<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>gb-2007-8-10-r224</ui>
   <ji>GBJ</ji>
   <fm>
      <dochead>Method</dochead>
      <bibl>
         <title>
            <p>A BAC clone fingerprinting approach to the detection of human genome rearrangements</p>
         </title>
         <aug>
            <au id="A1">
               <snm>Krzywinski</snm>
               <fnm>Martin</fnm>
               <insr iid="I1"/>
               <email>martink@bcgsc.ca</email>
            </au>
            <au id="A2">
               <snm>Bosdet</snm>
               <fnm>Ian</fnm>
               <insr iid="I1"/>
               <email>ibosdet@bcgsc.ca</email>
            </au>
            <au id="A3">
               <snm>Mathewson</snm>
               <fnm>Carrie</fnm>
               <insr iid="I1"/>
               <email>cmathewson@bcgsc.ca</email>
            </au>
            <au id="A4">
               <snm>Wye</snm>
               <fnm>Natasja</fnm>
               <insr iid="I1"/>
               <email>nwye@bcgsc.ca</email>
            </au>
            <au id="A5">
               <snm>Brebner</snm>
               <fnm>Jay</fnm>
               <insr iid="I2"/>
               <email>brebner@cc.ucsf.edu</email>
            </au>
            <au id="A6">
               <snm>Chiu</snm>
               <fnm>Readman</fnm>
               <insr iid="I1"/>
               <email>rchiu@bcgsc.ca</email>
            </au>
            <au id="A7">
               <snm>Corbett</snm>
               <fnm>Richard</fnm>
               <insr iid="I1"/>
               <email>rcorbett@bcgsc.ca</email>
            </au>
            <au id="A8">
               <snm>Field</snm>
               <fnm>Matthew</fnm>
               <insr iid="I1"/>
               <email>mfield@bcgsc.ca</email>
            </au>
            <au id="A9">
               <snm>Lee</snm>
               <fnm>Darlene</fnm>
               <insr iid="I1"/>
               <email>dlee@bcgsc.ca</email>
            </au>
            <au id="A10">
               <snm>Pugh</snm>
               <fnm>Trevor</fnm>
               <insr iid="I1"/>
               <email>tpugh@bcgsc.ca</email>
            </au>
            <au id="A11">
               <snm>Volik</snm>
               <fnm>Stas</fnm>
               <insr iid="I2"/>
               <email>svolik@cc.ucsf.edu</email>
            </au>
            <au id="A12">
               <snm>Siddiqui</snm>
               <fnm>Asim</fnm>
               <insr iid="I1"/>
               <email>asims@bcgsc.ca</email>
            </au>
            <au id="A13">
               <snm>Jones</snm>
               <fnm>Steven</fnm>
               <insr iid="I1"/>
               <email>sjones@bcgsc.ca</email>
            </au>
            <au id="A14">
               <snm>Schein</snm>
               <fnm>Jacquie</fnm>
               <insr iid="I1"/>
               <email>jschein@bcgsc.ca</email>
            </au>
            <au id="A15">
               <snm>Collins</snm>
               <fnm>Collin</fnm>
               <insr iid="I2"/>
               <email>collins@cc.ucsf.edu</email>
            </au>
            <au id="A16" ca="yes">
               <snm>Marra</snm>
               <fnm>Marco</fnm>
               <insr iid="I1"/>
               <email>mmarra@bcgsc.ca</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>BC Cancer Agency Genome Sciences Centre, West 7th Avenue, Vancouver, British Columbia, Canada V5Z 4S6</p>
            </ins>
            <ins id="I2">
               <p>Cancer Research Institute, University of California at San Francisco, San Francisco, California, USA 94143-0808</p>
            </ins>
         </insg>
         <source>Genome Biology</source>
         <issn>1465-6906</issn>
         <pubdate>2007</pubdate>
         <volume>8</volume>
         <issue>10</issue>
         <fpage>R224</fpage>
         <url>http://genomebiology.com/2007/8/10/R224</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">17953769</pubid>
               <pubid idtype="doi">10.1186/gb-2007-8-10-r224</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>30</day>
               <month>4</month>
               <year>2007</year>
            </date>
         </rec>
         <revrec>
            <date>
               <day>28</day>
               <month>8</month>
               <year>2007</year>
            </date>
         </revrec>
         <acc>
            <date>
               <day>22</day>
               <month>10</month>
               <year>2007</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>22</day>
               <month>10</month>
               <year>2007</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2007</year>
         <collab>Krzywinski et al.; licensee BioMed Central Ltd.</collab>
         <note>This is an open access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <shorttitle>
         <p>Detecting human genome rearrangements</p>
      </shorttitle>
      <shortabs>
         <p>Fingerprint Profiling (FPP) is a new method which uses restriction digest fingerprints of bacterial artificial chromosome (BAC) clones for detecting and classifying rearrangements in the human genome.</p>
      </shortabs>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <p>We present a method, called fingerprint profiling (FPP), that uses restriction digest fingerprints of bacterial artificial chromosome clones to detect and classify rearrangements in the human genome. The approach uses alignment of experimental fingerprint patterns to <it>in silico </it>digests of the sequence assembly and is capable of detecting micro-deletions (1-5 kb) and balanced rearrangements. Our method has compelling potential for use as a whole-genome method for the identification and characterization of human genome rearrangements.</p>
         </sec>
      </abs>
   </fm>
   <meta>
      <classifications>
         <classification type="BMC" subtype="man_spc_id" id="30010002">Bioinformatics</classification>
         <classification type="BMC" subtype="man_spc_id" id="30010009">Genetics</classification>
      </classifications>
   </meta>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>The phenomenon of genomic heterogeneity, and the implications of this heterogeneity to human phenotypic diversity and disease, have recently been widely recognized <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr><abbr bid="B5">5</abbr></abbrgrp>, energizing efforts to develop catalogues of genomic variation <abbrgrp><abbr bid="B6">6</abbr><abbr bid="B7">7</abbr><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr></abbrgrp>. Among efforts to understand the role and effect of genomic variability, landmark studies have described changes in the genetic landscape of both normal and diseased genomes <abbrgrp><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr><abbr bid="B15">15</abbr></abbrgrp>, the presence of heterogeneity at different length scales <abbrgrp><abbr bid="B5">5</abbr><abbr bid="B16">16</abbr></abbrgrp> and variability within normal individuals of various ethnicities <abbrgrp><abbr bid="B17">17</abbr><abbr bid="B18">18</abbr><abbr bid="B19">19</abbr></abbrgrp>. Genome rearrangements have been repeatedly linked to a variety of diseases, such as cancer <abbrgrp><abbr bid="B20">20</abbr></abbrgrp> and mental retardation <abbrgrp><abbr bid="B21">21</abbr></abbrgrp>, and the evolution of alterations during disease progression continues to be an emphasis of current studies.</p>
         <p>Presently, various array-based methods, such as the 32 K bacterial artificial chromosome (BAC) array and Affy 100 K SNP array <abbrgrp><abbr bid="B21">21</abbr><abbr bid="B22">22</abbr><abbr bid="B24">23</abbr></abbrgrp>, are the most common approaches to detecting and localizing copy number variants, which are one class of genomic variation. The ubiquity of arrays is largely due to the fact that array experiments are relatively inexpensive, and collect information genome-wide. The advent of high-density oligonucleotide arrays, with probes spaced approximately every 5 kb, has increased the resolution of array methods to about 20-30 kb (multiple adjacent probes must confirm an aberration to be statistically significant) <abbrgrp><abbr bid="B21">21</abbr></abbrgrp>. Despite their advantages, commonly available array-based methods have several shortcomings. These include the inability to: detect copy number neutral variants, such as balanced rearrangements; precisely delineate breakpoints and other fine structure details of genomic rearrangements; and directly provide substrates for functional sequence-based characterization once a rearrangement has been detected.</p>
         <p>Clone-based approaches have been developed to study genome structure, in part motivated by shortcomings of array-based methods <abbrgrp><abbr bid="B16">16</abbr><abbr bid="B24">24</abbr><abbr bid="B25">25</abbr></abbrgrp>. In addition to their use in identifying both balanced and unbalanced rearrangements, clones have the potential to be directly used as reagents for downstream sequence characterization and cell-based functional studies <abbrgrp><abbr bid="B24">24</abbr></abbrgrp>. Despite the advantages of clone-based methods, relatively few studies have reported their use for detecting and characterizing genomic rearrangements. End sequences from fosmid clones have been compared to the human reference genome sequence to catalogue human genome structural variation <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>. End sequence profiling (ESP) <abbrgrp><abbr bid="B25">25</abbr></abbrgrp>, which uses BAC end sequences, has been used to study genomic rearrangements in MCF7 breast cancer cells <abbrgrp><abbr bid="B24">24</abbr></abbrgrp>. The principal drawbacks of clone-based methods are cost and speed of data acquisition. For example, in the case of end sequencing approaches that sample only the clone's termini, deeply redundant clone sampling would be required to approach coverage of the human genome. This might require millions of clones and end sequences. More tractable might be an approach capable of sampling the entire insert of a clone rather than only the ends, thereby enhancing coverage of the target genome with fewer sampled clones. Clone coverage of the human genome could then be achieved with only a small fraction of the clones required to achieve comparable genome coverage in clone end sequences.</p>
