2F|M00516 E2F V$E2F_03| 136 - 147 - gcgcccgcgaat 6.48 IRF-7|M00453 V$IRF7_01 IRF-7| 144 - 161 - gaatgcttcccattcgtc 6.22 IRF-1|M00747 IRF1| 168 - 174 - aaaagaa 6.41 HEX|Hexamer| 175 - 180 - gaagtc 6.74 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 178 - 189 + gtcagccaatcg 7.87 E2F|M00516 E2F V$E2F_03| 201 - 212 + ttttgcgcccag 6.54 TBP|M00713 TBP F$TBP_Q6| 219 - 227 - ctataaggg 6.31 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: Hist1h2ao.2_M_musculus.fasta (1 sequences, 281 bp, 48% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score CCAAT_box|M00254 V$CAAT_01 CCAAT box| 2.59 HEX|Hexamer| 1.4 E2F|M00516 E2F V$E2F_03| 1.09 TBP|M00713 TBP F$TBP_Q6| 0.756 IRF-1|M00747 IRF1| 0.394 IRF-7|M00453 V$IRF7_01 IRF-7| 0.112 Oct-1|M00138 V$OCT1_04 Oct-1| 0.0513 HiNF-D|HiNF-D| -0.0818 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.237 TATA_box|M00252 TATA V$TATA_01| -0.501 NEG|Negative element| -1.28 GC_box|M00255 GC box V$GC_01| -2.26 AACCCT_box|AACCCT S. pombe| -4.21 SPT10|Spt10p| -4.63 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >Hist1h2ao.2_M_musculus mm6_dna range=chr13:21313540-21313820 NM_178185 NP_835492 - TBP|M00713 TBP F$TBP_Q6| 57 - 65 + cccttatag 6.29 E2F|M00516 E2F V$E2F_03| 72 - 83 - ctgggcgcaaaa 6.57 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 95 - 106 - cgattggctgac 7.87 HEX|Hexamer| 104 - 109 + gacttc 6.73 IRF-1|M00747 IRF1| 110 - 116 + ttctttt 6.36 IRF-7|M00453 V$IRF7_01 IRF-7| 123 - 140 + gacgaatgggaagcattc 6.26 E2F|M00516 E2F V$E2F_03| 137 - 148 + attcgcgggcgc 6.48 HEX|Hexamer| 164 - 169 + gacttc 6.73 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 189 - 200 + atgaaccaatca 8.4 Oct-1|M00138 V$OCT1_04 Oct-1| 216 - 238 - atgcctcatttgaataagacctc 6.05 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: Hist1h2be_M_musculus.fasta (1 sequences, 649 bp, 44.1% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 5.84 GC_box|M00255 GC box V$GC_01| 2.14 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.767 IRF-1|M00747 IRF1| 0.168 HEX|Hexamer| 0.0276 NEG|Negative element| -0.232 HiNF-D|HiNF-D| -0.458 TBP|M00713 TBP F$TBP_Q6| -0.882 Oct-1|M00138 V$OCT1_04 Oct-1| -1.03 TATA_box|M00252 TATA V$TATA_01| -1.38 IRF-7|M00453 V$IRF7_01 IRF-7| -1.9 SPT10|Spt10p| -2.76 AACCCT_box|AACCCT S. pombe| -2.85 E2F|M00516 E2F V$E2F_03| -4 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >Hist1h2be_M_musculus mm6_dna range=chr13:23101002-23101650 NM_178194 NP_835501 - IRF-1|M00747 IRF1| 5 - 11 + ttcattt 6.59 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 119 - 129 - ctcattggctg 13 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 120 - 131 - tcattggctgtc 7.82 GC_box|M00255 GC box V$GC_01| 297 - 310 + tgcgggtggggttg 9 GC_box|M00255 GC box V$GC_01| 576 - 589 - aagctcagcccact 6.62 GC_box|M00255 GC box V$GC_01| 607 - 620 - taaccacaccccct 7.5 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: Hist1h2bf_Hist1h2ad_M_musculus.fasta (1 sequences, 282 bp, 43.6% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score E2F|M00516 E2F V$E2F_03| 4.69 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 2.8 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 1.8 TBP|M00713 TBP F$TBP_Q6| 1.58 HEX|Hexamer| 0.869 SPT10|Spt10p| -0.0646 TATA_box|M00252 TATA V$TATA_01| -0.587 IRF-7|M00453 V$IRF7_01 IRF-7| -0.83 IRF-1|M00747 IRF1| -0.922 NEG|Negative element| -1.07 Oct-1|M00138 V$OCT1_04 Oct-1| -1.09 HiNF-D|HiNF-D| -1.29 AACCCT_box|AACCCT S. pombe| -1.85 GC_box|M00255 GC box V$GC_01| -2.65 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >Hist1h2bf_Hist1h2ad_M_musculus NM_178195-NM_178188 mm6_dna range=chr13:23054259-23054540 NM_178195 NM_178188 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 95 - 106 - tgattggtttat 7.46 HEX|Hexamer| 121 - 126 - gaagtc 6.72 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 126 - 137 + cttgcccaatca 7.99 SPT10|Spt10p| 142 - 162 + gcgccccgaatgcttctcatt 6.17 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 157 - 167 - ctcattggtct 7.04 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 158 - 169 - tcattggtctag 7.52 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 180 - 191 + gtcagccaatgg 7.68 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 182 - 192 + cagccaatggc 7.57 E2F|M00516 E2F V$E2F_03| 203 - 214 + tttcgcgcccag 10.9 E2F|M00516 E2F V$E2F_03| 203 - 214 - tttcgcgcccag 8.33 TBP|M00713 TBP F$TBP_Q6| 221 - 229 - atataaagg 7.8 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: Hist1h2bh_Hist1h3f_M_musculus.fasta (1 sequences, 614 bp, 37.3% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score CCAAT_box|M00254 V$CAAT_01 CCAAT box| 3.62 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 1.09 HiNF-D|HiNF-D| 0.627 IRF-1|M00747 IRF1| 0.497 TBP|M00713 TBP F$TBP_Q6| 0.255 HEX|Hexamer| -0.436 Oct-1|M00138 V$OCT1_04 Oct-1| -0.517 TATA_box|M00252 TATA V$TATA_01| -0.53 NEG|Negative element| -0.568 SPT10|Spt10p| -0.925 IRF-7|M00453 V$IRF7_01 IRF-7| -1.29 E2F|M00516 E2F V$E2F_03| -2.1 GC_box|M00255 GC box V$GC_01| -2.65 AACCCT_box|AACCCT S. pombe| -5.74 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >Hist1h2bh_Hist1h3f_M_musculus NM_178197-NM_013548 mm6_dna range=chr13:23023417-23024030 NM_178197 NM_013548 HiNF-D|HiNF-D| 76 - 91 - agcggtggctgtcctt 7.29 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 121 - 132 + actgtccaatca 8.61 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 148 - 158 - ctcagtggtta 7.18 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 149 - 160 - tcagtggttagt 6.74 IRF-1|M00747 IRF1| 209 - 215 - aaatgaa 6.06 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 232 - 242 - ctgattggcca 7.69 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 233 - 244 - tgattggccaag 10.5 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 245 - 256 + tttagccaatag 7.7 IRF-1|M00747 IRF1| 537 - 543 + ttcattt 6.33 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: Hist1h2bl_Hist1h2ai_M_musculus.fasta (1 sequences, 280 bp, 40% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score CCAAT_box|M00254 V$CAAT_01 CCAAT box| 2.59 IRF-1|M00747 IRF1| 1.47 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 0.907 E2F|M00516 E2F V$E2F_03| 0.885 TATA_box|M00252 TATA V$TATA_01| 0.826 HEX|Hexamer| -0.0323 NEG|Negative element| -0.104 TBP|M00713 TBP F$TBP_Q6| -0.61 HiNF-D|HiNF-D| -0.612 Oct-1|M00138 V$OCT1_04 Oct-1| -0.653 IRF-7|M00453 V$IRF7_01 IRF-7| -2.19 GC_box|M00255 GC box V$GC_01| -3.63 AACCCT_box|AACCCT S. pombe| -3.81 SPT10|Spt10p| -4.5 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >Hist1h2bl_Hist1h2ai_M_musculus NM_178199-NM_178182 mm6_dna range=chr13:21196208-21196487 NM_178199 NM_178182 IRF-1|M00747 IRF1| 14 - 20 - aagtgaa 7.67 TATA_box|M00252 TATA V$TATA_01| 61 - 75 - ggctgcattttaaac 6.11 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 122 - 133 + acagtccaatca 7.12 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 168 - 178 + taaccaatgtg 6.65 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 177 - 188 + tgtaaccaatga 8.67 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 179 - 189 + taaccaatgaa 6.1 E2F|M00516 E2F V$E2F_03| 200 - 211 + tttcgcgtccag 6.81 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: Hist1h2bm_M_musculus.fasta (1 sequences, 284 bp, 37.3% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 3.38 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 2.71 Oct-1|M00138 V$OCT1_04 Oct-1| 2.52 IRF-1|M00747 IRF1| 1.68 TATA_box|M00252 TATA V$TATA_01| 1.25 NEG|Negative element| 0.713 E2F|M00516 E2F V$E2F_03| 0.537 HiNF-D|HiNF-D| 0.0583 TBP|M00713 TBP F$TBP_Q6| -0.0116 HEX|Hexamer| -0.487 GC_box|M00255 GC box V$GC_01| -1.07 IRF-7|M00453 V$IRF7_01 IRF-7| -2.1 SPT10|Spt10p| -2.21 AACCCT_box|AACCCT S. pombe| -5.99 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >Hist1h2bm_M_musculus mm6_dna range=chr13:21201880-21202163 NM_178200 NP_835507 + E2F|M00516 E2F V$E2F_03| 62 - 73 - aatggcgctaaa 6.68 IRF-1|M00747 IRF1| 73 - 79 - aaatgaa 6.07 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 86 - 97 - gcattggctaag 7.55 Oct-1|M00138 V$OCT1_04 Oct-1| 130 - 152 - ttgaacaatatgcattctcattg 7.82 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 146 - 156 - ctcattggata 9.65 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 147 - 158 - tcattggatagg 8.36 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 170 - 181 + actaaccaataa 7.48 Oct-1|M00138 V$OCT1_04 Oct-1| 198 - 220 - cgtctctatttgcataacagcgt 8.25 TATA_box|M00252 TATA V$TATA_01| 221 - 235 + gtatatagggcgttc 7.34 NEG|Negative element| 222 - 236 - tatatagggcgttca 6.57 IRF-1|M00747 IRF1| 233 - 239 + ttcactt 7.77 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: Hist1h3a_M_musculus.fasta (1 sequences, 1000 bp, 37.3% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1 HiNF-D|HiNF-D| 0.974 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 0.624 HEX|Hexamer| 0.542 IRF-1|M00747 IRF1| 0.178 TBP|M00713 TBP F$TBP_Q6| -0.157 Oct-1|M00138 V$OCT1_04 Oct-1| -0.27 NEG|Negative element| -0.85 E2F|M00516 E2F V$E2F_03| -0.932 TATA_box|M00252 TATA V$TATA_01| -1.06 SPT10|Spt10p| -1.58 IRF-7|M00453 V$IRF7_01 IRF-7| -1.63 AACCCT_box|AACCCT S. pombe| -2.03 GC_box|M00255 GC box V$GC_01| -2.76 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >Hist1h3a_M_musculus mm6_dna range=chr13:23242264-23243263 NM_013550 NP_038578 - TBP|M00713 TBP F$TBP_Q6| 25 - 33 + tatttatag 6.07 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 47 - 57 - gtgattggatg 6.77 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 48 - 59 - tgattggatgaa 7.59 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 89 - 99 - ctgattggttt 7.82 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 90 - 101 - tgattggtttat 7.31 E2F|M00516 E2F V$E2F_03| 132 - 143 + tctgccgcggta 6.29 HEX|Hexamer| 305 - 310 + gacttc 6.88 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 345 - 356 - tgattggtttac 6.38 IRF-1|M00747 IRF1| 399 - 405 + ttcattt 6.06 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 587 - 598 - tttttggccaga 6.46 HiNF-D|HiNF-D| 708 - 723 - tcccagagctattgtg 7.11 IRF-1|M00747 IRF1| 760 - 766 + ttctctt 6.51 HiNF-D|HiNF-D| 908 - 923 + acccgcagagaaggcc 8.05 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: Hist1h3b_M_musculus.fasta (1 sequences, 789 