         <p>One method for sampling clone inserts is restriction fragment clone fingerprinting, which has been used by us and others to produce redundant clone maps of whole genomes <abbrgrp><abbr bid="B21">21</abbr><abbr bid="B26">26</abbr><abbr bid="B27">27</abbr><abbr bid="B28">28</abbr><abbr bid="B29">29</abbr><abbr bid="B30">30</abbr></abbrgrp>. Whole-genome clone mapping projects have shown that it is possible to achieve saturation of mammalian genome coverage with 150,000-200,000 fingerprinted BACs, with the number of BACs required inversely proportional to BAC library insert sizes. This relatively tractable number of clones suggests that whole genome surveys using BAC fingerprinting are feasible. What is not known is whether fingerprints are capable of identifying clones bearing genome rearrangements. In this study we address this question using computational simulations and fingerprint analysis of a small number of BAC clones, previously characterized by ESP. We collected restriction enzyme fingerprints from a set of 493 BACs that represented regions of the MCF7 breast cancer cell line genome. Using an alignment algorithm we developed (called fingerprint profiling (FPP)), we fingerprinted clones and aligned these fingerprints to locations on the reference genome sequence and used the alignment profiles to detect candidate genomic rearrangements. Our analysis reveals fingerprint analysis can detect small focal rearrangements and more complex events occurring within the span of a single clone. By varying the number of fingerprints collected for a clone, the sensitivity of FPP can be tuned to balance throughput with satisfactory detection performance. We also show that FPP is relatively insensitive to certain sequence repeats. Our analysis is compatible with the concept of using clone fingerprinting to profile entire genomes in screens for genome rearrangements.</p>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <p>We explored the utility of FPP for the identification of genome rearrangements. The method involved generating one or more fingerprint patterns by digesting clones with several restriction enzymes, and comparing these patterns to <it>in silico </it>digests of the reference human genome sequence. Differences detected in this comparison identified the coordinates of candidate genome rearrangements.</p>
         <sec>
            <st>
               <p>Restriction enzyme selection</p>
            </st>
            <p>We analyzed the distribution of recognition sequences for 4,060 restriction enzyme combinations (Figure <figr fid="F1">1</figr>) on human chromosome 7 (Materials and methods). From this, we identified five restriction enzyme combinations of potential utility for FPP. All five combinations included <it>Hin</it>dIII and <it>Eco</it>RI, and one of: <it>Bcl</it>I/<it>Bgl</it>II/<it>Pvu</it>II, <it>Bal</it>I/<it>Bcl</it>I/<it>Bgl</it>II, <it>Nco</it>I/<it>Pvu</it>II/<it>Xba</it>I, <it>Bcl</it>/<it>Nco</it>I/<it>Pvu</it>II, or <it>Bgl</it>II/<it>Nco</it>I/<it>Pvu</it>II. Each of these combinations represented at least 99.98% of the chromosome7 sequence in restriction fragments of sizes that are generally accurately determined using our BAC clone fingerprinting method. Ultimately, we selected the combination <it>Hin</it>dIII/<it>Eco</it>RI/<it>Bgl</it>II/<it>Nco</it>I/<it>Pvu</it>II for its desirable cut site distribution, ease of use in the laboratory and our favorable experience with the high quality of fingerprints from these enzymes.</p>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>Desirability ranking of 4,060 five-enzyme combinations</p>
               </caption>
               <text>
                  <p>Desirability ranking of 4,060 five-enzyme combinations. We determined desirability of enzyme combinations based on S(n), defined as the fraction of the chromosome 7 that is represented by restriction fragments in the range 1-20 kb (a subset of our sizing range within which sizing accuracy is increased) for &#8805;n enzymes. Enzyme combinations with high values of S(n) are desirable because a large fraction of fragments in their fingerprint patterns can be accurately sized and because the number of large fragment covers found in regions represented exclusively by large fragments in all digests is minimized. Points represented by hollow glyphs correspond to enzyme combinations which achieved rank in top 10% for <it>each </it>of S(<it>n </it>= 1..5).</p>
               </text>
               <graphic file="gb-2007-8-10-r224-1"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Theoretical sensitivity of fingerprint alignments</p>
            </st>
            <p>To demonstrate that fingerprint patterns are sufficiently complex to uniquely identify genomic intervals, we devised <it>in silico </it>simulations to determine specificities of fingerprint fragments and patterns and to align virtual clones with simulated rearrangement breakpoints to the reference genome sequence.</p>
            <p>We computed the fragment specificity for a given fragment as the fraction of fragments in the genome that are experimentally indistinguishable in size (Materials and methods). Figure <figr fid="F2">2</figr> shows the specificity for an individual <it>Hin</it>dIII fragment of a given size in the human genome (hg17), and depicts the practical specificity where experimental sizing error is used to determine whether fragment sizes can be distinguished. Our sizing error depends on fragment size (Figure <figr fid="F3">3</figr>), effectively dividing the sizing range into approximately 380 unique bins. Also depicted is the case of exact sizing, where fragments are considered indistinguishable only if their sizes are identical. Although exact sizing is not possible in the laboratory, we include the case of exact sizing here because it represents the theoretical best possible performance of FPP with the enzymes we selected, and because it helps to contrast FPP's practical performance.</p>
            <fig id="F2">
               <title>
                  <p>Figure 2</p>
               </title>
               <caption>
                  <p>Specificity of individual restriction fragments and patterns based on exact and experimental sizing tolerance</p>
               </caption>
               <text>
                  <p>Specificity of individual restriction fragments and patterns based on exact and experimental sizing tolerance. <b>(a) </b><it>Hin</it>dIII restriction fragment specificity for the human genome for fragments within the experimental size range of 500 bp to 30 kb. For a given fragment size, the vertical scale represents the fraction of fragments in the genome that are indistinguishable by size in the case of either exact sizing (fragments in common between two fingerprints must be of identical size) or within experimental tolerance (fragments in common between two fingerprints must be within experimental sizing error; Figure 3) on a fingerprinting gel. When sizing is exact, fragment specificity follows approximately the exponential distribution of fragment sizes and spans a range of 3.5 orders of magnitude. When experimental tolerance is included, the number of distinguishable fragment size bins is reduced and the range of fragment specificity drops to two orders of magnitude. <b>(b) </b>The specificity of a fingerprint pattern of a given size in the human genome. Fingerprint pattern size is measured in terms of number of fragments. Regions with identical patterns are those in which there is a 1:1 mapping within tolerance between all sizeable fragments. The specificity of experimental fingerprint patterns is cumulatively affected by specificity of individual fragments. The specificity of fragments is sufficiently low (that is, due to high experimental precision) so that 96.5% of the genome is uniquely represented by fragment patterns of 8 fragments or more.</p>
               </text>
               <graphic file="gb-2007-8-10-r224-2"/>
            </fig>
            <fig id="F3">
               <title>
                  <p>Figure 3</p>
               </title>
               <caption>
                  <p>Experimental error of fragment sizing within the 0.5-30 kb sizing range of our single digest protocol</p>
               </caption>
               <text>
                  <p>Experimental error of fragment sizing within the 0.5-30 kb sizing range of our single digest protocol. The error is expressed in relative size (left axis) and standard mobility (right axis). Standard mobility is a distance unit that takes into account inter-gel variation and is approximately linear with the distance traveled by the fragment on the gel.</p>
               </text>
               <graphic file="gb-2007-8-10-r224-3"/>
            </fig>
            <p>This analysis revealed that <it>Hin</it>dIII fingerprints with approximately 15 fragments exhibit a high degree of specificity, as only approximately 1.5% of the genome cannot be uniquely distinguished using patterns composed of this number of fragments. This high specificity results from accurate experimental fragment sizing, and from the fact that the length of genomic repeats is generally much shorter than restriction fragments. Therefore, a specific combination of adjacent fragment sizes represents a relatively unique event in the human genome.</p>
            <p>To evaluate the accuracy and sensitivity of actual fingerprint alignments, we performed an <it>in silico </it>study (Materials and methods), in which we computationally generated virtual clones containing simulated genomic rearrangement breakpoints and used these fingerprints as inputs into the alignment algorithm. Figure <figr fid="F4">4</figr> illustrates the sensitivity and positional accuracy of the mapping of these synthetic clones as a function of the number of digests and segment size. When a single <it>Hin</it>dIII fingerprint digest is used, we successfully aligned 50% of 35 kb segments. This cutoff size can be decreased to 25 kb if two digests are used (<it>Hin</it>dIII/<it>Eco</it>RI) and to 16 kb if five digests are used (<it>Hin</it>dIII/<it>Eco</it>RI/<it>Bgl</it>II/<it>Nco</it>I/<it>Pst</it>II). The number of digests used has a large impact on the smallest alignable segment size due to the fact that the positions of cut sites of distinct enzymes are generally uncorrelated and that the individual digest patterns can be aligned independently and used together to increase sensitivity. Figure <figr fid="F4">4</figr> suggests the number of digests that would be required to detect 90% of rearrangements of a certain size. For example, if we wish to identify a breakpoint in 90% of simulated cloned rearrangements, then the shortest rearrangements that can be detected for 1, 2, 3, 4 and 5 digests are 60, 45, 34, 28, and 25 kb, respectively. Stated differently, one can be 90% certain that when using 5 enzymes, a segment of length 25 kb within a BAC would be sufficient to identify the BAC as bearing a genome rearrangement.</p>
            <fig id="F4">
               <title>
                  <p>Figure 4</p>
               </title>
               <caption>
                  <p>Simulation results of sensitivity and spatial error of rearrangement detection by FPP using experimental sizing tolerance</p>
               </caption>
               <text>
                  <p>Simulation results of sensitivity and spatial error of rearrangement detection by FPP using experimental sizing tolerance. <b>(a) </b>Sensitivity is measured as the fraction of clone regions of a given size with successful FPP alignments and is plotted for five digests (labeled 1-5). <b>(b) </b>Spatial error is measured by the median distance between FPP and theoretical alignment positions. The largest improvement in both sensitivity and spatial error is realized by migrating FPP from one digest to two. With two fingerprint patterns used to align the clone, 50% of >25 kb clone regions are aligned (90% of >45 kb regions) with a spatial error of 1.7 kb.</p>
               </text>
               <graphic file="gb-2007-8-10-r224-4"/>
            </fig>
            <p>Figure <figr fid="F4">4</figr> shows the median distance between the left and right edges of the alignment and known segment spans for segments of varying sizes. While the values for 10 kb segments are difficult to interpret because of relatively few successful alignments, the error is otherwise constant for segment sizes and depends primarily on the number of digests. The error is 3.0 kb for an alignment based on a single digest and drops to 1.7 kb when two digests are used. When the number of digests is increased to 5, the error drops as low as 700 base-pairs (bp).</p>
         </sec>
         <sec>
            <st>
               <p>MCF7 clone fingerprint-based alignments</p>
            </st>
            <p>With knowledge gained from our simulations, we sought to apply FPP to a test set of 493 BAC clones derived from the MCF7 breast cancer cell line. Each clone was fingerprinted and aligned to the genome with FPP, and the results of the alignments were compared to alignments performed using BAC end sequences (Materials and methods, Additional data file 2). Alignments were evaluated based on their size and number, with multiple alignments indicating identification of a candidate rearrangement. We were able to obtain FPP alignments for 487/493 of the clones. On average, we were able to map 88% of a clone's fingerprint fragments to the genome, and 90% of clones had more than 72% of their fingerprint fragments mapped. Table <tblr tid="T1">1</tblr> summarizes FPP and ESP rearrangement detection and Table <tblr tid="T2">2</tblr> shows a detailed comparison of rearrangement detection for clones that had an FPP alignment that indicated a breakpoint. The positional accuracy of FPP alignments is shown in Table <tblr tid="T3">3</tblr>.</p>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>Comparison of number of rearrangements detected by ESP and FPP in a 487 MCF7 BACs</p>
               </caption>
               <tblbdy cols="8">
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c cspan="6" ca="center">
                        <p>ESP</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c cspan="3" ca="center">
                        <p>N</p>
                     </c>
                     <c cspan="3" ca="center">
                        <p>Y</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c cspan="3">
                        <hr/>
                     </c>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>No. of clones</p>
                     </c>
                     <c ca="center">
                        <p>Agree</p>
                     </c>
                     <c ca="center">
                        <p>Disagree</p>
                     </c>
                     <c ca="center">
                        <p>No. of clones</p>
                     </c>
                     <c ca="center">
                        <p>No. agree</p>
                     </c>
                     <c ca="center">
                        <p>No. disagree</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="8">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>FPP</p>
                     </c>
                     <c ca="center">
                        <p>N</p>
                     </c>
                     <c ca="center">
                        <p>250</p>
                     </c>
                     <c ca="center">
                        <p>243</p>
                     </c>
                     <c ca="center">
                        <p>2<sup>b</sup>/5<sup>c</sup></p>
                     </c>
                     <c ca="center">
                        <p>72</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>63<sup>d</sup>/6<sup>e</sup></p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>Y<sup>a</sup></p>
                     </c>
                     <c ca="center">
                        <p>11</p>
                     </c>
                     <c ca="center">
                        <p>8</p>
                     </c>
                     <c ca="center">
                        <p>2<sup>f</sup>/1<sup>g</sup></p>
                     </c>
                     <c ca="center">
                        <p>154</p>
                     </c>
                     <c ca="center">
                        <p>126</p>
                     </c>
                     <c ca="center">
                        <p>26<sup>h</sup>/2<sup>i</sup></p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>The clones are partitioned based on whether a rearrangement was detected by ESP and/or FPP. For each combination of detection (for example, FPP = Y, ESP = N, where Y/N indicates the presence/absence of rearrangement, respectively, as measured by the corresponding method), the table shows the number of clones in this category, which is further broken down into the number of clones in which ESP and FPP mappings agreed and the number of clones for which ESP and FPP mappings did not agree (for example, both can show no rearrangement but disagree about clone position). Clones in the 'Agree' column have an FPP alignment within 50 kb of both end sequence alignments. Clones in the 'Disagree' column are reported as two groups: clones with an FPP alignment agreeing with one end sequence alignment and clones for which no agreement with either end sequence alignment was detected. Both groups with the disagree category are annotated with a reason for the disagreement. <sup>a</sup>Clones in this row are further classified based on the number of FPP alignments in Table 2. <sup>b</sup>Del (2); <sup>c</sup>mispick (5); <sup>d</sup>bne (33), hr (14), lowcomplex (1), nip (10), rep (5); <sup>e</sup>lowcomplex (1), mispick (3), rep (2); <sup>f</sup>rep (2); <sup>g</sup>mispick (1); <sup>h</sup>bne (14), hr (8), nip (3), rep (1); <sup>i</sup>bne (1), mispick (1). Bne, breakpoint near end of clone; del, clone appears deleted; hr, highly rearranged; lowcomplex, fingerprint has very few fragments; mispick, FPP/ESP data mismatch; nip, FPP alignment detected but not added to partition; rep, alignments in repeat regions.</p>
               </tblfn>
            </tbl>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Profile of candidate rearrangements detected by FPP</p>
               </caption>
               <tblbdy cols="8">
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c cspan="6" ca="center">
                        <p>ESP</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c cspan="3" ca="center">
                        <p>N</p>
                     </c>
                     <c cspan="3" ca="center">
                        <p>Y</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c cspan="3">
                        <hr/>
                     </c>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>No. of clones</p>
                     </c>
                     <c ca="center">
                        <p>Agree</p>
                     </c>
                     <c ca="center">
                        <p>Disagree</p>
                     </c>
                     <c ca="center">
                        <p>No. of clones</p>
                     </c>
                     <c ca="center">
                        <p>No. agree</p>
                     </c>
                     <c ca="center">
                        <p>No. disagree</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="8">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>FPP alignments</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>11</p>
                     </c>
                     <c ca="center">
                        <p>8</p>
                     </c>
                     <c ca="center">
                        <p>1/2</p>
                     </c>
                     <c ca="center">
                        <p>123</p>
                     </c>
                     <c ca="center">
                        <p>101</p>
                     </c>
                     <c ca="center">
                        <p>22/0</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>29</p>
                     </c>
                     <c ca="center">
                        <p>22</p>
                     </c>
                     <c ca="center">
                        <p>5/2</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>4</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>0/0</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>Clones are grouped in rows by the number of distinct FPP alignments. For each group, the clones are partitioned based on whether ESP detected a rearrangement. Clones in the 'Agree' column have an FPP alignment within 50 kb of both end sequence alignments. Clones in the 'Disagree' column are partitioned in the same manner as in Table 1.</p>
               </tblfn>
            </tbl>
            <tbl id="T3">
               <title>
                  <p>Table 3</p>
               </title>
               <caption>
                  <p>Positional accuracy of FPP alignments</p>
               </caption>
               <tblbdy cols="3">
                  <r>
                     <c ca="left">
                        <p>|FPP-BES|</p>
                     </c>
                     <c ca="center">
                        <p>Clone ends*</p>
                     </c>
                     <c ca="center">
                        <p>Clones<sup>&#8224;</sup></p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>&lt;1 kb</p>
                     </c>
                     <c ca="center">
                        <p>50%</p>
                     </c>
                     <c ca="center">
                        <p>28%</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>&lt;2 kb</p>
                     </c>
                     <c ca="center">
                        <p>70%</p>
                     </c>
                     <c ca="center">
                        <p>50%</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>&lt;5 kb</p>
                     </c>
                     <c ca="center">
                        <p>88%</p>
                     </c>
                     <c ca="center">
                        <p>79%</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>&lt;10 kb</p>
                     </c>
                     <c ca="center">
                        <p>96%</p>
                     </c>
                     <c ca="center">
                        <p>93%</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>&lt;25 kb</p>
                     </c>
                     <c ca="center">
                        <p>99%</p>
                     </c>
                     <c ca="center">
                        <p>98%</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>&lt;50 kb</p>
                     </c>
                     <c ca="center">
                        <p>100%</p>
                     </c>
                     <c ca="center">
                        <p>100%</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>Accuracy was measured by comparing the distance between the positions of end sequence alignments and nearest edge of an FPP alignment. For this comparison the subset of clones for which ESP and FPP agreed in both rearrangement detection and mapping position (243 + 126 = 369 clones; Table 1) was used. *Cumulative distribution of nearest distances between FPP and individual BES alignments, min<sub>i</sub>|FPP<sub>i</sub>-BES|. <sup>&#8224;</sup>Cumulative distribution of max<sub>j</sub>(min<sub>i</sub>|FPP<sub>i</sub>-BES<sub>j</sub>|) - the larger of two distances between a clone's FPP and BES alignments</p>