bp, 36% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score HiNF-D|HiNF-D| 2.46 TATA_box|M00252 TATA V$TATA_01| 1.36 IRF-1|M00747 IRF1| 0.73 Oct-1|M00138 V$OCT1_04 Oct-1| 0.175 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.166 E2F|M00516 E2F V$E2F_03| -0.204 TBP|M00713 TBP F$TBP_Q6| -0.275 HEX|Hexamer| -0.527 NEG|Negative element| -0.625 SPT10|Spt10p| -1.11 IRF-7|M00453 V$IRF7_01 IRF-7| -1.49 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.71 GC_box|M00255 GC box V$GC_01| -1.77 AACCCT_box|AACCCT S. pombe| -2.15 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >Hist1h3b_M_musculus mm6_dna range=chr13:23231470-23232258 NM_178203 NP_835510 + TATA_box|M00252 TATA V$TATA_01| 9 - 23 + ccataaaatgagctg 6.34 TATA_box|M00252 TATA V$TATA_01| 47 - 61 - ctacagtttttatac 6.76 E2F|M00516 E2F V$E2F_03| 218 - 229 + tttggcacccag 7.05 IRF-1|M00747 IRF1| 439 - 445 + ttcactt 7.62 HiNF-D|HiNF-D| 593 - 608 + aggggaagagaggcgg 9.24 HiNF-D|HiNF-D| 595 - 610 + gggaagagaggcggag 7.94 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 657 - 668 + gctgaccaatcc 6.46 HiNF-D|HiNF-D| 669 - 684 + caacaaagcgcgggcc 8.31 TATA_box|M00252 TATA V$TATA_01| 724 - 738 + gtataaaaggtggac 8.29 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: Hist1h3e_M_musculus.fasta (1 sequences, 1000 bp, 42.7% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score Oct-1|M00138 V$OCT1_04 Oct-1| 2.24 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 2.09 SPT10|Spt10p| 1.37 TBP|M00713 TBP F$TBP_Q6| 1.26 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 0.681 TATA_box|M00252 TATA V$TATA_01| 0.623 HiNF-D|HiNF-D| 0.537 HEX|Hexamer| -0.495 IRF-1|M00747 IRF1| -0.701 E2F|M00516 E2F V$E2F_03| -0.715 NEG|Negative element| -0.919 IRF-7|M00453 V$IRF7_01 IRF-7| -1.04 GC_box|M00255 GC box V$GC_01| -1.33 AACCCT_box|AACCCT S. pombe| -5.29 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >Hist1h3e_M_musculus mm6_dna range=chr13:23042434-23043433 NM_178205 NP_835512 - SPT10|Spt10p| 6 - 26 - gaggaggagaaacgggagcag 6.85 HiNF-D|HiNF-D| 7 - 22 + aggaggagaaacggga 6.51 HiNF-D|HiNF-D| 16 - 31 + aacgggagcagagggc 6.51 TATA_box|M00252 TATA V$TATA_01| 38 - 52 - tgctgctatttatgc 7 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 68 - 78 - ctgattggatt 8.22 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 69 - 80 - tgattggattct 7.22 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 136 - 147 - cgattggccgat 9.34 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 174 - 185 + aataaccaatgg 7.97 TBP|M00713 TBP F$TBP_Q6| 368 - 376 + tctatatat 6.25 Oct-1|M00138 V$OCT1_04 Oct-1| 371 - 393 + atatatgtatgtatatgtataca 9.02 Oct-1|M00138 V$OCT1_04 Oct-1| 376 - 398 - tgtatgtatatgtatacatatat 7.9 Oct-1|M00138 V$OCT1_04 Oct-1| 377 - 399 + gtatgtatatgtatacatatata 6.41 Oct-1|M00138 V$OCT1_04 Oct-1| 380 - 402 - tgtatatgtatacatatatatat 6.54 Oct-1|M00138 V$OCT1_04 Oct-1| 381 - 403 + gtatatgtatacatatatatata 7.4 Oct-1|M00138 V$OCT1_04 Oct-1| 386 - 408 - tgtatacatatatatatatacac 6.24 TBP|M00713 TBP F$TBP_Q6| 392 - 400 + catatatat 6.2 TBP|M00713 TBP F$TBP_Q6| 393 - 401 - atatatata 6.39 TBP|M00713 TBP F$TBP_Q6| 394 - 402 + tatatatat 6.32 TBP|M00713 TBP F$TBP_Q6| 395 - 403 - atatatata 6.39 TBP|M00713 TBP F$TBP_Q6| 396 - 404 + tatatatat 6.32 TBP|M00713 TBP F$TBP_Q6| 397 - 405 - atatatata 6.39 Oct-1|M00138 V$OCT1_04 Oct-1| 418 - 440 - tgcacatatttacacacacacac 6.1 E2F|M00516 E2F V$E2F_03| 508 - 519 + tctggcggccac 6.45 GC_box|M00255 GC box V$GC_01| 567 - 580 - atgctccacctacg 6.09 SPT10|Spt10p| 719 - 739 - agcgagaaactacccgaaaac 8.8 TATA_box|M00252 TATA V$TATA_01| 924 - 938 + gtataaaacgaatcc 7.15 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: Hist1h3g_M_musculus.fasta (1 sequences, 1000 bp, 44.4% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1.6 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 1.34 HEX|Hexamer| 0.101 Oct-1|M00138 V$OCT1_04 Oct-1| 0.0831 GC_box|M00255 GC box V$GC_01| -0.0989 TBP|M00713 TBP F$TBP_Q6| -0.212 E2F|M00516 E2F V$E2F_03| -0.228 IRF-7|M00453 V$IRF7_01 IRF-7| -0.487 NEG|Negative element| -0.747 HiNF-D|HiNF-D| -0.913 IRF-1|M00747 IRF1| -0.977 TATA_box|M00252 TATA V$TATA_01| -1.77 AACCCT_box|AACCCT S. pombe| -3.33 SPT10|Spt10p| -3.8 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >Hist1h3g_M_musculus mm6_dna range=chr13:23014484-23015483 NM_145073 NP_659539 + IRF-7|M00453 V$IRF7_01 IRF-7| 162 - 179 - tacatcttcgtattgctc 6.31 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 418 - 428 - ctccttggttg 8.73 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 528 - 539 - ggattggctcat 6.45 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 801 - 812 + gttaaccaatcg 7.51 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 824 - 835 + gttaaccaatca 8.14 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 848 - 859 + ctcagccaatag 8.09 E2F|M00516 E2F V$E2F_03| 865 - 876 - ctgcgcgggaca 7.15 GC_box|M00255 GC box V$GC_01| 886 - 899 - cagacacgcctatc 7.35 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: Hist1h3i_M_musculus.fasta (1 sequences, 1000 bp, 40.5% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score E2F|M00516 E2F V$E2F_03| 4.86 GC_box|M00255 GC box V$GC_01| 3.66 NEG|Negative element| 0.987 IRF-1|M00747 IRF1| 0.461 TBP|M00713 TBP F$TBP_Q6| 0.228 HEX|Hexamer| 0.119 TATA_box|M00252 TATA V$TATA_01| -0.188 Oct-1|M00138 V$OCT1_04 Oct-1| -0.284 HiNF-D|HiNF-D| -0.634 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.97 IRF-7|M00453 V$IRF7_01 IRF-7| -1.03 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.93 SPT10|Spt10p| -2.23 AACCCT_box|AACCCT S. pombe| -4.02 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >Hist1h3i_M_musculus mm6_dna range=chr13:21263435-21264434 NM_178207 NP_835514 - IRF-1|M00747 IRF1| 16 - 22 - aagtgaa 7.44 TBP|M00713 TBP F$TBP_Q6| 53 - 61 + tatatatat 6.13 NEG|Negative element| 172 - 186 - tatatttaacgtaca 8.24 Oct-1|M00138 V$OCT1_04 Oct-1| 190 - 212 - ttcatctttttacataacaatta 6.41 TBP|M00713 TBP F$TBP_Q6| 281 - 289 + tatttattt 6.11 E2F|M00516 E2F V$E2F_03| 495 - 506 + tttggcgcgaaa 12.1 E2F|M00516 E2F V$E2F_03| 495 - 506 - tttggcgcgaaa 11.2 IRF-1|M00747 IRF1| 568 - 574 + ttctgtt 6.56 GC_box|M00255 GC box V$GC_01| 693 - 706 - cagccccaccccac 11.2 GC_box|M00255 GC box V$GC_01| 698 - 711 - ccaccccaccgccc 6.25 GC_box|M00255 GC box V$GC_01| 701 - 714 - ccccaccgcccaac 7.26 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: Hist1h4a_M_musculus.fasta (1 sequences, 1000 bp, 55.1% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score TATA_box|M00252 TATA V$TATA_01| 3.1 GC_box|M00255 GC box V$GC_01| 2.89 TBP|M00713 TBP F$TBP_Q6| 2.21 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 0.982 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.836 E2F|M00516 E2F V$E2F_03| 0.831 HEX|Hexamer| 0.674 HiNF-D|HiNF-D| 0.394 IRF-1|M00747 IRF1| 0.318 Oct-1|M00138 V$OCT1_04 Oct-1| -0.511 NEG|Negative element| -0.732 IRF-7|M00453 V$IRF7_01 IRF-7| -0.774 AACCCT_box|AACCCT S. pombe| -2.54 SPT10|Spt10p| -3.19 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >Hist1h4a_M_musculus mm6_dna range=chr13:23241035-23242034 NM_178192 NP_835499 - TATA_box|M00252 TATA V$TATA_01| 39 - 53 - gtcggtcctttatat 8.09 TATA_box|M00252 TATA V$TATA_01| 41 - 55 - cggtcctttatatag 10.5 TBP|M00713 TBP F$TBP_Q6| 45 - 53 + cctttatat 9.44 TATA_box|M00252 TATA V$TATA_01| 46 - 60 + ctttatatagctgct 7.05 TBP|M00713 TBP F$TBP_Q6| 47 - 55 + tttatatag 7.41 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 57 - 68 - tgcttggccttg 7.24 IRF-1|M00747 IRF1| 82 - 88 - aacagaa 6.12 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 134 - 144 + ccgccaataag 7.82 E2F|M00516 E2F V$E2F_03| 146 - 157 - cctggcgggaaa 7.47 HiNF-D|HiNF-D| 160 - 175 + accgaaagcgcccggg 7.28 E2F|M00516 E2F V$E2F_03| 171 - 182 - ccgggcgggaaa 6.63 GC_box|M00255 GC box V$GC_01| 193 - 206 - aaatccctcccatc 6.44 GC_box|M00255 GC box V$GC_01| 206 - 219 - caaccatgccccga 6.2 GC_box|M00255 GC box V$GC_01| 248 - 261 - aaaccccgcccctc 9.69 E2F|M00516 E2F V$E2F_03| 320 - 331 - catgccgggaaa 6.49 HEX|Hexamer| 359 - 364 + gacttc 6.89 GC_box|M00255 GC box V$GC_01| 367 - 380 - aaattccgcccctc 7.68 IRF-1|M00747 IRF1| 410 - 416 - aagtgat 6.16 GC_box|M00255 GC box V$GC_01| 435 - 448 - cagccccgccccga 9.59 TBP|M00713 TBP F$TBP_Q6| 501 - 509 - ctataagga 6.83 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 580 - 590 + cagacaatcag 7.77 TATA_box|M00252 TATA V$TATA_01| 668 - 682 - ctagggaatatatag 7.22 TBP|M00713 TBP F$TBP_Q6| 675 - 683 - atatatagg 7.5 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 748 - 759 - cctttggttaat 7.86 GC_box|M00255 GC box V$GC_01| 784 - 797 - caattacgccctct 6.4 HEX|Hexamer| 961 - 966 - gaagtc 6.64 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: Hist1h4b_M_musculus.fasta (1 sequences, 1000 bp, 36.3% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score TATA_box|M00252 TATA V$TATA_01| 0.989 GC_box|M00255 GC box V$GC_01| 0.843 E2F|M00516 E2F V$E2F_03| 0.196 IRF-1|M00747 IRF1| 0.196 TBP|M00713 TBP F$TBP_Q6| 0.0118 IRF-7|M00453 V$IRF7_01 IRF-7| -0.0419 HEX|Hexamer| -0.133 Oct-1|M00138 V$OCT1_04 Oct-1| -0.51 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -1.08 HiNF-D|HiNF-D| -1.13 NEG|Negative element| -1.14 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.63 SPT10|Spt10p| -3.64 AACCCT_box|AACCCT S. pombe| -3.67 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >Hist1h4b_M_musculus mm6_dna range=chr13:23235900-23236899 NM_178193 NP_835500 + GC_box|M00255 GC box V$GC_01| 8 - 21 - ccgcaccacctaca 7.44 GC_box|M00255 GC box V$GC_01| 29 - 42 - ggacccttccctca 7.33 IRF-1|M00747 IRF1| 85 - 91 + ttcattt 6.31 TATA_box|M00252 TATA V$TATA_01| 282 - 296 + gtataaagggggaac 8.48 IRF-7|M00453 V$IRF7_01 IRF-7| 290 - 307 + ggggaacaggaaaatgac 6.62 E2F|M00516 E2F V$E2F_03| 394 - 405 + tttcccgctcta 7.53 IRF-1|M00747 IRF1| 566 - 572 + ttctctt 6.81 IRF-7|M00453 V$IRF7_01 IRF-7| 590 - 607 - gtatctttcacatttgaa 6.51 TBP|M00713 TBP F$TBP_Q6| 755 - 763 + tccttatag 6.26 GC_box|M00255 GC box V$GC_01| 893 - 906 - ggtccccgcccact 6.37 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: Hist1h4c_M_musculus.fasta (1 sequences, 1000 bp, 42% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score GC_box|M00255 GC box V$GC_01| 3.57 IRF-7|M00453 V$IRF7_01 IRF-7| 1.66 