               </tblfn>
            </tbl>
            <p>Because ESP uses BAC end sequences that produce data for only the ends of clones, ESP has limited capacity to localize the locations of rearrangement breakpoints within clones. To investigate the precision of FPP in defining the position of breakpoints within BACs, we used clone alignments spanning regions of chromosomes 1, 3, 17 and 20 that contained known breakpoints. We selected these regions because of the enriched coverage provided by our test clone set. The breakpoint position was determined to be the average FPP alignment position with the error given by the standard deviation of the alignments. Additional data file 2 shows the layout of these breakpoints in the MCF7 genome and all FPP and ESP alignments for clones in these regions. Additional data file 3 expands several of the regions from Additional data file 2, and illustrates the relative position of FPP and ESP alignments. Additional data file 6 further increases the detail shown in Additional data file 2, depicting restriction maps and fragment matching status within each clone alignment for all five enzymes. We found 51 breakpoints in 118 unique clones (Table <tblr tid="T4">4</tblr>). We tested the presence of breakpoints in three clones using PCR (Table <tblr tid="T5">5</tblr>), and demonstrated the presence of PCR products (Figure <figr fid="F5">5</figr>) to verify fusions within the clone's insert of regions non-adjacent in the reference genome sequence.</p>
            <tbl id="T4">
               <title>
                  <p>Table 4</p>
               </title>
               <caption>
                  <p>Location of breakpoints in the MCF7 genome in regions sampled by clones on chromosomes 1, 3, 17 and 20</p>
               </caption>
               <tblbdy cols="5">
                  <r>
                     <c ca="left">
                        <p>ID</p>
                     </c>
                     <c ca="center">
                        <p>Chromosome</p>
                     </c>
                     <c ca="center">
                        <p>Position</p>
                     </c>
                     <c ca="center">
                        <p>Uncertainty</p>
                     </c>
                     <c ca="left">
                        <p>Clones</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="5">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>1L</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>106446622</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>M0035E03</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>2L</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>107325668</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="left">
                        <p>M0090F09 M0095D18</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>3R</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>107642673</p>
                     </c>
                     <c ca="center">
                        <p>1,640</p>
                     </c>
                     <c ca="left">
                        <p>M0012O05 M0064A13 M0089C03 M0090K07 M0126M04 M0152M23</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>4L</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>112083301</p>
                     </c>
                     <c ca="center">
                        <p>957</p>
                     </c>
                     <c ca="left">
                        <p>M0035A16 M0039B19 M0041G20 M0043K05 M0062P11 M0078P07</p>
                        <p>M0080G18 M0086B04 M0086C02 M0090F09 M0091L21 M0168M09</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>5R</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>112119925</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="left">
                        <p>M0090F09 M0095D18</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>6R</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>62612471</p>
                     </c>
                     <c ca="center">
                        <p>856</p>
                     </c>
                     <c ca="left">
                        <p>M0012A19 M0041A24</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>7L</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>63679826</p>
                     </c>
                     <c ca="center">
                        <p>757</p>
                     </c>
                     <c ca="left">
                        <p>M0005P04 M0007J14 M0030P20 M0043O24 M0093C20 M0134N23</p>
                        <p>M0143D18 M0150I03 M0156K22</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>8R</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>63716623</p>
                     </c>
                     <c ca="center">
                        <p>1,755</p>
                     </c>
                     <c ca="left">
                        <p>M0005P04 M0007J14 M0030P20 M0043O24 M0093C20 M0107G11</p>
                        <p>M0134N23 M0137G17 M0143D18 M0150I03 M0151M05 M0156K22</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>9R</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>63908884</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>M0035E03</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>10L</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>63954937</p>
                     </c>
                     <c ca="center">
                        <p>8,740</p>
                     </c>
                     <c ca="left">
                        <p>M0007J14 M0030P20 M0037J18 M0043O24 M0066M03 M0067H12</p>
                        <p>M0073I23 M0093C20 M0107G11 M0124I19 M0134N23 M0137G17</p>
                        <p>M0143D18 M0150I03 M0151M05 M0156K22</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>11R</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>63995878</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="left">
                        <p>M0066M03 M0067H12 M0124I19 M0137G17</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>12L</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>63997257</p>
                     </c>
                     <c ca="center">
                        <p>1,178</p>
                     </c>
                     <c ca="left">
                        <p>M0003F05 M0031O08 M0039A05 M0088O13 M0145B06</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>13R</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>64074753</p>
                     </c>
                     <c ca="center">
                        <p>3,228</p>
                     </c>
                     <c ca="left">
                        <p>M0014E11 M0031O08 M0088O13 M0144L06 M0145B06</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>14L</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>64660949</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="left">
                        <p>M0012A19 M0041A24</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>15R</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>64927120</p>
                     </c>
                     <c ca="center">
                        <p>304</p>
                     </c>
                     <c ca="left">
                        <p>M0006B19 M0014P03</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>16L</p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>54050256</p>
                     </c>
                     <c ca="center">
                        <p>11,312</p>
                     </c>
                     <c ca="left">
                        <p>M0037J18 M0066C22</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>17R</p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>54158022</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="left">
                        <p>M0037J18 M0073I23</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>18L</p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>54397666</p>
                     </c>
                     <c ca="center">
                        <p>9,801</p>
                     </c>
                     <c ca="left">
                        <p>M0035A16 M0039B19 M0041G20 M0043K05 M0062P11 M0078P07</p>
                        <p>M0080G18 M0086B04 M0086C02 M0090F09 M0090P15 M0091L21</p>
                        <p>M0095D18 M0168M09</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>19R</p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>54549098</p>
                     </c>
                     <c ca="center">
                        <p>6,065</p>
                     </c>
                     <c ca="left">
                        <p>M0009I10 M0013G05 M0105A20 M0107H09</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>20L</p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>55260098</p>
                     </c>
                     <c ca="center">
                        <p>5,548</p>
                     </c>
                     <c ca="left">
                        <p>M0001M18 M0009I10 M0013G05 M0107H09</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>21R</p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>55468383</p>
                     </c>
                     <c ca="center">
                        <p>15,761</p>
                     </c>
                     <c ca="left">
                        <p>M0001M18 M0090P15 M0092G06</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>22L</p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>56176919</p>
                     </c>
                     <c ca="center">
                        <p>163</p>
                     </c>
                     <c ca="left">
                        <p>M0089C03 M0090K07 M0126M04 M0152M23</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>23R</p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>56206584</p>
                     </c>
                     <c ca="center">
                        <p>1,204</p>
                     </c>
                     <c ca="left">
                        <p>M0064A13 M0089C03 M0090K07 M0126M04 M0152M23</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>24R</p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>56233933</p>
                     </c>
                     <c ca="center">
                        <p>3,684</p>
                     </c>
                     <c ca="left">
                        <p>M0005P04 M0007J14 M0030P20 M0043O24 M0093C20 M0134N23</p>
                        <p>M0143D18 M0150I03</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>25L</p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>56644007</p>
                     </c>
                     <c ca="center">
                        <p>1,148</p>
                     </c>
                     <c ca="left">
                        <p>M0005I19 M0045E13 M0054A01 M0054C03 M0058D14 M0058K11</p>
                        <p>M0059J17 M0062L13 M0077L13 M0089F05 M0089I18 M0094M14</p>
                        <p>M0107O02 M0124A06 M0132D17 M0138H21 M0145N09 M0147K12</p>
                        <p>M0148L05 M0159O13 M0160H16 M0165D22</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>26L</p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>56961440</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>M0021C24</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>27R</p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>57339860</p>
                     </c>
                     <c ca="center">
                        <p>1,364</p>
                     </c>
                     <c ca="left">
                        <p>M0024G06 M0123G10 M0155O05 M0156I16</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>28L</p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>59745950</p>
                     </c>
                     <c ca="center">
                        <p>6,571</p>
                     </c>
                     <c ca="left">
                        <p>M0006B19 M0014P03</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>29R</p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>59781552</p>
                     </c>
                     <c ca="center">
                        <p>688</p>
                     </c>
                     <c ca="left">
                        <p>M0006B19 M0014P03</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>30L</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>38948829</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>M0011K13</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>31L</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>40249289</p>
                     </c>
                     <c ca="center">
                        <p>2,622</p>
                     </c>
                     <c ca="left">
                        <p>M0003F05 M0031O08 M0039A05 M0043G01 M0145B06</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>32R</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>40271873</p>
                     </c>
                     <c ca="center">
                        <p>1,207</p>
                     </c>
                     <c ca="left">
                        <p>M0003F05 M0031O08 M0039A05 M0043G01 M0088O13 M0145B06</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>33R</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>40664609</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>M0011K13</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>34L</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>45230184</p>
                     </c>
                     <c ca="center">
                        <p>278</p>
                     </c>
                     <c ca="left">
                        <p>M0001A11 M0010D13 M0026L11 M0028H13 M0031E14 M0038G05</p>
                        <p>M0038P15 M0041B14 M0055I11 M0080H12 M0108H05 M0129A15</p>
                        <p>M0135D20 M0151F12 M0162M24 M0167J20</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>35L</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>45736731</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>M0021C24</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>36L</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>45847023</p>
                     </c>
                     <c ca="center">
                        <p>1,846</p>
                     </c>
                     <c ca="left">
                        <p>M0014E11 M0088O13 M0144L06</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>37L</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>46174956</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>M0159C23</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>38L</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>48694494</p>
                     </c>
                     <c ca="center">
                        <p>933</p>
                     </c>
                     <c ca="left">
                        <p>M0001A11 M0055I11 M0151F12</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>39L</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>48729868</p>
                     </c>
                     <c ca="center">
                        <p>6,077</p>
                     </c>
                     <c ca="left">
                        <p>M0010D13 M0026L11 M0028H13 M0031E14 M0038G05 M0038P15</p>
                        <p>M0041B14 M0080H12 M0108H05 M0129A15 M0135D20 M0162M24</p>
                        <p>M0165D22 M0167J20</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>40R</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>48863824</p>
                     </c>
                     <c ca="center">
                        <p>720</p>
                     </c>
                     <c ca="left">
                        <p>M0001A11 M0005I19 M0045E13 M0054A01 M0054C03 M0058D14</p>
                        <p>M0058K11 M0059J17 M0062L13 M0069H04 M0077L13 M0089F05</p>
                        <p>M0089I18 M0094M14 M0107O02 M0124A06 M0132D17 M0138H21</p>
                        <p>M0145N09 M0147K12 M0148L05 M0159O13 M0160H16 M0165D22</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>41L</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>51618225</p>
                     </c>
                     <c ca="center">
                        <p>4,895</p>
                     </c>
                     <c ca="left">
                        <p>M0003F05 M0005H09 M0008J22 M0029C09 M0031O08 M0036L24</p>
                        <p>M0043G01 M0071O17 M0075M20 M0077H17 M0090K04 M0100O14</p>
                        <p>M0116C01 M0132B21 M0145O12 M0159P14</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>42R</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>52046458</p>
                     </c>
                     <c ca="center">
                        <p>2,367</p>
                     </c>
                     <c ca="left">
                        <p>M0066M03 M0067H12 M0124I19 M0137G17</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>43R</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>52066649</p>
                     </c>
                     <c ca="center">
                        <p>126</p>
                     </c>
                     <c ca="left">
                        <p>M0012O05 M0089C03 M0152M23</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>44R</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>52248474</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>M0066C22</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>45R</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>52985221</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>M0014P03</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>46R</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>53545530</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="left">
                        <p>M0036B13 M0141F19</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>47L</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>55122587</p>
                     </c>
                     <c ca="center">
                        <p>853</p>
                     </c>
                     <c ca="left">
                        <p>M0024G06 M0123G10 M0155O05 M0156I16</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>48L</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>55254895</p>
                     </c>
                     <c ca="center">
                        <p>3,310</p>
                     </c>
                     <c ca="left">
                        <p>M0003F05 M0031O08 M0036L24 M0039A05 M0043G01 M0071O17</p>
                        <p>M0132B21 M0145B06 M0159C23</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>49R</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>55287488</p>
                     </c>
                     <c ca="center">
                        <p>1,269</p>
                     </c>
                     <c ca="left">
                        <p>M0003F05 M0005H09 M0008J22 M0029C09 M0031O08 M0036L24</p>
                        <p>M0039A05 M0043G01 M0071O17 M0075M20 M0077H17 M0090K04</p>
                        <p>M0100O14 M0116C01 M0132B21 M0145B06 M0145O12 M0159C23</p>
                        <p>M0159P14</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>50L</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>59150999</p>
                     </c>
                     <c ca="center">
                        <p>936</p>
                     </c>
                     <c ca="left">
                        <p>M0036B13 M0141F19</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>51R</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>59176749</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="left">
                        <p>M0036B13 M0141F19</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>Breakpoint position is the average position of blunt alignment ends with the standard deviation of these quantities taken as the uncertainty. Breakpoint ID is composed of a unique numerical index and L/R suffix that indicates which edge of the FPP alignment (left/right) is considered to be the breakpoint.</p>
               </tblfn>
            </tbl>
            <tbl id="T5">
               <title>
                  <p>Table 5</p>
               </title>
               <caption>
                  <p>PCR primers used to validate the presence of breakpoints detected by fingerprints</p>
               </caption>
               <tblbdy cols="9">
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c cspan="4" ca="center">
                        <p>Left primer</p>
                     </c>
                     <c cspan="4" ca="center">
                        <p>Right primer</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c cspan="4">
                        <hr/>
                     </c>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Primer transform</p>
                     </c>
                     <c ca="center">
                        <p>Sequence</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c cspan="2" ca="center">
                        <p>Position</p>
                     </c>
                     <c ca="center">
                        <p>Sequence</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c cspan="2" ca="center">
                        <p>Position</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="9">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>Chr</p>
                     </c>
                     <c ca="center">
                        <p>Start (bp)</p>
                     </c>
                     <c ca="center">
                        <p>End (bp)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>Chr</p>
                     </c>
                     <c ca="center">
                        <p>Start (bp)</p>
                     </c>
                     <c ca="center">
                        <p>End (bp)</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="9">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>M0092D11</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>ar+ br+</p>
                     </c>
                     <c ca="center">
                        <p>TGCTAAATTTCCCAAGTGCC</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>45,794,352</p>
                     </c>
                     <c ca="center">
                        <p>45,794,371</p>
                     </c>