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1.3 HiNF-D|HiNF-D| 0.846 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 0.544 TATA_box|M00252 TATA V$TATA_01| 0.441 IRF-1|M00747 IRF1| 0.119 HEX|Hexamer| -0.0272 TBP|M00713 TBP F$TBP_Q6| -0.0639 Oct-1|M00138 V$OCT1_04 Oct-1| -0.45 NEG|Negative element| -1.11 AACCCT_box|AACCCT S. pombe| -2.37 E2F|M00516 E2F V$E2F_03| -2.48 SPT10|Spt10p| -2.8 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >Hist1h4c_M_musculus mm6_dna range=chr13:23178327-23179326 NM_178208 NP_835515 - TATA_box|M00252 TATA V$TATA_01| 28 - 42 - cgtccctttaaatag 6.8 TATA_box|M00252 TATA V$TATA_01| 33 - 47 + ctttaaataggcctt 6.12 GC_box|M00255 GC box V$GC_01| 74 - 87 + gttaggcggggttt 8.2 IRF-7|M00453 V$IRF7_01 IRF-7| 133 - 150 + ttggaatctgaatgtttt 7.89 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 149 - 159 - ttcattggcta 8.02 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 150 - 161 - tcattggctagc 8.82 HiNF-D|HiNF-D| 163 - 178 - agccccagctattctt 6.45 GC_box|M00255 GC box V$GC_01| 231 - 244 - tccctcctccccac 6.67 IRF-7|M00453 V$IRF7_01 IRF-7| 506 - 523 - gcaaacttcatattccct 8.64 IRF-1|M00747 IRF1| 687 - 693 - aagagaa 6.9 GC_box|M00255 GC box V$GC_01| 817 - 830 - gacccccgcccccc 11.1 HiNF-D|HiNF-D| 817 - 832 - gacccccgcccccctt 7.88 TATA_box|M00252 TATA V$TATA_01| 825 - 839 - cccccctttttaaaa 6.96 IRF-7|M00453 V$IRF7_01 IRF-7| 886 - 903 - ttgattttggcattccaa 7.08 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: Hist1h4d_M_musculus.fasta (1 sequences, 1000 bp, 39.5% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score GC_box|M00255 GC box V$GC_01| 1.73 SPT10|Spt10p| 1.34 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1.15 TATA_box|M00252 TATA V$TATA_01| 1.1 HiNF-D|HiNF-D| 0.839 Oct-1|M00138 V$OCT1_04 Oct-1| 0.0288 HEX|Hexamer| -0.112 TBP|M00713 TBP F$TBP_Q6| -0.262 NEG|Negative element| -0.335 IRF-1|M00747 IRF1| -0.495 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.13 IRF-7|M00453 V$IRF7_01 IRF-7| -1.22 AACCCT_box|AACCCT S. pombe| -1.42 E2F|M00516 E2F V$E2F_03| -1.68 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >Hist1h4d_M_musculus mm6_dna range=chr13:23060481-23061480 NM_175654 NP_783585 + GC_box|M00255 GC box V$GC_01| 105 - 118 + gtgaggtgggggtg 8.75 TATA_box|M00252 TATA V$TATA_01| 243 - 257 + acataaagagcagcc 6.25 SPT10|Spt10p| 272 - 292 + ctgttcccagagctcctgatg 8.91 NEG|Negative element| 411 - 425 + tgaatgctaaaaaaa 6.1 Oct-1|M00138 V$OCT1_04 Oct-1| 640 - 662 + gaattgtaatgtaaatatctgaa 6.84 TATA_box|M00252 TATA V$TATA_01| 676 - 690 - tgtcccgatttatag 7.43 GC_box|M00255 GC box V$GC_01| 821 - 834 - aggacccgccttgt 8.29 HiNF-D|HiNF-D| 858 - 873 + aacgccagaagggcgg 7.09 AACCCT_box|AACCCT S. pombe| 884 - 906 + tggttcacgcccccttcccttca 6.11 HiNF-D|HiNF-D| 889 - 904 - cacgcccccttccctt 6.98 TATA_box|M00252 TATA V$TATA_01| 933 - 947 + ttataaaagccagga 8.1 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 964 - 975 - tcactggctagt 8.66 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: Hist1h4f_M_musculus.fasta (1 sequences, 1000 bp, 42.1% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 2.69 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1.31 TATA_box|M00252 TATA V$TATA_01| 0.591 HiNF-D|HiNF-D| 0.359 Oct-1|M00138 V$OCT1_04 Oct-1| 0.255 TBP|M00713 TBP F$TBP_Q6| 0.00702 IRF-1|M00747 IRF1| -0.154 GC_box|M00255 GC box V$GC_01| -0.358 IRF-7|M00453 V$IRF7_01 IRF-7| -0.389 HEX|Hexamer| -0.408 E2F|M00516 E2F V$E2F_03| -0.696 AACCCT_box|AACCCT S. pombe| -0.896 NEG|Negative element| -1.41 SPT10|Spt10p| -2.96 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >Hist1h4f_M_musculus mm6_dna range=chr13:23031712-23032711 NM_175655 NP_783586 - TATA_box|M00252 TATA V$TATA_01| 44 - 58 - agctggtatatatat 6.49 TATA_box|M00252 TATA V$TATA_01| 49 - 63 + gtatatatatggcga 7.34 TBP|M00713 TBP F$TBP_Q6| 50 - 58 + tatatatat 6.21 TBP|M00713 TBP F$TBP_Q6| 51 - 59 - atatatatg 6.22 TATA_box|M00252 TATA V$TATA_01| 51 - 65 + atatatatggcgaat 6.31 E2F|M00516 E2F V$E2F_03| 93 - 104 - gcgggcgggaag 6.51 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 129 - 139 - ctcactggctg 10.3 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 130 - 141 - tcactggctgaa 8 GC_box|M00255 GC box V$GC_01| 159 - 172 - aggcacagcccctg 6.29 IRF-1|M00747 IRF1| 201 - 207 + ttctctt 6.44 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 282 - 293 + cccagccactca 8.33 Oct-1|M00138 V$OCT1_04 Oct-1| 373 - 395 + gaagatttacgaaaatgtaactt 6.48 Oct-1|M00138 V$OCT1_04 Oct-1| 379 - 401 + ttacgaaaatgtaacttctaaaa 6.05 IRF-7|M00453 V$IRF7_01 IRF-7| 380 - 397 + tacgaaaatgtaacttct 6.21 HiNF-D|HiNF-D| 562 - 577 - agccctggctgtcctg 6.08 Oct-1|M00138 V$OCT1_04 Oct-1| 637 - 659 - tctaatctttttaataaacgcta 6.12 AACCCT_box|AACCCT S. pombe| 946 - 968 + gtcctcaccccactcactctgta 6.58 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: Hist1h4h_M_musculus.fasta (1 sequences, 1000 bp, 41.7% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score GC_box|M00255 GC box V$GC_01| 4.27 IRF-1|M00747 IRF1| 0.303 HEX|Hexamer| 0.294 HiNF-D|HiNF-D| 0.142 IRF-7|M00453 V$IRF7_01 IRF-7| 0.0593 Oct-1|M00138 V$OCT1_04 Oct-1| -0.431 TBP|M00713 TBP F$TBP_Q6| -0.474 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.53 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -0.585 NEG|Negative element| -0.897 TATA_box|M00252 TATA V$TATA_01| -1.51 E2F|M00516 E2F V$E2F_03| -1.76 SPT10|Spt10p| -2.87 AACCCT_box|AACCCT S. pombe| -3.79 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >Hist1h4h_M_musculus mm6_dna range=chr13:23010116-23011115 NM_153173 NP_694813 + IRF-1|M00747 IRF1| 175 - 181 - aagagaa 6.45 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 505 - 515 + tcgctaatgag 6.85 IRF-1|M00747 IRF1| 519 - 525 - aagagaa 6.45 IRF-7|M00453 V$IRF7_01 IRF-7| 520 - 537 + agagaaagcaaaatttgg 7.26 Oct-1|M00138 V$OCT1_04 Oct-1| 546 - 568 - agtaaacattaacatactagtaa 6.02 HEX|Hexamer| 867 - 872 - gaagtc 6.68 HiNF-D|HiNF-D| 944 - 959 + catgccaggggcgggg 6.25 GC_box|M00255 GC box V$GC_01| 949 - 962 + caggggcggggcca 11.9 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: Hist1h4j_M_musculus.fasta (1 sequences, 1000 bp, 49.1% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score TATA_box|M00252 TATA V$TATA_01| 2.42 IRF-1|M00747 IRF1| 0.921 HiNF-D|HiNF-D| 0.651 Oct-1|M00138 V$OCT1_04 Oct-1| 0.598 TBP|M00713 TBP F$TBP_Q6| 0.168 HEX|Hexamer| 0.0524 IRF-7|M00453 V$IRF7_01 IRF-7| -0.0755 GC_box|M00255 GC box V$GC_01| -0.511 NEG|Negative element| -1.18 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.31 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -1.47 E2F|M00516 E2F V$E2F_03| -1.5 SPT10|Spt10p| -3.17 AACCCT_box|AACCCT S. pombe| -3.25 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >Hist1h4j_M_musculus mm6_dna range=chr13:21214162-21215161 NM_178210 NP_835582 + IRF-7|M00453 V$IRF7_01 IRF-7| 86 - 103 - caagaattcagttccccc 6.65 IRF-1|M00747 IRF1| 92 - 98 + ttcagtt 7.6 IRF-1|M00747 IRF1| 492 - 498 - aactgaa 7.35 Oct-1|M00138 V$OCT1_04 Oct-1| 507 - 529 + aaaggtttctataaattcttata 6.24 Oct-1|M00138 V$OCT1_04 Oct-1| 514 - 536 - tctataaattcttataaacatat 6.36 Oct-1|M00138 V$OCT1_04 Oct-1| 520 - 542 - aattcttataaacatattaaaat 7.1 TBP|M00713 TBP F$TBP_Q6| 522 - 530 + ttcttataa 6.24 IRF-1|M00747 IRF1| 844 - 850 + ttctttt 6.53 GC_box|M00255 GC box V$GC_01| 893 - 906 - cgcctcctccctgc 6.46 TBP|M00713 TBP F$TBP_Q6| 935 - 943 - gtataaaaa 6.07 TATA_box|M00252 TATA V$TATA_01| 935 - 949 + gtataaaaagacggc 9.97 HiNF-D|HiNF-D| 965 - 980 - cagcatctctgttctg 7.15 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: Hist1h4k_M_musculus.fasta (1 sequences, 1000 bp, 40% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score TATA_box|M00252 TATA V$TATA_01| 3.04 HiNF-D|HiNF-D| 2.58 IRF-1|M00747 IRF1| 0.81 HEX|Hexamer| 0.202 TBP|M00713 TBP F$TBP_Q6| 0.011 GC_box|M00255 GC box V$GC_01| -0.162 E2F|M00516 E2F V$E2F_03| -0.383 Oct-1|M00138 V$OCT1_04 Oct-1| -0.519 NEG|Negative element| -0.665 IRF-7|M00453 V$IRF7_01 IRF-7| -1.29 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -1.46 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.6 SPT10|Spt10p| -1.92 AACCCT_box|AACCCT S. pombe| -3.61 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >Hist1h4k_M_musculus mm6_dna range=chr13:21230570-21231569 NM_178211 NP_835583 - HiNF-D|HiNF-D| 21 - 36 + cagaacagagatgctg 7.41 HiNF-D|HiNF-D| 43 - 58 + agcctgagcgccgcct 6.27 TATA_box|M00252 TATA V$TATA_01| 52 - 66 - gccgcctttttatac 10.6 E2F|M00516 E2F V$E2F_03| 67 - 78 + tgcggcgggcgg 6.48 GC_box|M00255 GC box V$GC_01| 70 - 83 + ggcgggcggaccga 6.32 GC_box|M00255 GC box V$GC_01| 95 - 108 + gcagggaagaggcg 6.09 HiNF-D|HiNF-D| 96 - 111 + cagggaagaggcggga 9.23 HiNF-D|HiNF-D| 118 - 133 + gcccgcagctgtgggg 7.27 HiNF-D|HiNF-D| 118 - 133 - gcccgcagctgtgggg 9.12 HiNF-D|HiNF-D| 274 - 289 + aagccaagcggcccct 6.87 IRF-1|M00747 IRF1| 498 - 504 + ttctctt 6.49 IRF-1|M00747 IRF1| 592 - 598 - aagtgaa 7.9 HEX|Hexamer| 773 - 778 - gaagtc 6.89 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: Hist1h4m.1_M_musculus.fasta (1 sequences, 1000 bp, 51% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score TATA_box|M00252 TATA V$TATA_01| 1.77 GC_box|M00255 GC box V$GC_01| 1.25 IRF-1|M00747 IRF1| 0.399 TBP|M00713 TBP F$TBP_Q6| 0.267 HiNF-D|HiNF-D| 0.145 AACCCT_box|AACCCT S. pombe| -0.131 HEX|Hexamer| -0.24 NEG|Negative element| -0.894 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.03 Oct-1|M00138 V$OCT1_04 Oct-1| -1.04 SPT10|Spt10p| -1.44 E2F|M00516 E2F V$E2F_03| -1.78 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -1.92 IRF-7|M00453 V$IRF7_01 IRF-7| -2.61 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >Hist1h4m.1_M_musculus mm6_dna range=chr13:21292158-21293157 NM_175657 NP_783588 - GC_box|M00255 GC box V$GC_01| 230 - 243 + aggaggcagagctc 7.76 HiNF-D|HiNF-D| 233 - 248 + aggcagagctcaggcg 6.32 GC_box|M00255 GC box V$GC_01| 273 - 286 - ccgtcccacccctg 6.73 GC_box|M00255 GC box V$GC_01| 279 - 292 - cacccctgcctcct 7.67 IRF-1|M00747 IRF1| 419 - 425 + ttcagtt 7.7 GC_box|M00255 GC box V$GC_01| 720 - 733 - gtacccctccccta 6.44 AACCCT_box|AACCCT S. pombe| 867 - 889 + tgctccccagccctagccctata 7.26 TBP|M00713 TBP F$TBP_Q6| 885 - 893 - ctataaaaa 7.48 TATA_box|M00252 TATA V$TATA_01| 885 - 899 + ctataaaaagggtac 9.34 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: Hist1h4m.2_M_musculus.fasta (1 sequences, 1000 bp, 45.1% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score GC_box|M00255 GC box V$GC_01| 2.5 TBP|M00713 TBP F$TBP_Q6| 1.4 TATA_box|M00252 TATA V$TATA_01| 1.22 IRF-1|M00747 IRF1| 0.814 HiNF-D|HiNF-D| -0.0635 HEX|Hexamer| -0.171 Oct-1|M00138 V$OCT1_04 Oct-1| -0.402 NEG|Negative element| -1.09 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -1.22 IRF-7|M00453 V$IRF7_01 IRF-7| -1.68 SPT10|Spt10p| -2.09 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.15 E2F|M00516 E2F V$E2F_03| -2.2 AACCCT_box|AACCCT S. pombe| -2.79 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >Hist1h4m.2_M_musculus mm6_dna range=chr13:21312223-21313222 NM_175657 NP_783588 - TATA_box|M00252 TATA V$TATA_01| 58 - 72 - cggcccctcttatag 8.42 TBP|M00713 TBP F$TBP_Q6| 64 - 72 + ctcttatag 6.26 GC_box|M00255 GC box V$GC_01| 112 - 125 + agtgggtgtggccg 9.02 GC_box|M00255 GC box V$GC_01| 124 - 137 + cgggggaagggctt 9.2 TATA_box|M00252 TATA V$TATA_01| 154 - 168 - aataggtttttatat 6.48 TBP|M00713 TBP F$TBP_Q6| 160 - 168 + tttttatat 8.07 GC_box|M00255 GC box V$GC_01| 510 - 523 + gggaggcaggggca 6.8 GC_box|M00255 GC box V$GC_01| 516 - 529 + caggggcaggggca 7.68 GC_box|M00255 GC box V$GC_01| 522 - 535 + caggggcaggggca 7.68 IRF-1|M00747 IRF1| 719 - 725 + ttcattt 6.88 TBP|M00713 TBP F$TBP_Q6| 721 - 729 + catttatat 8.05 IRF-1|M00747 IRF1| 845 - 851 + ttcagtt 7.28 TATA_box|M00252 TATA V$TATA_01| 852 - 866 + ctttaaaagacactg 6.42 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: Hist2h2aa1.1_M_musculus.fasta (1 sequences, 1000 bp, 45.4% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 2.34 TATA_box|M00252 TATA V$TATA_01| 1.44 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1.06 HiNF-D|HiNF-D| 0.969 TBP|M00713 TBP F$TBP_Q6| 0.896 Oct-1|M00138 V$OCT1_04 Oct-1| 0.491 IRF-1|M00747 IRF1| 0.128 NEG|Negative element| 0.089 E2F|M00516 E2F V$E2F_03| -0.365 HEX|Hexamer| -0.408 SPT10|Spt10p| -0.53 IRF-7|M00453 V$IRF7_01 IRF-7| -0.708 GC_box|M00255 GC box V$GC_01| -1.92 AACCCT_box|AACCCT S. pombe| -3.67 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >Hist2h2aa1.1_M_musculus mm6_dna range=chr3:95728126-95729125 NM_013549 NP_038577 - TATA_box|M00252 TATA V$TATA_01| 18 - 32 - ctcacccttttatag 8.91 TBP|M00713 TBP F$TBP_Q6| 24 - 32 + cttttatag 6.45 HiNF-D|HiNF-D| 51 - 66 - gcccgacgctctcatt 6.6 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 61 - 71 - ctcattggctc 9.9 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 62 - 73 - tcattggctcac 7.28 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 88 - 99 + cgtggccaatag 8.3 HiNF-D|HiNF-D| 95 - 110 + aataggagcgcgcgga 6.14 HiNF-D|HiNF-D| 147 - 162 - ccccggcgccgccctg 7.39 E2F|M00516 E2F V$E2F_03| 163 - 174 - gaacgcgcgaat 6.68 IRF-1|M00747 IRF1| 197 - 203 + ttcattt 6.39 SPT10|Spt10p| 250 - 270 + gcttgctcgctgtttctcctg 6.91 IRF-1|M00747 IRF1| 447 - 453 + ttcattt 6.39 NEG|Negative element| 449 - 463 - cattttaagcgttta 7.28 TBP|M00713 TBP F$TBP_Q6| 494 - 502 - atttaaagg 6.31 Oct-1|M00138 V$OCT1_04 Oct-1| 831 - 853 - tcgatgcattagaatcactgatt 6.38 TBP|M00713 TBP F$TBP_Q6| 919 - 927 + tctttatat 7.71 Oct-1|M00138 V$OCT1_04 Oct-1| 920 - 942 - ctttatattttacattgttacat 6.4 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: Hist2h2aa1.2_M_musculus.fasta (1 sequences, 1000 bp, 48.3% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 2.2 HiNF-D|HiNF-D| 1.38 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1.12 TATA_box|M00252 TATA V$TATA_01| 0.555 IRF-1|M00747 IRF1| 0.512 HEX|Hexamer| 0.357 Oct-1|M00138 V$OCT1_04 Oct-1| 0.284 TBP|M00713 TBP F$TBP_Q6| 0.262 SPT10|Spt10p| -0.415 NEG|Negative element| -0.448 E2F|M00516 E2F V$E2F_03| -0.461 IRF-7|M00453 V$IRF7_01 IRF-7| -0.682 GC_box|M00255 GC box V$GC_01| -1.32 AACCCT_box|AACCCT S. pombe| -4.36 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >Hist2h2aa1.2_M_musculus mm6_dna range=chr3:95732372-95733371 NM_013549 NP_038577 + HEX|Hexamer| 155 - 160 + gacttc 6.88 TBP|M00713 TBP F$TBP_Q6| 188 - 196 + ctcttaaat 6.03 IRF-7|M00453 V$IRF7_01 IRF-7| 230 - 247 + atgtaaactgaaaactgc 6.26 IRF-1|M00747 IRF1| 235 - 241 - aactgaa 6.99 Oct-1|M00138 V$OCT1_04 Oct-1| 370 - 392 + atatattaacactaattttatgt 6.88 NEG|Negative element| 375 - 389 + ttaacactaatttta 6.09 HEX|Hexamer| 470 - 475 + gatttc 6.11 IRF-1|M00747 IRF1| 495 - 501 - aagagaa 6.38 HiNF-D|HiNF-D| 701 - 716 - taccggctctattcct 8.27 SPT10|Spt10p| 731 - 751 - caggagaaacagcgagcaggc 7.11 IRF-1|M00747 IRF1| 798 - 804 - aaatgaa 6.52 E2F|M00516 E2F V$E2F_03| 827 - 838 + attcgcgcgttc 6.68 HiNF-D|HiNF-D| 839 - 854 + cagggcggcgccgggg 6.59 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 902 - 913 - ctattggccacg 8.2 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 928 - 939 + gtgagccaatga 7.23 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 930 - 940 + gagccaatgag 9.74 HiNF-D|HiNF-D| 935 - 950 + aatgagagcgtcgggc 6.35 TATA_box|M00252 TATA V$TATA_01| 969 - 983 + ctataaaagagtgag 7.83 TBP|M00713 TBP F$TBP_Q6| 969 - 977 - ctataaaag 6.61 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: Hist2h2ac_Hist2h2bb_M_musculus.fasta (1 sequences, 278 bp, 45% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score Oct-1|M00138 V$OCT1_04 Oct-1| 2.04 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1.47 TATA_box|M00252 TATA V$TATA_01| 1.02 HEX|Hexamer| 1.01 GC_box|M00255 GC box V$GC_01| 0.978 TBP|M00713 TBP F$TBP_Q6| 0.886 IRF-7|M00453 V$IRF7_01 IRF-7| 0.556 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 0.11 NEG|Negative element| 0.0522 HiNF-D|HiNF-D| -0.735 IRF-1|M00747 IRF1| -0.959 E2F|M00516 E2F V$E2F_03| -1.37 AACCCT_box|AACCCT S. pombe| -1.92 SPT10|Spt10p| -4.6 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >Hist2h2ac_Hist2h2bb_M_musculus NM_175662-NM_175666 mm6_dna range=chr3:95708677-95708954 NM_175662 NM_175666 TATA_box|M00252 TATA V$TATA_01| 66 - 80 - ctaaggcctttatag 6.99 TBP|M00713 TBP F$TBP_Q6| 72 - 80 + cctttatag 6.95 GC_box|M00255 GC box V$GC_01| 88 - 101 + taggggtggggtga 7.22 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 113 - 123 - ttcattggtgg 6.16 HEX|Hexamer| 139 - 144 - gaagtc 6.62 IRF-7|M00453 V$IRF7_01 IRF-7| 147 - 164 + atgaaatctgaaatttta 6.23 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 194 - 205 + atgggccaatgg 7.64 Oct-1|M00138 V$OCT1_04 Oct-1| 194 - 216 + atgggccaatggaaattaaaagt 8.15 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: Hist2h2bb_M_musculus.fasta (1 sequences, 594 bp, 44.6% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score GC_box|M00255 GC box V$GC_01| 3.89 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 3.06 IRF-7|M00453 V$IRF7_01 IRF-7| 0.479 NEG|Negative element| 0.0782 TBP|M00713 TBP F$TBP_Q6| 0.0188 IRF-1|M00747 IRF1| -0.132 HiNF-D|HiNF-D| -0.271 Oct-1|M00138 V$OCT1_04 Oct-1| -0.417 HEX|Hexamer| -0.43 TATA_box|M00252 TATA V$TATA_01| -0.6 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.917 AACCCT_box|AACCCT S. pombe| -2.31 E2F|M00516 E2F V$E2F_03| -2.76 SPT10|Spt10p| -4.05 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >Hist2h2bb_M_musculus mm6_dna range=chr3:95756940-95757533 NM_175666 NP_783597 + GC_box|M00255 GC box V$GC_01| 102 - 115 - caaatacgccctca 6.05 HiNF-D|HiNF-D| 353 - 368 + aagaacagctgaggca 6.07 IRF-7|M00453 V$IRF7_01 IRF-7| 396 - 413 + catgaaatggaaggctgc 7.17 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 413 - 424 - cgattggctaga 10.1 GC_box|M00255 GC box V$GC_01| 476 - 489 - aggctccgcctcct 10.9 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 510 - 521 + atcaaccaataa 6.78 Oct-1|M00138 V$OCT1_04 Oct-1| 539 - 561 - aaacctcatttgcatacaagctc 6.06 TBP|M00713 TBP F$TBP_Q6| 561 - 569 - ctataagta 6.42 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: Hist2h3b_M_musculus.fasta (1 sequences, 1000 bp, 43.2% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 1.62 NEG|Negative element| 0.898 IRF-1|M00747 IRF1| 0.866 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.847 HEX|Hexamer| 0.435 TBP|M00713 TBP F$TBP_Q6| 0.315 TATA_box|M00252 TATA V$TATA_01| 0.254 Oct-1|M00138 V$OCT1_04 Oct-1| -0.231 GC_box|M00255 GC box V$GC_01| -0.628 SPT10|Spt10p| -0.74 HiNF-D|HiNF-D| -1.05 IRF-7|M00453 V$IRF7_01 IRF-7| -1.11 E2F|M00516 E2F V$E2F_03| -2.65 AACCCT_box|AACCCT S. pombe| -5.47 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >Hist2h3b_M_musculus mm6_dna range=chr3:95755528-95756527 NM_178215 NP_835587 + GC_box|M00255 GC box V$GC_01| 83 - 96 - ggcccacgccttta 6.28 TATA_box|M00252 TATA V$TATA_01| 86 - 100 - ccacgcctttaatcc 6.23 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 240 - 250 - ctcatttgctt 9.03 TATA_box|M00252 TATA V$TATA_01| 318 - 332 - aggcggtattaatac 6.58 IRF-1|M00747 IRF1| 347 - 353 + ttctgtt 6.94 TBP|M00713 TBP F$TBP_Q6| 354 - 362 - atataaaca 6.5 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 379 - 390 - taattggccgtt 6.22 Oct-1|M00138 V$OCT1_04 Oct-1| 535 - 557 - cctttcactatacatcgttttgt 6.18 SPT10|Spt10p| 581 - 601 - cgttcaaatcactgggcacaa 6.12 NEG|Negative element| 616 - 630 + taaatgctaactgtc 8.18 IRF-1|M00747 IRF1| 665 - 671 - aagtgaa 7.3 IRF-1|M00747 IRF1| 773 - 779 - aactgaa 6.82 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 888 - 899 + tctacccaatca 8.02 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 890 - 900 + tacccaatcag 7.22 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 928 - 939 + tgggcccaatca 6.48 TBP|M00713 TBP F$TBP_Q6| 954 - 962 - ctataagta 6.29 HEX|Hexamer| 986 - 991 - gaagtc 6.56 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: Hist2h3c1.1_M_musculus.fasta (1 sequences, 692 bp, 64.9% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score GC_box|M00255 GC box V$GC_01| 1.63 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1.16 SPT10|Spt10p| 0.986 NEG|Negative element| 0.443 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 0.0767 HiNF-D|HiNF-D| -0.0241 AACCCT_box|AACCCT S. pombe| -0.0293 IRF-1|M00747 IRF1| -0.109 HEX|Hexamer| -0.357 Oct-1|M00138 V$OCT1_04 Oct-1| -0.638 TBP|M00713 TBP F$TBP_Q6| -1.74 E2F|M00516 E2F V$E2F_03| -1.78 TATA_box|M00252 TATA V$TATA_01| -2.8 IRF-7|M00453 V$IRF7_01 IRF-7| -2.93 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >Hist2h3c1.1_M_musculus mm6_dna range=chr3:95726909-95727600 NM_178216 NP_835734 - Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 31 - 41 - cccattggctc 6.89 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 32 - 43 - ccattggctcgg 7.9 GC_box|M00255 GC box V$GC_01| 58 - 71 - ctgacccgccccca 6.85 IRF-1|M00747 IRF1| 102 - 108 + tccactt 6.62 GC_box|M00255 GC box V$GC_01| 121 - 134 + cgagggtggagcca 6.08 GC_box|M00255 GC box V$GC_01| 153 - 166 + agagggcgggtccc 6.45 GC_box|M00255 GC box V$GC_01| 324 - 337 - cacctcctcctcct 7.46 Oct-1|M00138 V$OCT1_04 Oct-1| 384 - 406 - tgtctagattggcctagacgtcc 6.45 AACCCT_box|AACCCT S. pombe| 452 - 474 - gtgagggacagtgttgtgtagga 7.16 NEG|Negative element| 491 - 505 + taggggctaaatgct 7.4 SPT10|Spt10p| 493 - 513 - ggggctaaatgcttgggacgg 8.19 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 552 - 563 + atgaaccaaaga 7.19 GC_box|M00255 GC box V$GC_01| 639 - 652 + ttggggcagggcca 7.43 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: Hist2h3c1.2_M_musculus.fasta (1 sequences, 685 bp, 65.4% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score GC_box|M00255 GC box V$GC_01| 1.56 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1.2 SPT10|Spt10p| 1.05 NEG|Negative element| 0.531 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 0.113 AACCCT_box|AACCCT S. pombe| 0.107 HiNF-D|HiNF-D| -0.00594 IRF-1|M00747 IRF1| -0.06 HEX|Hexamer| -0.332 Oct-1|M00138 V$OCT1_04 Oct-1| -0.499 TBP|M00713 TBP F$TBP_Q6| -1.62 E2F|M00516 E2F V$E2F_03| -1.79 TATA_box|M00252 TATA V$TATA_01| -2.68 IRF-7|M00453 V$IRF7_01 IRF-7| -2.77 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >Hist2h3c1.2_M_musculus mm6_dna range=chr3:95733900-95734584 NM_178216 NP_835734 + GC_box|M00255 GC box V$GC_01| 38 - 51 - tggccctgccccaa 7.43 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 123 - 134 - tctttggttcat 7.22 SPT10|Spt10p| 173 - 193 + ccgtcccaagcatttagcccc 8.24 NEG|Negative element| 181 - 195 - agcatttagccccta 7.49 AACCCT_box|AACCCT S. pombe| 212 - 234 + tcctacacaacactgtccctcac 7.28 Oct-1|M00138 V$OCT1_04 Oct-1| 280 - 302 + ggacgtctaggccaatctagaca 6.58 GC_box|M00255 GC box V$GC_01| 349 - 362 + aggaggaggaggtg 7.49 GC_box|M00255 GC box V$GC_01| 520 - 533 - gggacccgccctct 6.41 GC_box|M00255 GC box V$GC_01| 552 - 565 - tggctccaccctcg 6.05 IRF-1|M00747 IRF1| 578 - 584 - aagtgga 6.68 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 643 - 654 + ccgagccaatgg 7.93 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 645 - 655 + gagccaatggg 6.92 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: Hist2h3c2_M_musculus.fasta (1 sequences, 601 bp, 64.6% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score GC_box|M00255 GC box V$GC_01| 1.82 SPT10|Spt10p| 0.988 NEG|Negative element| 0.5 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 0.203 IRF-1|M00747 IRF1| 0.0478 HiNF-D|HiNF-D| -0.027 AACCCT_box|AACCCT S. pombe| -0.101 HEX|Hexamer| -0.329 Oct-1|M00138 V$OCT1_04 Oct-1| -0.499 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.963 TBP|M00713 TBP F$TBP_Q6| -1.6 E2F|M00516 E2F V$E2F_03| -1.69 TATA_box|M00252 TATA V$TATA_01| -2.68 IRF-7|M00453 V$IRF7_01 IRF-7| -2.78 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >Hist2h3c2_M_musculus mm6_dna range=chr3:95726960-95727560 NM_054045 NP_473386 - GC_box|M00255 GC box V$GC_01| 7 - 20 - ctgacccgccccca 7 IRF-1|M00747 IRF1| 51 - 57 + tccactt 6.68 GC_box|M00255 GC box V$GC_01| 102 - 115 + agagggcgggtccc 6.4 GC_box|M00255 GC box V$GC_01| 273 - 286 - cacctcctcctcct 7.67 Oct-1|M00138 V$OCT1_04 Oct-1| 333 - 355 - tgtctagattggcctagacgtcc 6.45 AACCCT_box|AACCCT S. pombe| 401 - 423 - gtgagggacagtgttgtgtagga 6.94 NEG|Negative element| 440 - 454 + taggggctaaatgct 7.31 SPT10|Spt10p| 442 - 462 - ggggctaaatgcttgggacgg 8.04 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 501 - 512 + atgaaccaaaga 7.08 GC_box|M00255 GC box V$GC_01| 588 - 601 + ttggggcagggcca 7.36 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: Hist2h4_M_musculus.fasta (1 sequences, 1000 bp, 46.5% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-7|M00453 V$IRF7_01 IRF-7| 2.01 IRF-1|M00747 IRF1| 1.7 HiNF-D|HiNF-D| 1.07 GC_box|M00255 GC box V$GC_01| 0.653 TBP|M00713 TBP F$TBP_Q6| 0.428 HEX|Hexamer| 0.194 NEG|Negative element| 0.0686 TATA_box|M00252 TATA V$TATA_01| -0.554 Oct-1|M00138 V$OCT1_04 Oct-1| -0.565 E2F|M00516 E2F V$E2F_03| -1.02 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.74 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -2.01 SPT10|Spt10p| -2.48 AACCCT_box|AACCCT S. pombe| -2.63 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >Hist2h4_M_musculus mm6_dna range=chr3:95751166-95752165 NM_033596 NP_291074 - GC_box|M00255 GC box V$GC_01| 9 - 22 + tggaggtggagtgc 6.44 TBP|M00713 TBP F$TBP_Q6| 28 - 36 - atatatgag 6.03 IRF-7|M00453 V$IRF7_01 IRF-7| 51 - 68 + ttgaaaactgaaagcgcg 8.59 IRF-1|M00747 IRF1| 56 - 62 - aactgaa 7.43 HiNF-D|HiNF-D| 57 - 72 + actgaaagcgcgcggg 6.81 IRF-1|M00747 IRF1| 131 - 137 + ttctctt 6.85 TBP|M00713 TBP F$TBP_Q6| 171 - 179 + cctttattt 6.05 TBP|M00713 TBP F$TBP_Q6| 179 - 187 + tttttattt 6.23 IRF-7|M00453 V$IRF7_01 IRF-7| 181 - 198 - tttattttcgattttctt 8.14 HEX|Hexamer| 211 - 216 - gaagtc 6.74 IRF-7|M00453 V$IRF7_01 IRF-7| 221 - 238 - ggagaattcagattcctc 8.03 NEG|Negative element| 277 - 291 + ctgacgctaaaaaga 7.25 IRF-7|M00453 V$IRF7_01 IRF-7| 301 - 318 + ggagaaagagaaagttag 7.05 IRF-1|M00747 IRF1| 306 - 312 - aagagaa 7.19 HiNF-D|HiNF-D| 349 - 364 - gcccggagctcctgtt 7.91 GC_box|M00255 GC box V$GC_01| 653 - 666 - gaggcccgcccttt 7.84 IRF-1|M00747 IRF1| 670 - 676 + ttcagtt 7.22 IRF-7|M00453 V$IRF7_01 IRF-7| 706 - 723 - ctaaaattcactttttca 7.08 IRF-1|M00747 IRF1| 712 - 718 + ttcactt 7.87 IRF-1|M00747 IRF1| 758 - 764 - aaatgaa 7.07 TATA_box|M00252 TATA V$TATA_01| 867 - 881 - gacttgtttttaaag 6.27 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: Hist3h2ba_M_musculus.fasta (1 sequences, 1000 bp, 44.6% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 2.44 GC_box|M00255 GC box V$GC_01| 2.26 IRF-7|M00453 V$IRF7_01 IRF-7| 1.42 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1.2 TBP|M00713 TBP F$TBP_Q6| 1.14 IRF-1|M00747 IRF1| 0.421 HiNF-D|HiNF-D| 0.276 E2F|M00516 E2F V$E2F_03| 0.247 HEX|Hexamer| 0.227 Oct-1|M00138 V$OCT1_04 Oct-1| 0.0868 TATA_box|M00252 TATA V$TATA_01| 0.000126 NEG|Negative element| -0.426 SPT10|Spt10p| -2.51 AACCCT_box|AACCCT S. pombe| -4.42 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >Hist3h2ba_M_musculus mm6_dna range=chr11:58673542-58674541 NM_030082 NP_084358 + TATA_box|M00252 TATA V$TATA_01| 251 - 265 - agtttgcttttataa 6.71 TBP|M00713 TBP F$TBP_Q6| 257 - 265 + cttttataa 6.05 TBP|M00713 TBP F$TBP_Q6| 317 - 325 + tttttattt 6.83 GC_box|M00255 GC box V$GC_01| 341 - 354 + cgggggcagggcag 9.5 GC_box|M00255 GC box V$GC_01| 346 - 359 + gcagggcagggcgg 8.27 GC_box|M00255 GC box V$GC_01| 351 - 364 + gcagggcggaggga 6.25 HiNF-D|HiNF-D| 376 - 391 + agcgcgcgcgcgcgag 6.36 E2F|M00516 E2F V$E2F_03| 381 - 392 - gcgcgcgcgaga 7.44 IRF-1|M00747 IRF1| 497 - 503 - aaatgaa 6.44 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 506 - 517 + tctacccagtca 6.11 IRF-7|M00453 V$IRF7_01 IRF-7| 543 - 560 - tttgctttcagatttccc 7.1 HEX|Hexamer| 626 - 631 - gaagtc 6.67 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 675 - 685 - ctcattagctg 9.93 IRF-7|M00453 V$IRF7_01 IRF-7| 845 - 862 - tacactttcggattggtt 8.7 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 853 - 863 - cggattggttg 7.44 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 854 - 865 - ggattggttggg 7.28 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 868 - 879 + actgtccaatag 6.25 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 919 - 930 + tttgtccaatca 8.28 Oct-1|M00138 V$OCT1_04 Oct-1| 946 - 968 + gagccttcatttaaatataaaga 6.62 IRF-1|M00747 IRF1| 951 - 957 + ttcattt 7.12 TBP|M00713 TBP F$TBP_Q6| 953 - 961 + catttaaat 6.13 TBP|M00713 TBP F$TBP_Q6| 954 - 962 - atttaaata 6.24 TBP|M00713 TBP F$TBP_Q6| 960 - 968 - atataaaga 7.73 GC_box|M00255 GC box V$GC_01| 976 - 989 - taaccctgccttca 6.86 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: Hist3h2bb_Hist3h2a_M_musculus.fasta (1 sequences, 174 bp, 44.8% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score Oct-1|M00138 V$OCT1_04 Oct-1| 3.8 TBP|M00713 TBP F$TBP_Q6| 2.47 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1.45 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 1.25 TATA_box|M00252 TATA V$TATA_01| 1.23 HEX|Hexamer| 0.41 IRF-7|M00453 V$IRF7_01 IRF-7| -0.534 IRF-1|M00747 IRF1| -0.57 E2F|M00516 E2F V$E2F_03| -0.906 HiNF-D|HiNF-D| -0.96 GC_box|M00255 GC box V$GC_01| -1.09 NEG|Negative element| -1.94 SPT10|Spt10p| -2.83 AACCCT_box|AACCCT S. pombe| -4.26 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >Hist3h2bb_Hist3h2a_M_musculus NM_206882-NM_178218 mm6_dna range=chr11:58680142-58680315 NM_206882 NM_178218 Oct-1|M00138 V$OCT1_04 Oct-1| 41 - 63 + gcggggtaaggcatatgcaaatt 6.91 Oct-1|M00138 V$OCT1_04 Oct-1| 47 - 69 + taaggcatatgcaaattaggaag 9.42 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 85 - 95 - ctgattggttc 6.57 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 86 - 97 - tgattggttctt 7.07 TBP|M00713 TBP F$TBP_Q6| 142 - 150 - atatataag 6.83 TATA_box|M00252 TATA V$TATA_01| 142 - 156 + atatataagagcttg 6.74 TBP|M00713 TBP F$TBP_Q6| 144 - 152 - atataagag 7.89 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: Hist4h4_M_musculus.fasta (1 sequences, 1000 bp, 42.8% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score GC_box|M00255 GC box V$GC_01| 3.5 IRF-1|M00747 IRF1| 0.381 HEX|Hexamer| 0.296 IRF-7|M00453 V$IRF7_01 IRF-7| 0.233 Oct-1|M00138 V$OCT1_04 Oct-1| 0.175 TATA_box|M00252 TATA V$TATA_01| 0.0883 HiNF-D|HiNF-D| -0.095 TBP|M00713 TBP F$TBP_Q6| -0.195 NEG|Negative element| -0.963 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -0.971 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -1.31 E2F|M00516 E2F V$E2F_03| -2.09 SPT10|Spt10p| -2.59 AACCCT_box|AACCCT S. pombe| -3.75 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >Hist4h4_M_musculus mm6_dna range=chr6:137576176-137577175 NM_175652 NP_783583 - GC_box|M00255 GC box V$GC_01| 104 - 117 + agtgggcggagctc 10.6 GC_box|M00255 GC box V$GC_01| 119 - 132 - agactccaccccct 9.95 IRF-7|M00453 V$IRF7_01 IRF-7| 169 - 186 - aaccctttcggttccctc 6.3 TBP|M00713 TBP F$TBP_Q6| 272 - 280 - aaataaaaa 6.18 TATA_box|M00252 TATA V$TATA_01| 272 - 286 + aaataaaaacggcgc 6.76 Oct-1|M00138 