                     <c ca="center">
                        <p>CCGTCCTCTTAGCGAACTTG</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>46,968,304</p>
                     </c>
                     <c ca="center">
                        <p>46,968,323</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>ar+ br-</p>
                     </c>
                     <c ca="center">
                        <p>TGCTAAATTTCCCAAGTGCC</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>45,794,352</p>
                     </c>
                     <c ca="center">
                        <p>45,794,371</p>
                     </c>
                     <c ca="center">
                        <p>AATTTCAAAATGCGTCTGGG</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>46,968,631</p>
                     </c>
                     <c ca="center">
                        <p>46,968,650</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>ar+ bl+</p>
                     </c>
                     <c ca="center">
                        <p>TGCTAAATTTCCCAAGTGCC</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>45,794,352</p>
                     </c>
                     <c ca="center">
                        <p>45,794,371</p>
                     </c>
                     <c ca="center">
                        <p>TGACACGCAGGGTAGATCAG</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>46,923,060</p>
                     </c>
                     <c ca="center">
                        <p>46,923,079</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>ar+ bl-</p>
                     </c>
                     <c ca="center">
                        <p>TGCTAAATTTCCCAAGTGCC</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>45,794,352</p>
                     </c>
                     <c ca="center">
                        <p>45,794,371</p>
                     </c>
                     <c ca="center">
                        <p>TCCAACAGGAAGGAGTACCG</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>46,922,743</p>
                     </c>
                     <c ca="center">
                        <p>46,922,762</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>al+ br+</p>
                     </c>
                     <c ca="center">
                        <p>CTCTCTTTTGTGGGACGAGC</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>45,718,752</p>
                     </c>
                     <c ca="center">
                        <p>45,718,771</p>
                     </c>
                     <c ca="center">
                        <p>CCGTCCTCTTAGCGAACTTG</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>46,968,304</p>
                     </c>
                     <c ca="center">
                        <p>46,968,323</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>al+ br-</p>
                     </c>
                     <c ca="center">
                        <p>CTCTCTTTTGTGGGACGAGC</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>45,718,752</p>
                     </c>
                     <c ca="center">
                        <p>45,718,771</p>
                     </c>
                     <c ca="center">
                        <p>AATTTCAAAATGCGTCTGGG</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>46,968,631</p>
                     </c>
                     <c ca="center">
                        <p>46,968,650</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>al+ bl+</p>
                     </c>
                     <c ca="center">
                        <p>CTCTCTTTTGTGGGACGAGC</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>45,718,752</p>
                     </c>
                     <c ca="center">
                        <p>45,718,771</p>
                     </c>
                     <c ca="center">
                        <p>TGACACGCAGGGTAGATCAG</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>46,923,060</p>
                     </c>
                     <c ca="center">
                        <p>46,923,079</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p><b>al+ bl</b>-</p>
                     </c>
                     <c ca="center">
                        <p>CTCTCTTTTGTGGGACGAGC</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>45,718,752</p>
                     </c>
                     <c ca="center">
                        <p>45,718,771</p>
                     </c>
                     <c ca="center">
                        <p>TCCAACAGGAAGGAGTACCG</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>46,922,743</p>
                     </c>
                     <c ca="center">
                        <p>46,922,762</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>M0107O02</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>
                           <b>br+ ar+</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>AATAGAAGCCAGGCATGGTG</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>48,861,156</p>
                     </c>
                     <c ca="center">
                        <p>48,861,175</p>
                     </c>
                     <c ca="center">
                        <p>GTTAGGAGGAGGGTGGAACC</p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>56,663,181</p>
                     </c>
                     <c ca="center">
                        <p>56,663,200</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>br+ ar-</p>
                     </c>
                     <c ca="center">
                        <p>AATAGAAGCCAGGCATGGTG</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>48,861,156</p>
                     </c>
                     <c ca="center">
                        <p>48,861,175</p>
                     </c>
                     <c ca="center">
                        <p>TAGCCGTTCTGACTGGTGTG</p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>56,663,261</p>
                     </c>
                     <c ca="center">
                        <p>56,663,280</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>br+ al+</p>
                     </c>
                     <c ca="center">
                        <p>AATAGAAGCCAGGCATGGTG</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>48,861,156</p>
                     </c>
                     <c ca="center">
                        <p>48,861,175</p>
                     </c>
                     <c ca="center">
                        <p>TAGCTGGGATTACAGGTGCC</p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>56,646,379</p>
                     </c>
                     <c ca="center">
                        <p>56,646,398</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>br+ al-</p>
                     </c>
                     <c ca="center">
                        <p>AATAGAAGCCAGGCATGGTG</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>48,861,156</p>
                     </c>
                     <c ca="center">
                        <p>48,861,175</p>
                     </c>
                     <c ca="center">
                        <p>ACAACCTGTCCGACCAGAAC</p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>56,646,305</p>
                     </c>
                     <c ca="center">
                        <p>56,646,324</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>M0141F19</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>ar+ cr+</p>
                     </c>
                     <c ca="center">
                        <p>GGACAGAGGCTTTTGTAGCG</p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>56,687,628</p>
                     </c>
                     <c ca="center">
                        <p>56,687,647</p>
                     </c>
                     <c ca="center">
                        <p>ACCACGTAGACAAAGACGGG</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>59,173,964</p>
                     </c>
                     <c ca="center">
                        <p>59,173,983</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>ar+ cr-</p>
                     </c>
                     <c ca="center">
                        <p>GGACAGAGGCTTTTGTAGCG</p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>56,687,628</p>
                     </c>
                     <c ca="center">
                        <p>56,687,647</p>
                     </c>
                     <c ca="center">
                        <p>TTCTGGATTCTCCTTGGTGC</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>59,173,950</p>
                     </c>
                     <c ca="center">
                        <p>59,173,969</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>
                           <b>ar+ cl+</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>GGACAGAGGCTTTTGTAGCG</p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>56,687,628</p>
                     </c>
                     <c ca="center">
                        <p>56,687,647</p>
                     </c>
                     <c ca="center">
                        <p>ATTTGGTTCCTGGTGAGTGC</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>59,153,746</p>
                     </c>
                     <c ca="center">
                        <p>59,153,765</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>ar+ cl-</p>
                     </c>
                     <c ca="center">
                        <p>GGACAGAGGCTTTTGTAGCG</p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>56,687,628</p>
                     </c>
                     <c ca="center">
                        <p>56,687,647</p>
                     </c>
                     <c ca="center">
                        <p>AGAAGAACCCGACGACATTG</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>59,153,849</p>
                     </c>
                     <c ca="center">
                        <p>59,153,868</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>br+ cr+</p>
                     </c>
                     <c ca="center">
                        <p>TATCCTTCAGGAATCGCCAC</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>53,542,992</p>
                     </c>
                     <c ca="center">
                        <p>53,543,011</p>
                     </c>
                     <c ca="center">
                        <p>ACCACGTAGACAAAGACGGG</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>59,173,964</p>
                     </c>
                     <c ca="center">
                        <p>59,173,983</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>
                           <b>br+ cr-</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>TATCCTTCAGGAATCGCCAC</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>53,542,992</p>
                     </c>
                     <c ca="center">
                        <p>53,543,011</p>
                     </c>
                     <c ca="center">
                        <p>TTCTGGATTCTCCTTGGTGC</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>59,173,950</p>
                     </c>
                     <c ca="center">
                        <p>59,173,969</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>br+ cl+</p>
                     </c>
                     <c ca="center">
                        <p>TATCCTTCAGGAATCGCCAC</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>53,542,992</p>