V$OCT1_04 Oct-1| 354 - 376 + actttaatgtgaaaatgaaaaga 7.12 IRF-1|M00747 IRF1| 366 - 372 - aaatgaa 6.82 HiNF-D|HiNF-D| 731 - 746 + gccaagagctggggcc 6.3 GC_box|M00255 GC box V$GC_01| 777 - 790 - cccctcctccccac 7.33 HEX|Hexamer| 813 - 818 - gaagtc 6.83 IRF-7|M00453 V$IRF7_01 IRF-7| 937 - 954 - cctgagttcaaattccag 6.83 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: his-10_H4_his-9_H3_C_elegans.fasta (1 sequences, 274 bp, 44.5% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score GC_box|M00255 GC box V$GC_01| 3.17 TBP|M00713 TBP F$TBP_Q6| 2.4 TATA_box|M00252 TATA V$TATA_01| 2.3 HiNF-D|HiNF-D| 1.08 IRF-1|M00747 IRF1| 0.47 HEX|Hexamer| 0.124 NEG|Negative element| -0.338 Oct-1|M00138 V$OCT1_04 Oct-1| -1.3 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.7 IRF-7|M00453 V$IRF7_01 IRF-7| -2.16 SPT10|Spt10p| -2.85 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -2.93 E2F|M00516 E2F V$E2F_03| -4.7 AACCCT_box|AACCCT S. pombe| -5.03 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >his-10_H4_his-9_H3_C_elegans ref|NC_003280.3|:13823272-13823545 Caenorhabditis elegans chromosome II, complete sequence TATA_box|M00252 TATA V$TATA_01| 53 - 67 - gccttctttatatac 8.24 TBP|M00713 TBP F$TBP_Q6| 57 - 65 + tctttatat 7.98 GC_box|M00255 GC box V$GC_01| 86 - 99 + ggtgggaagaggtg 8.83 HiNF-D|HiNF-D| 87 - 102 + gtgggaagaggtggag 7.12 GC_box|M00255 GC box V$GC_01| 92 - 105 + aagaggtggagtca 8.58 TBP|M00713 TBP F$TBP_Q6| 209 - 217 - atataaaag 7.89 TATA_box|M00252 TATA V$TATA_01| 209 - 223 + atataaaagaaacga 6.77 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: his-12_H2A_his-11_H2B_C_elegans.fasta (1 sequences, 229 bp, 45.4% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-1|M00747 IRF1| 0.582 TBP|M00713 TBP F$TBP_Q6| 0.446 GC_box|M00255 GC box V$GC_01| 0.154 HEX|Hexamer| -0.321 HiNF-D|HiNF-D| -0.514 TATA_box|M00252 TATA V$TATA_01| -0.527 NEG|Negative element| -0.881 SPT10|Spt10p| -0.938 Oct-1|M00138 V$OCT1_04 Oct-1| -0.956 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.11 E2F|M00516 E2F V$E2F_03| -1.87 IRF-7|M00453 V$IRF7_01 IRF-7| -2.26 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -2.37 AACCCT_box|AACCCT S. pombe| -4.2 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >his-12_H2A_his-11_H2B_C_elegans ref|NC_003280.3|:13821478-13821706 Caenorhabditis elegans chromosome II, complete sequence GC_box|M00255 GC box V$GC_01| 142 - 155 - tgactcctccttcc 6.05 IRF-1|M00747 IRF1| 174 - 180 - aagagaa 6.49 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: his-14_H4_his-13_H3_C_elegans.fasta (1 sequences, 274 bp, 44.5% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score GC_box|M00255 GC box V$GC_01| 3.17 TBP|M00713 TBP F$TBP_Q6| 2.4 TATA_box|M00252 TATA V$TATA_01| 2.3 HiNF-D|HiNF-D| 1.08 IRF-1|M00747 IRF1| 0.47 HEX|Hexamer| 0.124 NEG|Negative element| -0.338 Oct-1|M00138 V$OCT1_04 Oct-1| -1.3 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.7 IRF-7|M00453 V$IRF7_01 IRF-7| -2.16 SPT10|Spt10p| -2.85 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -2.93 E2F|M00516 E2F V$E2F_03| -4.7 AACCCT_box|AACCCT S. pombe| -5.03 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >his-14_H4_his-13_H3_C_elegans ref|NC_003280.3|:13819834-13820107 Caenorhabditis elegans chromosome II, complete sequence TATA_box|M00252 TATA V$TATA_01| 53 - 67 - gccttctttatatac 8.24 TBP|M00713 TBP F$TBP_Q6| 57 - 65 + tctttatat 7.98 GC_box|M00255 GC box V$GC_01| 86 - 99 + ggtgggaagaggtg 8.83 HiNF-D|HiNF-D| 87 - 102 + gtgggaagaggtggag 7.12 GC_box|M00255 GC box V$GC_01| 92 - 105 + aagaggtggagtca 8.58 TBP|M00713 TBP F$TBP_Q6| 209 - 217 - atataaaag 7.89 TATA_box|M00252 TATA V$TATA_01| 209 - 223 + atataaaagaaacga 6.77 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: his-16_H2A_his-15_H2B_C_elegans.fasta (1 sequences, 229 bp, 45.4% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-1|M00747 IRF1| 0.582 TBP|M00713 TBP F$TBP_Q6| 0.446 GC_box|M00255 GC box V$GC_01| 0.154 HEX|Hexamer| -0.321 HiNF-D|HiNF-D| -0.514 TATA_box|M00252 TATA V$TATA_01| -0.527 NEG|Negative element| -0.881 SPT10|Spt10p| -0.938 Oct-1|M00138 V$OCT1_04 Oct-1| -0.956 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.11 E2F|M00516 E2F V$E2F_03| -1.87 IRF-7|M00453 V$IRF7_01 IRF-7| -2.26 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -2.37 AACCCT_box|AACCCT S. pombe| -4.2 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >his-16_H2A_his-15_H2B_C_elegans ref|NC_003280.3|:13818040-13818268 Caenorhabditis elegans chromosome II, complete sequence GC_box|M00255 GC box V$GC_01| 142 - 155 - tgactcctccttcc 6.05 IRF-1|M00747 IRF1| 174 - 180 - aagagaa 6.49 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: his-17_H3_his-18_H4_C_elegans.fasta (1 sequences, 237 bp, 43.9% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-7|M00453 V$IRF7_01 IRF-7| 3.61 TATA_box|M00252 TATA V$TATA_01| 3.19 SPT10|Spt10p| 2.26 IRF-1|M00747 IRF1| 0.493 TBP|M00713 TBP F$TBP_Q6| 0.469 HiNF-D|HiNF-D| 0.242 HEX|Hexamer| -0.128 NEG|Negative element| -0.395 AACCCT_box|AACCCT S. pombe| -0.873 Oct-1|M00138 V$OCT1_04 Oct-1| -0.903 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.38 GC_box|M00255 GC box V$GC_01| -3 E2F|M00516 E2F V$E2F_03| -4.01 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -4.22 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >his-17_H3_his-18_H4_C_elegans ref|NC_003283.4|:8900579-8900815 Caenorhabditis elegans chromosome V, complete sequence TATA_box|M00252 TATA V$TATA_01| 45 - 59 - acactgcatttatac 8.49 TBP|M00713 TBP F$TBP_Q6| 51 - 59 + catttatac 6 SPT10|Spt10p| 133 - 153 + gtgtccccgcagtgtctcctc 8.33 TATA_box|M00252 TATA V$TATA_01| 171 - 185 + gtataaaagggacag 8.68 IRF-7|M00453 V$IRF7_01 IRF-7| 186 - 203 - ccaactgtccatttcttc 9.68 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: his-20_H2B_his-19_H2A_C_elegans.fasta (1 sequences, 294 bp, 45.2% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score CCAAT_box|M00254 V$CAAT_01 CCAAT box| 4.21 GC_box|M00255 GC box V$GC_01| 2.57 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 1.08 TATA_box|M00252 TATA V$TATA_01| 0.748 HiNF-D|HiNF-D| 0.37 TBP|M00713 TBP F$TBP_Q6| 0.0476 IRF-1|M00747 IRF1| -0.448 HEX|Hexamer| -0.741 Oct-1|M00138 V$OCT1_04 Oct-1| -1.24 NEG|Negative element| -1.35 E2F|M00516 E2F V$E2F_03| -1.88 SPT10|Spt10p| -2.27 IRF-7|M00453 V$IRF7_01 IRF-7| -3.08 AACCCT_box|AACCCT S. pombe| -3.57 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >his-20_H2B_his-19_H2A_C_elegans ref|NC_003283.4|:8898059-8898352 Caenorhabditis elegans chromosome V, complete sequence CCAAT_box|M00254 V$CAAT_01 CCAAT box| 8 - 19 - tgattggactgg 7.38 GC_box|M00255 GC box V$GC_01| 80 - 93 + ggaaggaggagcct 8.86 HiNF-D|HiNF-D| 216 - 231 - caccgcagctgtgttt 6.51 TATA_box|M00252 TATA V$TATA_01| 228 - 242 + gtttaaaagggtgct 6.92 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 277 - 288 + accaaccaatca 10.5 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 279 - 289 + caaccaatcat 7.4 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: his-21_H2A_his-22_H2B_C_elegans.fasta (1 sequences, 294 bp, 45.2% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score CCAAT_box|M00254 V$CAAT_01 CCAAT box| 4.21 GC_box|M00255 GC box V$GC_01| 2.57 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 1.08 TATA_box|M00252 TATA V$TATA_01| 0.748 HiNF-D|HiNF-D| 0.37 TBP|M00713 TBP F$TBP_Q6| 0.0476 IRF-1|M00747 IRF1| -0.448 HEX|Hexamer| -0.741 Oct-1|M00138 V$OCT1_04 Oct-1| -1.24 NEG|Negative element| -1.35 E2F|M00516 E2F V$E2F_03| -1.88 SPT10|Spt10p| -2.27 IRF-7|M00453 V$IRF7_01 IRF-7| -3.08 AACCCT_box|AACCCT S. pombe| -3.57 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >his-21_H2A_his-22_H2B_C_elegans ref|NC_003283.4|:8894853-8895146 Caenorhabditis elegans chromosome V, complete sequence Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 6 - 16 - atgattggttg 7.4 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 7 - 18 - tgattggttggt 10.5 TATA_box|M00252 TATA V$TATA_01| 53 - 67 - agcacccttttaaac 6.92 HiNF-D|HiNF-D| 64 - 79 + aaacacagctgcggtg 6.51 GC_box|M00255 GC box V$GC_01| 202 - 215 - aggctcctccttcc 8.86 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 276 - 287 + ccagtccaatca 7.38 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: his-25_H3_his-26_H4_C_elegans.fasta (1 sequences, 274 bp, 44.5% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score GC_box|M00255 GC box V$GC_01| 3.17 TBP|M00713 TBP F$TBP_Q6| 2.4 TATA_box|M00252 TATA V$TATA_01| 2.3 HiNF-D|HiNF-D| 1.08 IRF-1|M00747 IRF1| 0.47 HEX|Hexamer| 0.124 NEG|Negative element| -0.338 Oct-1|M00138 V$OCT1_04 Oct-1| -1.3 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.7 IRF-7|M00453 V$IRF7_01 IRF-7| -2.16 SPT10|Spt10p| -2.85 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -2.93 E2F|M00516 E2F V$E2F_03| -4.7 AACCCT_box|AACCCT S. pombe| -5.03 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >his-25_H3_his-26_H4_C_elegans ref|NC_003280.3|:13825156-13825429 Caenorhabditis elegans chromosome II, complete sequence TATA_box|M00252 TATA V$TATA_01| 52 - 66 - tcgtttcttttatat 6.77 TBP|M00713 TBP F$TBP_Q6| 58 - 66 + cttttatat 7.89 GC_box|M00255 GC box V$GC_01| 170 - 183 - tgactccacctctt 8.58 HiNF-D|HiNF-D| 173 - 188 - ctccacctcttcccac 7.12 GC_box|M00255 GC box V$GC_01| 176 - 189 - cacctcttcccacc 8.83 TATA_box|M00252 TATA V$TATA_01| 208 - 222 + gtatataaagaaggc 8.24 TBP|M00713 TBP F$TBP_Q6| 210 - 218 - atataaaga 7.98 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: his-28_H4_his-27_H3_C_elegans.fasta (1 sequences, 240 bp, 43.3% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-7|M00453 V$IRF7_01 IRF-7| 3.7 TATA_box|M00252 TATA V$TATA_01| 3.12 SPT10|Spt10p| 2.47 IRF-1|M00747 IRF1| 0.518 TBP|M00713 TBP F$TBP_Q6| 0.432 HiNF-D|HiNF-D| 0.363 HEX|Hexamer| -0.101 NEG|Negative element| -0.325 Oct-1|M00138 V$OCT1_04 Oct-1| -0.626 AACCCT_box|AACCCT S. pombe| -0.795 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.34 GC_box|M00255 GC box V$GC_01| -2.94 E2F|M00516 E2F V$E2F_03| -3.95 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -4.17 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >his-28_H4_his-27_H3_C_elegans ref|NC_003283.4|:8892386-8892625 Caenorhabditis elegans chromosome V, complete sequence IRF-7|M00453 V$IRF7_01 IRF-7| 38 - 55 + gaagaaatggacagttgg 