                     </c>
                     <c ca="center">
                        <p>53,543,011</p>
                     </c>
                     <c ca="center">
                        <p>ATTTGGTTCCTGGTGAGTGC</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>59,153,746</p>
                     </c>
                     <c ca="center">
                        <p>59,153,765</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>br+ cl-</p>
                     </c>
                     <c ca="center">
                        <p>TATCCTTCAGGAATCGCCAC</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>53,542,992</p>
                     </c>
                     <c ca="center">
                        <p>53,543,011</p>
                     </c>
                     <c ca="center">
                        <p>AGAAGAACCCGACGACATTG</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>59,153,849</p>
                     </c>
                     <c ca="center">
                        <p>59,153,868</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>Primer sequence is the appropriately transformed (reversed, complemented, reverse-complemented) primer sequence to test a specific order/orientation of clone regions within the insert. Products were detected for reactions where the primer transform field is in bold. Primer combinations (e.g. ar+ br+) correspond to order and orientation of putative rearrangement and are described in detail in Additional data file 1.</p>
               </tblfn>
            </tbl>
            <fig id="F5">
               <title>
                  <p>Figure 5</p>
               </title>
               <caption>
                  <p>PCR reactions validating the presence of breakpoints in clones listed in Table 5</p>
               </caption>
               <text>
                  <p>PCR reactions validating the presence of breakpoints in clones listed in Table 5. Each reaction is labeled by the primer combination (e.g. AR+ CL+) used to test order and orientation of the clone's fused regions (Materials and methods; primer combination nomenculature is described in detail in Additional data file 1). The presence of a product demonstrates the adjacency of the regions within the clone's insert.</p>
               </text>
               <graphic file="gb-2007-8-10-r224-5"/>
            </fig>
            <p>To demonstrate that FPP can resolve complex rearrangements, we closely examined the FPP results for clone 3F5. In the original MCF7 ESP analysis, Volik <it>et al</it>. <abbrgrp><abbr bid="B25">25</abbr></abbrgrp> concluded that the shotgun sequence assembly of this clone is highly rearranged and composed of five distant regions of chromosomes 3 and 20 (3p14.1, 20q13.2, 20q13, 20q13.3 and 20q13.2). Our FPP analysis generally recapitulated the shotgun sequencing results - out of the five distinct insert segments found by sequencing, we detected four (Figure <figr fid="F6">6</figr>; detailed fingerprint alignments are shown in Additional data file 4; individual restriction fragment accounting is shown in Additional data file 5). The fifth segment, sized at 4,695 bp based on alignment of the clone's sequence to the reference genome, lacked the fragment complexity to confidently identify it by FPP. This small segment includes only two entire restriction fragments (marked with asterisks in the following list of intersecting fragments) in the restriction map of our enzyme combination (<it>Hin</it>dIII, 1 fragment (7.4 kb); <it>Eco</it>RI, 3 fragments (7.2 kb, 0.9 kb*, 8.5 kb); <it>Bgl</it>II, 2 fragments (4.1 kb, 8.6 kb); <it>Nco</it>II, 3 fragments (2.0 kb, 1.9 kb*, 6.2 kb); <it>Pvu</it>II, 2 fragments (5.8 kb, 13.1 kb)).</p>
            <fig id="F6">
               <title>
                  <p>Figure 6</p>
               </title>
               <caption>
                  <p>Detailed reconciliation of sequence and fingerprint alignments for clone 3F05, which contains at least four internal breakpoints</p>
               </caption>
               <text>
                  <p>Detailed reconciliation of sequence and fingerprint alignments for clone 3F05, which contains at least four internal breakpoints. FPP is capable of dissecting complex rearrangements in a clone, as illustrated in this figure showing the internal structure of M0003F05. This BAC was sequenced [26] and found to be composed of content from at least five distinct regions (A-E). FPP detected 4/5 of these regions. BLAT (grey rectangles with alignment orientation arrows) and FPP (thin black lines) alignments of M0003F05 are shown; values underneath coordinate pairs are differences in edge positions between BLAT and FPP alignments.</p>
               </text>
               <graphic file="gb-2007-8-10-r224-6"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Micro-rearrangements</p>
            </st>
            <p>Fingerprints provide a representation of the entire length of a clone's insert and, thus, are capable of mapping genome rearrangements internal to the clone insert that do not involve the ends of the clone. We identified 17 such small-scale candidate aberrations, and validated 4 of these using PCR (Table <tblr tid="T6">6</tblr>, Figure <figr fid="F7">7</figr>). PCR analysis of clone 12G17 yielded an amplicon approximately 400 bp smaller than expected, which supports the observation that experimental fragments were approximately 300 bp smaller than expected in this area. The fingerprint results are consistent with a hypothesis of a loss of a 313 bp SINE element evident in the genome sequence for this region. PCR analysis of clone 15O22 indicated an insertion of approximately 560 bp relative to the reference genome sequence. The experimental fragments nearest to the unmatched <it>in silico </it>fragments in this clone's fingerprints are all about 300 bp larger than expected. The results are consistent with a hypothesis of increased copy number of Alu (300 bp) or SINE (100 bp) elements evident in the genome sequence of this region.</p>
            <tbl id="T6">
               <title>
                  <p>Table 6</p>
               </title>
               <caption>
                  <p>Location of 17 putative small-scale aberrations identified in MCF7 clones</p>
               </caption>
               <tblbdy cols="9">
                  <r>
                     <c cspan="4" ca="left">
                        <p>Aberration position and size</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c cspan="3" ca="center">
                        <p>PCR validation</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Chr.</p>
                     </c>
                     <c ca="center">
                        <p>Start (bp)</p>
                     </c>
                     <c ca="center">
                        <p>End (bp)</p>
                     </c>
                     <c ca="center">
                        <p>Size (bp)</p>
                     </c>
                     <c ca="center">
                        <p>Affected/all clones</p>
                     </c>
                     <c ca="center">
                        <p>Sampled clone*</p>
                     </c>
                     <c ca="center">
                        <p>Reaction<sup>&#8224;</sup></p>
                     </c>
                     <c ca="center">
                        <p>Primers</p>
                     </c>
                     <c ca="center">
                        <p>Products (bp)</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="9">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>54,737,944</p>
                     </c>
                     <c ca="center">
                        <p>54,742,444</p>
                     </c>
                     <c ca="center">
                        <p>4,500</p>
                     </c>
                     <c ca="center">
                        <p>1/1</p>
                     </c>
                     <c ca="center">
                        <p>M0025G14</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>15,468,892</p>
                     </c>
                     <c ca="center">
                        <p>15,471,992</p>
                     </c>
                     <c ca="center">
                        <p>3,100</p>
                     </c>
                     <c ca="center">
                        <p>1/1</p>
                     </c>
                     <c ca="center">
                        <p>M0015O22</p>
                     </c>
                     <c ca="center">
                        <p>D</p>
                     </c>
                     <c ca="left">
                        <p>GGGGCCCTTTAGTGCCTTAG</p>
                        <p>AATTGCCAAGTCAGAGGCAG</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>4,686</b>
                        </p>
                        <p>5,251 (+565)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>110,086,572</p>
                     </c>
                     <c ca="center">
                        <p>110,101,972</p>
                     </c>
                     <c ca="center">
                        <p>15,400</p>
                     </c>
                     <c ca="center">
                        <p>1/1</p>
                     </c>
                     <c ca="center">
                        <p>M0006P20</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>63,591,911</p>
                     </c>
                     <c ca="center">
                        <p>63,594,011</p>
                     </c>
                     <c ca="center">
                        <p>2,100</p>
                     </c>
                     <c ca="center">
                        <p>2/5</p>
                     </c>
                     <c ca="center">
                        <p>M0118E13</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>159,597,920</p>
                     </c>
                     <c ca="center">
                        <p>159,602,020</p>
                     </c>
                     <c ca="center">
                        <p>4,100</p>
                     </c>
                     <c ca="center">
                        <p>1/1</p>
                     </c>
                     <c ca="center">
                        <p>M0012G17</p>
                     </c>
                     <c ca="center">
                        <p>B</p>
                     </c>
                     <c ca="left">
                        <p>TACTTACGGCAGAGGTTGGG</p>
                        <p>TCTGATTTTGGAGCTTTTGG</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>6,411</b>
                        </p>
                        <p>6,017 (-394)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>4</p>
                     </c>
                     <c ca="center">
                        <p>13,455,944</p>
                     </c>
                     <c ca="center">
                        <p>13,464,544</p>
                     </c>
                     <c ca="center">
                        <p>8,600</p>
                     </c>
                     <c ca="center">
                        <p>1/1</p>
                     </c>
                     <c ca="center">
                        <p>M0004J18</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>177,652,902</p>