9.79 TATA_box|M00252 TATA V$TATA_01| 56 - 70 - ctgtcccttttatac 8.59 SPT10|Spt10p| 88 - 108 - gaggagacactgcggggacac 8.55 TATA_box|M00252 TATA V$TATA_01| 182 - 196 + gtataaatgcagtgt 8.48 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: his-29_H2B_his-30_H2A_C_elegans.fasta (1 sequences, 255 bp, 44.3% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score GC_box|M00255 GC box V$GC_01| 3.5 TATA_box|M00252 TATA V$TATA_01| 0.956 TBP|M00713 TBP F$TBP_Q6| 0.866 HEX|Hexamer| -0.074 HiNF-D|HiNF-D| -0.557 Oct-1|M00138 V$OCT1_04 Oct-1| -0.655 IRF-1|M00747 IRF1| -0.816 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.03 NEG|Negative element| -1.44 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -2.55 E2F|M00516 E2F V$E2F_03| -3.52 IRF-7|M00453 V$IRF7_01 IRF-7| -3.68 SPT10|Spt10p| -4.46 AACCCT_box|AACCCT S. pombe| -4.83 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >his-29_H2B_his-30_H2A_C_elegans ref|NC_003282.3|:8331394-8331648 Caenorhabditis elegans chromosome IV, complete sequence TATA_box|M00252 TATA V$TATA_01| 24 - 38 + gtataaagaaatggg 6.27 TBP|M00713 TBP F$TBP_Q6| 51 - 59 + ttattatat 6.42 GC_box|M00255 GC box V$GC_01| 75 - 88 + ggaaggcggagtct 8.38 GC_box|M00255 GC box V$GC_01| 163 - 176 - aagaccctccccca 9.35 TATA_box|M00252 TATA V$TATA_01| 194 - 208 + acataaaaaggggtc 6.28 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: his-2_H3_his-1_H4_C_elegans.fasta (1 sequences, 238 bp, 47.9% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score TATA_box|M00252 TATA V$TATA_01| 3.64 TBP|M00713 TBP F$TBP_Q6| 0.962 HEX|Hexamer| 0.401 IRF-7|M00453 V$IRF7_01 IRF-7| 0.225 IRF-1|M00747 IRF1| 0.111 HiNF-D|HiNF-D| -0.0209 Oct-1|M00138 V$OCT1_04 Oct-1| -0.399 SPT10|Spt10p| -0.833 NEG|Negative element| -0.964 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.61 GC_box|M00255 GC box V$GC_01| -1.65 E2F|M00516 E2F V$E2F_03| -2.78 AACCCT_box|AACCCT S. pombe| -3.33 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -3.92 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >his-2_H3_his-1_H4_C_elegans ref|NC_003283.4|:16044866-16045103 Caenorhabditis elegans chromosome V, complete sequence TATA_box|M00252 TATA V$TATA_01| 45 - 59 - acactgcatttatac 8.93 TBP|M00713 TBP F$TBP_Q6| 51 - 59 + catttatac 6.46 TATA_box|M00252 TATA V$TATA_01| 171 - 185 + gtataaaaggggcag 9.15 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: his-31_H4_his-32_H3_C_elegans.fasta (1 sequences, 316 bp, 43% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score TATA_box|M00252 TATA V$TATA_01| 3.63 IRF-1|M00747 IRF1| 0.896 TBP|M00713 TBP F$TBP_Q6| 0.111 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 0.0208 HEX|Hexamer| -0.0469 HiNF-D|HiNF-D| -0.266 Oct-1|M00138 V$OCT1_04 Oct-1| -0.377 GC_box|M00255 GC box V$GC_01| -1.16 IRF-7|M00453 V$IRF7_01 IRF-7| -1.62 NEG|Negative element| -2.05 SPT10|Spt10p| -2.86 AACCCT_box|AACCCT S. pombe| -3.09 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -3.14 E2F|M00516 E2F V$E2F_03| -4.25 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >his-31_H4_his-32_H3_C_elegans ref|NC_003282.3|:8333965-8334280 Caenorhabditis elegans chromosome IV, complete sequence IRF-1|M00747 IRF1| 42 - 48 - aaatgaa 6.79 TATA_box|M00252 TATA V$TATA_01| 56 - 70 - ggctgtcttttatac 8.75 TATA_box|M00252 TATA V$TATA_01| 261 - 275 + gtataaaaggggaca 9.71 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: his-33_H2A_his-34_H2B_C_elegans.fasta (1 sequences, 255 bp, 44.3% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score GC_box|M00255 GC box V$GC_01| 3.5 TATA_box|M00252 TATA V$TATA_01| 0.956 TBP|M00713 TBP F$TBP_Q6| 0.866 HEX|Hexamer| -0.074 HiNF-D|HiNF-D| -0.557 Oct-1|M00138 V$OCT1_04 Oct-1| -0.655 IRF-1|M00747 IRF1| -0.816 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.03 NEG|Negative element| -1.44 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -2.55 E2F|M00516 E2F V$E2F_03| -3.52 IRF-7|M00453 V$IRF7_01 IRF-7| -3.68 SPT10|Spt10p| -4.46 AACCCT_box|AACCCT S. pombe| -4.83 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >his-33_H2A_his-34_H2B_C_elegans ref|NC_003282.3|:8335700-8335954 Caenorhabditis elegans chromosome IV, complete sequence TATA_box|M00252 TATA V$TATA_01| 48 - 62 - gacccctttttatgt 6.28 GC_box|M00255 GC box V$GC_01| 80 - 93 + tgggggagggtctt 9.35 GC_box|M00255 GC box V$GC_01| 168 - 181 - agactccgccttcc 8.38 TBP|M00713 TBP F$TBP_Q6| 197 - 205 - atataataa 6.42 TATA_box|M00252 TATA V$TATA_01| 218 - 232 - cccatttctttatac 6.27 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: his-43_H2A_his-42_H3_C_elegans.fasta (1 sequences, 579 bp, 34% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-1|M00747 IRF1| 0.765 HEX|Hexamer| 0.275 HiNF-D|HiNF-D| 0.148 Oct-1|M00138 V$OCT1_04 Oct-1| -0.0406 NEG|Negative element| -0.806 IRF-7|M00453 V$IRF7_01 IRF-7| -0.83 TBP|M00713 TBP F$TBP_Q6| -0.835 TATA_box|M00252 TATA V$TATA_01| -1.33 E2F|M00516 E2F V$E2F_03| -1.53 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -2.14 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.14 GC_box|M00255 GC box V$GC_01| -2.6 SPT10|Spt10p| -2.63 AACCCT_box|AACCCT S. pombe| -4.99 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >his-43_H2A_his-42_H3_C_elegans ref|NC_003280.3|:13827606-13828184 Caenorhabditis elegans chromosome II, complete sequence IRF-1|M00747 IRF1| 73 - 79 - aactgaa 6.71 IRF-1|M00747 IRF1| 126 - 132 - aactgaa 6.71 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: his-46_H4_his-45_H3_C_elegans.fasta (1 sequences, 229 bp, 48.9% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-1|M00747 IRF1| 0.987 HiNF-D|HiNF-D| 0.819 GC_box|M00255 GC box V$GC_01| 0.729 HEX|Hexamer| 0.563 TATA_box|M00252 TATA V$TATA_01| -0.761 IRF-7|M00453 V$IRF7_01 IRF-7| -1.06 SPT10|Spt10p| -1.29 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.64 Oct-1|M00138 V$OCT1_04 Oct-1| -1.71 TBP|M00713 TBP F$TBP_Q6| -1.98 NEG|Negative element| -2.39 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -3.11 E2F|M00516 E2F V$E2F_03| -3.16 AACCCT_box|AACCCT S. pombe| -5.07 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >his-46_H4_his-45_H3_C_elegans ref|NC_003282.3|:11326300-11326528 Caenorhabditis elegans chromosome IV, complete sequence GC_box|M00255 GC box V$GC_01| 78 - 91 + gctaggcggagtca 6.15 IRF-1|M00747 IRF1| 218 - 224 + ttctctt 6.72 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: his-47_H2A_his-48_H2B_C_elegans.fasta (1 sequences, 303 bp, 45.9% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score GC_box|M00255 GC box V$GC_01| 5.41 IRF-7|M00453 V$IRF7_01 IRF-7| 1.99 Oct-1|M00138 V$OCT1_04 Oct-1| 0.895 TBP|M00713 TBP F$TBP_Q6| 0.883 HiNF-D|HiNF-D| 0.619 IRF-1|M00747 IRF1| 0.584 E2F|M00516 E2F V$E2F_03| 0.291 TATA_box|M00252 TATA V$TATA_01| 0.144 HEX|Hexamer| -0.645 NEG|Negative element| -1.2 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.93 SPT10|Spt10p| -3.23 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -3.46 AACCCT_box|AACCCT S. pombe| -5.34 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >his-47_H2A_his-48_H2B_C_elegans ref|NC_003282.3|:11324410-11324712 Caenorhabditis elegans chromosome IV, complete sequence IRF-7|M00453 V$IRF7_01 IRF-7| 24 - 41 + gacgaatctgaagaatga 8.16 IRF-7|M00453 V$IRF7_01 IRF-7| 36 - 53 + gaatgaatcgaaactgtc 6.37 TBP|M00713 TBP F$TBP_Q6| 54 - 62 + tgtttatat 6.68 IRF-1|M00747 IRF1| 62 - 68 + ttcattt 6.09 HiNF-D|HiNF-D| 72 - 87 + cggtggaggggcggag 6.24 GC_box|M00255 GC box V$GC_01| 77 - 90 + gaggggcggagttt 11.2 E2F|M00516 E2F V$E2F_03| 213 - 224 - ccccgcgggaag 6.53 GC_box|M00255 GC box V$GC_01| 222 - 235 - aagctccgcccctc 10.9 Oct-1|M00138 V$OCT1_04 Oct-1| 238 - 260 - ccgcagtttttacataaataggt 6.52 TATA_box|M00252 TATA V$TATA_01| 249 - 263 + acataaataggtgtc 6.21 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: his-4_H2B_his-3_H2A_C_elegans.fasta (1 sequences, 226 bp, 48.2% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score GC_box|M00255 GC box V$GC_01| 2.76 TATA_box|M00252 TATA V$TATA_01| 0.892 TBP|M00713 TBP F$TBP_Q6| 0.632 HEX|Hexamer| -0.529 HiNF-D|HiNF-D| -0.834 NEG|Negative element| -0.969 IRF-1|M00747 IRF1| -1.09 SPT10|Spt10p| -1.37 Oct-1|M00138 V$OCT1_04 Oct-1| -1.52 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -1.88 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.99 E2F|M00516 E2F V$E2F_03| -2.01 IRF-7|M00453 V$IRF7_01 IRF-7| -2.91 AACCCT_box|AACCCT S. pombe| -7.46 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >his-4_H2B_his-3_H2A_C_elegans ref|NC_003283.4|:16043152-16043377 Caenorhabditis elegans chromosome V, complete sequence GC_box|M00255 GC box V$GC_01| 26 - 39 + ggaaggaggagcct 8.78 TATA_box|M00252 TATA V$TATA_01| 174 - 188 + gtttaaaagagtgtg 6.88 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: his-50_H4_his-49_H3_C_elegans.fasta (1 sequences, 240 bp, 43.3% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-7|M00453 V$IRF7_01 IRF-7| 3.7 TATA_box|M00252 TATA V$TATA_01| 3.12 SPT10|Spt10p| 2.47 IRF-1|M00747 IRF1| 0.518 TBP|M00713 TBP F$TBP_Q6| 0.432 HiNF-D|HiNF-D| 0.363 HEX|Hexamer| -0.101 NEG|Negative element| -0.325 Oct-1|M00138 V$OCT1_04 Oct-1| -0.626 AACCCT_box|AACCCT S. pombe| -0.795 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.34 GC_box|M00255 GC box V$GC_01| -2.94 E2F|M00516 E2F V$E2F_03| -3.95 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -4.17 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >his-50_H4_his-49_H3_C_elegans ref|NC_003283.4|:8850291-8850530 Caenorhabditis elegans chromosome V, complete sequence IRF-7|M00453 V$IRF7_01 IRF-7| 38 - 55 + gaagaaatggacagttgg 9.79 TATA_box|M00252 TATA V$TATA_01| 56 - 70 - ctgtcccttttatac 8.59 SPT10|Spt10p| 88 - 108 - gaggagacactgcggggacac 8.55 TATA_box|M00252 TATA V$TATA_01| 182 - 196 + gtataaatgcagtgt 8.48 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: his-51_H2A_his-52_H2B_C_elegans.fasta (1 sequences, 240 bp, 45% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score CCAAT_box|M00254 V$CAAT_01 CCAAT box| 3.77 GC_box|M00255 GC box V$GC_01| 3.56 TATA_box|M00252 TATA V$TATA_01| 1.46 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 0.792 HiNF-D|HiNF-D| 0.573 TBP|M00713 TBP F$TBP_Q6| 0.126 IRF-1|M00747 IRF1| -0.494 HEX|Hexamer| -0.717 E2F|M00516 E2F V$E2F_03| -1.26 NEG|Negative element| -1.4 Oct-1|M00138 V$OCT1_04 Oct-1| -1.61 SPT10|Spt10p| -2.73 IRF-7|M00453 V$IRF7_01 IRF-7| -3.28 AACCCT_box|AACCCT S. pombe| -6.74 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >his-51_H2A_his-52_H2B_C_elegans ref|NC_003283.4|:8852758-8852997 Caenorhabditis elegans chromosome V, complete sequence Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 6 - 16 - atgattggttg 6.9 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 7 - 18 - tgattggttggt 9.9 TATA_box|M00252 TATA V$TATA_01| 53 - 67 - agcacccttttaaac 7.51 HiNF-D|HiNF-D| 64 - 79 + aaacacagctgcggtg 6.52 GC_box|M00255 GC box V$GC_01| 202 - 215 - aggctcctccttcc 9.65 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: his-54_H2B_his-53_H2A_C_elegans.fasta (1 sequences, 240 bp, 45% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score CCAAT_box|M00254 V$CAAT_01 CCAAT box| 3.77 GC_box|M00255 GC box V$GC_01| 3.56 TATA_box|M00252 TATA V$TATA_01| 1.46 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 0.792 HiNF-D|HiNF-D| 0.573 TBP|M00713 TBP F$TBP_Q6| 0.126 IRF-1|M00747 IRF1| -0.494 HEX|Hexamer| -0.717 E2F|M00516 E2F V$E2F_03| -1.26 NEG|Negative element| -1.4 Oct-1|M00138 V$OCT1_04 Oct-1| -1.61 SPT10|Spt10p| -2.73 IRF-7|M00453 V$IRF7_01 IRF-7| -3.28 AACCCT_box|AACCCT S. pombe| -6.74 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >his-54_H2B_his-53_H2A_C_elegans ref|NC_003283.4|:8856018-8856257 Caenorhabditis elegans chromosome V, complete sequence GC_box|M00255 GC box V$GC_01| 26 - 39 + ggaaggaggagcct 9.65 HiNF-D|HiNF-D| 162 - 177 - caccgcagctgtgttt 6.52 TATA_box|M00252 TATA V$TATA_01| 174 - 188 + gtttaaaagggtgct 7.51 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 223 - 234 + accaaccaatca 9.9 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 225 - 235 + caaccaatcat 6.9 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: his-55_H3_his-56_H4_C_elegans.fasta (1 sequences, 260 bp, 48.5% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-1|M00747 IRF1| 0.933 HiNF-D|HiNF-D| 0.7 GC_box|M00255 GC box V$GC_01| 0.588 HEX|Hexamer| 0.462 IRF-7|M00453 V$IRF7_01 IRF-7| -1.05 TATA_box|M00252 TATA V$TATA_01| -1.14 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.35 Oct-1|M00138 V$OCT1_04 Oct-1| -1.45 SPT10|Spt10p| -1.63 TBP|M00713 TBP F$TBP_Q6| -1.7 NEG|Negative element| -1.89 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -3.07 E2F|M00516 E2F V$E2F_03| -3.24 AACCCT_box|AACCCT S. pombe| -5.2 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >his-55_H3_his-56_H4_C_elegans ref|NC_003282.3|:11338234-11338493 Caenorhabditis elegans chromosome IV, complete sequence IRF-1|M00747 IRF1| 37 - 43 - aagagaa 6.81 GC_box|M00255 GC box V$GC_01| 170 - 183 - tgactccgcctagc 6.35 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: his-58_H2B_his-57_H2A_C_elegans.fasta (1 sequences, 307 bp, 45.6% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score GC_box|M00255 GC box V$GC_01| 5.44 IRF-7|M00453 V$IRF7_01 IRF-7| 1.92 TBP|M00713 TBP F$TBP_Q6| 0.842 Oct-1|M00138 V$OCT1_04 Oct-1| 0.842 HiNF-D|HiNF-D| 0.684 IRF-1|M00747 IRF1| 0.582 E2F|M00516 E2F V$E2F_03| 0.312 TATA_box|M00252 TATA V$TATA_01| 0.0922 HEX|Hexamer| -0.662 NEG|Negative element| -1.2 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.93 SPT10|Spt10p| -3.2 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -3.46 AACCCT_box|AACCCT S. pombe| -5.32 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >his-58_H2B_his-57_H2A_C_elegans ref|NC_003282.3|:11340077-11340383 Caenorhabditis elegans chromosome IV, complete sequence TATA_box|M00252 TATA V$TATA_01| 45 - 59 - gacacctatttatgt 6.16 Oct-1|M00138 V$OCT1_04 Oct-1| 48 - 70 + acctatttatgtaaaaactgcgg 6.48 GC_box|M00255 GC box V$GC_01| 73 - 86 + gaggggcggagctt 10.9 E2F|M00516 E2F V$E2F_03| 84 - 95 + cttcccgcgggg 6.56 GC_box|M00255 GC box V$GC_01| 218 - 231 - aaactccgcccctc 11.3 HiNF-D|HiNF-D| 221 - 236 - ctccgcccctccaccg 6.35 IRF-1|M00747 IRF1| 240 - 246 - aaatgaa 6.09 TBP|M00713 TBP F$TBP_Q6| 246 - 254 - atataaaca 6.68 IRF-7|M00453 V$IRF7_01 IRF-7| 255 - 272 - gacagtttcgattcattc 6.32 IRF-7|M00453 V$IRF7_01 IRF-7| 267 - 284 - tcattcttcagattcgtc 8.1 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: his-63_H3_his-64_H4_C_elegans.fasta (1 sequences, 256 bp, 48% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score GC_box|M00255 GC box V$GC_01| 1.81 IRF-1|M00747 IRF1| 0.425 Oct-1|M00138 V$OCT1_04 Oct-1| 0.00427 HEX|Hexamer| -0.0244 HiNF-D|HiNF-D| -0.283 TATA_box|M00252 TATA V$TATA_01| -0.919 TBP|M00713 TBP F$TBP_Q6| -1.34 SPT10|Spt10p| -1.73 IRF-7|M00453 V$IRF7_01 IRF-7| -1.76 NEG|Negative element| -2.01 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.41 E2F|M00516 E2F V$E2F_03| -2.79 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -3.68 AACCCT_box|AACCCT S. pombe| -5.31 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >his-63_H3_his-64_H4_C_elegans ref|NC_003282.3|:11406832-11407087 Caenorhabditis elegans chromosome IV, complete sequence GC_box|M00255 GC box V$GC_01| 166 - 179 - tgactccgcctacc 7.88 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: his-66_H2B_his-65_H2A_C_elegans.fasta (1 sequences, 307 bp, 45.6% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score GC_box|M00255 GC box V$GC_01| 5.44 IRF-7|M00453 V$IRF7_01 IRF-7| 1.92 TBP|M00713 TBP F$TBP_Q6| 0.842 Oct-1|M00138 V$OCT1_04 Oct-1| 0.842 HiNF-D|HiNF-D| 0.684 IRF-1|M00747 IRF1| 0.582 E2F|M00516 E2F V$E2F_03| 0.312 TATA_box|M00252 TATA V$TATA_01| 0.0922 HEX|Hexamer| -0.662 NEG|Negative element| -1.2 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.93 SPT10|Spt10p| -3.2 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -3.46 AACCCT_box|AACCCT S. pombe| -5.32 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >his-66_H2B_his-65_H2A_C_elegans ref|NC_003282.3|:11400757-11401063 Caenorhabditis elegans chromosome IV, complete sequence TATA_box|M00252 TATA V$TATA_01| 45 - 59 - gacacctatttatgt 6.16 Oct-1|M00138 V$OCT1_04 Oct-1| 48 - 70 + acctatttatgtaaaaactgcgg 6.48 GC_box|M00255 GC box V$GC_01| 73 - 86 + gaggggcggagctt 10.9 E2F|M00516 E2F V$E2F_03| 84 - 95 + cttcccgcgggg 6.56 GC_box|M00255 GC box V$GC_01| 218 - 231 - aaactccgcccctc 11.3 HiNF-D|HiNF-D| 221 - 236 - ctccgcccctccaccg 6.35 IRF-1|M00747 IRF1| 240 - 246 - aaatgaa 6.09 TBP|M00713 TBP F$TBP_Q6| 246 - 254 - atataaaca 6.68 IRF-7|M00453 V$IRF7_01 IRF-7| 255 - 272 - gacagtttcgattcattc 6.32 IRF-7|M00453 V$IRF7_01 IRF-7| 267 - 284 - tcattcttcagattcgtc 8.1 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: his-67_H4_his-68_H2A_C_elegans.fasta (1 sequences, 358 bp, 47.8% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score CCAAT_box|M00254 V$CAAT_01 CCAAT box| 3.34 GC_box|M00255 GC box V$GC_01| 2.84 TBP|M00713 TBP F$TBP_Q6| 2.09 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 1.84 TATA_box|M00252 TATA V$TATA_01| 1.31 Oct-1|M00138 V$OCT1_04 Oct-1| 0.0768 HiNF-D|HiNF-D| 0.0243 HEX|Hexamer| -0.401 NEG|Negative element| -0.751 IRF-1|M00747 IRF1| -0.93 IRF-7|M00453 V$IRF7_01 IRF-7| -1.31 E2F|M00516 E2F V$E2F_03| -1.57 SPT10|Spt10p| -3.04 AACCCT_box|AACCCT S. pombe| -6.3 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >his-67_H4_his-68_H2A_C_elegans ref|NC_003279.3|:9988751-9989108 Caenorhabditis elegans chromosome I, complete sequence Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| 8 - 18 - gtgattggctg 8.38 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 9 - 20 - tgattggctgaa 9.88 TATA_box|M00252 TATA V$TATA_01| 52 - 66 - gttcttcttatatac 7.49 TBP|M00713 TBP F$TBP_Q6| 56 - 64 + ttcttatat 8.12 GC_box|M00255 GC box V$GC_01| 89 - 102 + caaaggcggagtca 6.24 GC_box|M00255 GC box V$GC_01| 281 - 294 - aaactccgccccgc 9.32 TBP|M00713 TBP F$TBP_Q6| 303 - 311 - aaataaata 6.54 TBP|M00713 TBP F$TBP_Q6| 309 - 317 - atataaagc 7.06 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: his-6_H3_his-5_H4_C_elegans.fasta (1 sequences, 228 bp, 46.1% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score IRF-7|M00453 V$IRF7_01 IRF-7| 4.17 TATA_box|M00252 TATA V$TATA_01| 3.66 SPT10|Spt10p| 2.31 TBP|M00713 TBP F$TBP_Q6| 0.75 IRF-1|M00747 IRF1| 0.661 HiNF-D|HiNF-D| 0.422 HEX|Hexamer| -0.139 NEG|Negative element| -0.359 Oct-1|M00138 V$OCT1_04 Oct-1| -0.916 AACCCT_box|AACCCT S. pombe| -1.77 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -2.35 GC_box|M00255 GC box V$GC_01| -2.62 E2F|M00516 E2F V$E2F_03| -3.52 CCAAT_box|M00254 V$CAAT_01 CCAAT box| -3.84 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >his-6_H3_his-5_H4_C_elegans ref|NC_003283.4|:8537565-8537792 Caenorhabditis elegans chromosome V, complete sequence TATA_box|M00252 TATA V$TATA_01| 45 - 59 - acactgcatttatac 8.95 TBP|M00713 TBP F$TBP_Q6| 51 - 59 + catttatac 6.34 SPT10|Spt10p| 133 - 153 + gtgtccccgcagtgtctcctc 8.33 TATA_box|M00252 TATA V$TATA_01| 171 - 185 + gtataaaaggggcag 9.08 IRF-7|M00453 V$IRF7_01 IRF-7| 186 - 203 - ccaactgtccatttcttc 10.2 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1 Clover: Cis-eLement OVERrepresentation Compiled on Nov 17 2005 Sequence file: his-8_H2B_his-7_H2A_C_elegans.fasta (1 sequences, 294 bp, 44.6% C+G) Motif file: ../histone_motifs (14 motifs) *** Over- and Under-represented Motifs: Motif Raw score GC_box|M00255 GC box V$GC_01| 2.64 CCAAT_box|M00254 V$CAAT_01 CCAAT box| 1.15 TATA_box|M00252 TATA V$TATA_01| 0.694 HiNF-D|HiNF-D| 0.443 TBP|M00713 TBP F$TBP_Q6| -0.124 IRF-1|M00747 IRF1| -0.245 HEX|Hexamer| -0.495 Oct-1|M00138 V$OCT1_04 Oct-1| -0.778 Alpha-CP1|M00687 V$ALPHACP1_01 alpha-CP1| -1.59 NEG|Negative element| -1.87 E2F|M00516 E2F V$E2F_03| -2.17 IRF-7|M00453 V$IRF7_01 IRF-7| -2.99 SPT10|Spt10p| -3.22 AACCCT_box|AACCCT S. pombe| -4.25 *** Motif Instances with Score >= 6: Motif Location Strand Sequence Score >his-8_H2B_his-7_H2A_C_elegans ref|NC_003283.4|:8535675-8535968 Caenorhabditis elegans chromosome V, complete sequence CCAAT_box|M00254 V$CAAT_01 CCAAT box| 8 - 19 - tgattggactgg 7.33 GC_box|M00255 GC box V$GC_01| 80 - 93 + gaaaggaggagcct 8.78 GC_box|M00255 GC box V$GC_01| 173 - 186 - tgccacctccccca 7.14 HiNF-D|HiNF-D| 216 - 231 - caccgcagctgtgttt 6.56 TATA_box|M00252 TATA V$TATA_01| 228 - 242 + gtttaaaagggtgct 6.85 Randomizations: 1000 P-value threshold: 0.01 Motif score threshold: 6 Randomize nucleotides OFF Randomize dinucleotides OFF Randomize motifs OFF Lowercase filtering OFF Pseudocount: 0.375 Random seed: 1