                     </c>
                     <c ca="center">
                        <p>177,661,002</p>
                     </c>
                     <c ca="center">
                        <p>8,100</p>
                     </c>
                     <c ca="center">
                        <p>1/1</p>
                     </c>
                     <c ca="center">
                        <p>M0019C11</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>10</p>
                     </c>
                     <c ca="center">
                        <p>45,658,295</p>
                     </c>
                     <c ca="center">
                        <p>45,662,695</p>
                     </c>
                     <c ca="center">
                        <p>4,400</p>
                     </c>
                     <c ca="center">
                        <p>1/1</p>
                     </c>
                     <c ca="center">
                        <p>M0021J21</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>18</p>
                     </c>
                     <c ca="center">
                        <p>13,660,940</p>
                     </c>
                     <c ca="center">
                        <p>13,670,040</p>
                     </c>
                     <c ca="center">
                        <p>9,100</p>
                     </c>
                     <c ca="center">
                        <p>1/1</p>
                     </c>
                     <c ca="center">
                        <p>M0040N18</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>19</p>
                     </c>
                     <c ca="center">
                        <p>46,075,421</p>
                     </c>
                     <c ca="center">
                        <p>46,081,021</p>
                     </c>
                     <c ca="center">
                        <p>5,600</p>
                     </c>
                     <c ca="center">
                        <p>1/1</p>
                     </c>
                     <c ca="center">
                        <p>M0005H04</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>8,877,965</p>
                     </c>
                     <c ca="center">
                        <p>8,903,965</p>
                     </c>
                     <c ca="center">
                        <p>26,000</p>
                     </c>
                     <c ca="center">
                        <p>1/1</p>
                     </c>
                     <c ca="center">
                        <p>M0013M22</p>
                     </c>
                     <c ca="center">
                        <p>A</p>
                     </c>
                     <c ca="left">
                        <p>CTTGGGTTGGGAACTGAAAG</p>
                        <p>CCTCTTCTGGGACTGCTGAC</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>28,006</b>
                        </p>
                        <p>4,925 (-23,081)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>39,042,929</p>
                     </c>
                     <c ca="center">
                        <p>39,047,029</p>
                     </c>
                     <c ca="center">
                        <p>4,100</p>
                     </c>
                     <c ca="center">
                        <p>1/1</p>
                     </c>
                     <c ca="center">
                        <p>M0011K13</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>48,823,455</p>
                     </c>
                     <c ca="center">
                        <p>48,827,555</p>
                     </c>
                     <c ca="center">
                        <p>4,100</p>
                     </c>
                     <c ca="center">
                        <p>3/21</p>
                     </c>
                     <c ca="center">
                        <p>M0107O02</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>51,886,035</p>
                     </c>
                     <c ca="center">
                        <p>51,891,935</p>
                     </c>
                     <c ca="center">
                        <p>5,900</p>
                     </c>
                     <c ca="center">
                        <p>1/1</p>
                     </c>
                     <c ca="center">
                        <p>M0089C13</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>52,157,503</p>
                     </c>
                     <c ca="center">
                        <p>52,161,003</p>
                     </c>
                     <c ca="center">
                        <p>3,500</p>
                     </c>
                     <c ca="center">
                        <p>1/1</p>
                     </c>
                     <c ca="center">
                        <p>M0004L22</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>59,158,037</p>
                     </c>
                     <c ca="center">
                        <p>59,163,037</p>
                     </c>
                     <c ca="center">
                        <p>5,000</p>
                     </c>
                     <c ca="center">
                        <p>1/2</p>
                     </c>
                     <c ca="center">
                        <p>M0141F19</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>X</p>
                     </c>
                     <c ca="center">
                        <p>97,281,472</p>
                     </c>
                     <c ca="center">
                        <p>97,287,472</p>
                     </c>
                     <c ca="center">
                        <p>6,000</p>
                     </c>
                     <c ca="center">
                        <p>1/1</p>
                     </c>
                     <c ca="center">
                        <p>M0018J12</p>
                     </c>
                     <c ca="center">
                        <p>C</p>
                     </c>
                     <c ca="left">
                        <p>CCCACCAATGGATTACAACC</p>
                        <p>CTTGAACCTGGGAAGCAGAG</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>7,828</b>
                        </p>
                        <p>4,971 (-2,857)</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>Four aberrations were tested with PCR using the primers shown here. The expected primer products based on inter-primer distance on the reference genome are shown in bold, with the observed product sizes shown below. *See Additional data file 2. <sup>&#8224;</sup>See Figure 7.</p>
               </tblfn>
            </tbl>
            <fig id="F7">
               <title>
                  <p>Figure 7</p>
               </title>
               <caption>
                  <p>PCR reactions validating small-scale aberrations listed in Table 6</p>
               </caption>
               <text>
                  <p>PCR reactions validating small-scale aberrations listed in Table 6. Reactions are labeled A-D, corresponding to the aberrations with the same label in Table 6. In each case the observed product sizes, shown here, are different from the expected sizes based on the inter-primer distance on the reference sequence.</p>
               </text>
               <graphic file="gb-2007-8-10-r224-7"/>
            </fig>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Discussion</p>
         </st>
         <p>Using computational simulations and restriction fingerprinting of a small number of BAC clones, we assessed the utility of clone fingerprints in detecting genomic rearrangements. We fingerprinted 493 BAC clones derived from the MCF7 breast cancer cell line genome that were previously analyzed by ESP <abbrgrp><abbr bid="B25">25</abbr></abbrgrp>. Using the clone fingerprints, we aligned the clones to the reference genome sequence assembly (UCSC, hg17) and have mapped the candidate positions of 51 rearrangement breakpoints and 17 micro-rearrangements within clones in the set. Further, we identified other rearrangement events within the clone set that were cryptic to ESP.</p>
         <p>The use of fingerprints to detect rearrangements provides several advantages, based on the fact that fingerprints sample essentially all of a clone's insert. First, at equivalent sampling depths, the position of a rearrangement breakpoint within a clone can be more precisely determined using FPP than with ESP. Second, fingerprint patterns can be used to locate differences internal to the insert between the clone and the reference genome. This advantage, which is not shared by ESP (Additional data files 2 and 3), can be leveraged to detect small rearrangements such as single nucleotide polymorphisms, micro-deletions, micro-insertions or other local rearrangements. There is currently no experimental method that can be applied on a whole-genome level that is sensitive to the identification of both balanced and unbalanced rearrangements on the order of 1-5 kb in size within the genome. While extremely high-density oligonucleotide arrays can, in principle, detect aberrations with a spatial frequency equal to probe spacing, confirmation of multiple adjacent probes are required to assign statistical significance to the result. Finally, a major strength of fingerprint alignments is their relative insensitivity to sequence repeats. Although approximately 50% of the human genome sequence assembly (hg17) lies in repeat regions, only 7% is found in contiguous repeat units longer than 3.9 kb, which is the average sizeable <it>Hin</it>dIII restriction fragment.</p>
         <p>Fingerprint-based alignments confirmed a lack of rearrangement in the vast majority of clones (96%) and also confirmed the presence of rearrangements in 68% of those clones in the test set whose ESP data indicated a breakpoint. The high level of confirmation of clone integrity reflects the low incidence of false-positive alignments for clones derived from a single location. The fraction of rearrangements detected is lower than in ESP due to the inherent limitation of fingerprint-based alignments to align small regions of the genome. The use of larger BACs or greater levels of coverage redundancy (Figure <figr fid="F8">8</figr>) would be expected to address a significant portion of these apparent false-negative FPP results.</p>
         <fig id="F8">
            <title>
               <p>Figure 8</p>
            </title>
            <caption>
               <p>Expected fraction of breakpoints, given five-fold redundant clone coverage, captured by &#8805;N clones with the distance between breakpoint and clone terminus larger than detection cutoff</p>
            </caption>
            <text>
               <p>Expected fraction of breakpoints, given five-fold redundant clone coverage, captured by &#8805;N clones with the distance between breakpoint and clone terminus larger than detection cutoff. The plot shows detection profiles for 150 kb and 220 kb clones. The plot illustrates the benefit of redundant coverage and of using clones with larger inserts - for a given detection cutoff, a breakpoint is captured by significantly more clones on average. The detection sensitivity (Figure 4) needs to be applied to the fraction of breakpoints