<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>gb-2007-8-7-r147</ui>
   <ji>GBJ</ji>
   <fm>
      <dochead>Research</dochead>
      <bibl>
         <title>
            <p>Meta-analysis of primary target genes of peroxisome proliferator-activated receptors</p>
         </title>
         <aug>
            <au id="A1">
               <snm>Hein&#228;niemi</snm>
               <fnm>Merja</fnm>
               <insr iid="I1"/>
               <insr iid="I2"/>
               <email>mmatilai@messi.uku.fi</email>
            </au>
            <au id="A2">
               <snm>Uski</snm>
               <fnm>J Oskari</fnm>
               <insr iid="I1"/>
               <email>jouski@hytti.uku.fi</email>
            </au>
            <au id="A3">
               <snm>Degenhardt</snm>
               <fnm>Tatjana</fnm>
               <insr iid="I1"/>
               <email>degenhar@messi.uku.fi</email>
            </au>
            <au id="A4" ca="yes">
               <snm>Carlberg</snm>
               <fnm>Carsten</fnm>
               <insr iid="I1"/>
               <insr iid="I2"/>
               <email>carsten.carlberg@uni.lu</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Department of Biochemistry, University of Kuopio, FIN-70211 Kuopio, Finland</p>
            </ins>
            <ins id="I2">
               <p>Life Sciences Research Unit, University of Luxembourg, L-1511 Luxembourg</p>
            </ins>
         </insg>
         <source>Genome Biology</source>
         <issn>1465-6906</issn>
         <pubdate>2007</pubdate>
         <volume>8</volume>
         <issue>7</issue>
         <fpage>R147</fpage>
         <url>http://genomebiology.com/2007/8/7/R147</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">17650321</pubid>
               <pubid idtype="doi">10.1186/gb-2007-8-7-r147</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>25</day>
               <month>5</month>
               <year>2007</year>
            </date>
         </rec>
         <revrec>
            <date>
               <day>2</day>
               <month>7</month>
               <year>2007</year>
            </date>
         </revrec>
         <acc>
            <date>
               <day>25</day>
               <month>7</month>
               <year>2007</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>25</day>
               <month>07</month>
               <year>2007</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2007</year>
         <collab>Hein&#228;niemi et al.; licensee BioMed Central Ltd.</collab>
         <note>This is an open access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <shorttitle>
         <p>PPAR target genes</p>
      </shorttitle>
      <shortabs>
         <p>A combined experimental and <it>in silico </it>approach identifies Peroxisome Proliferator Activated Receptor (PPAR) binding sites and six novel target genes in the human genome.</p>
      </shortabs>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>Peroxisome proliferator-activated receptors (PPARs) are known for their critical role in the development of diseases, such as obesity, cardiovascular disease, type 2 diabetes and cancer. Here, an <it>in silico </it>screening method is presented, which incorporates experiment- and informatics-derived evidence, such as DNA-binding data of PPAR subtypes to a panel of PPAR response elements (PPREs), PPRE location relative to the transcription start site (TSS) and PPRE conservation across multiple species, for more reliable prediction of PPREs.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p><it>In vitro </it>binding and <it>in vivo </it>functionality evidence agrees with <it>in silico </it>predictions, validating the approach. The experimental analysis of 30 putative PPREs in eight validated PPAR target genes indicates that each gene contains at least one functional, strong PPRE that occurs without positional bias relative to the TSS. An extended analysis of the cross-species conservation of PPREs reveals limited conservation of PPRE patterns, although PPAR target genes typically contain strong or multiple medium strength PPREs. Human chromosome 19 was screened using this method, with validation of six novel PPAR target genes.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>An <it>in silico </it>screening approach is presented, which allows increased sensitivity of PPAR binding site and target gene detection.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <meta>
      <classifications>
         <classification type="BMC" subtype="man_spc_id" id="30010002">Bioinformatics</classification>
         <classification type="BMC" subtype="man_spc_id" id="30010010">Genome studies</classification>
         <classification type="BMC" subtype="man_spc_id" id="30010015">Model organisms</classification>
      </classifications>
   </meta>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>Lipid level dys-regulation is a characteristic common to some of the most prevalent medical disorders, including obesity, cardiovascular disease and type 2 diabetes <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. Nuclear receptors (NRs) are transcription factors that have important roles in these diseases, because many of them have lipophilic compounds as ligands, including cholesterol, fatty acids and their metabolic derivatives <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>. For example, native and oxidized polyunsaturated fatty acids as well as arachidonic acid derivatives, such as prostaglandins and prostacyclins, selectively bind the NRs peroxisome proliferator-activated receptor (PPAR)&#945;, PPAR&#947; and PPAR&#946;/&#948; and stimulate their ability to activate target genes transcriptionally <abbrgrp><abbr bid="B3">3</abbr></abbrgrp>. The PPAR transcription factors are prominent players in the metabolic syndrome, because of their role as important regulators of lipid storage and catabolism <abbrgrp><abbr bid="B4">4</abbr></abbrgrp>. However, they also regulate cellular growth and differentiation and, therefore, have an impact on hyper-proliferative diseases, such as cancer <abbrgrp><abbr bid="B5">5</abbr></abbrgrp>. Known primary PPAR targets may be incompletely characterized for their regulatory regions involved in their regulation by PPARs. In rodents a large number of significantly inducible PPAR target genes have been identified <abbrgrp><abbr bid="B6">6</abbr><abbr bid="B7">7</abbr></abbrgrp>, while in human cell lines only a few genes are activated more than two-fold by PPAR ligands <abbrgrp><abbr bid="B8">8</abbr></abbrgrp>. In parallel, PPARs have a relatively high basal activity <abbrgrp><abbr bid="B9">9</abbr></abbrgrp>. These facts suggest that there is a need to identify new PPAR response elements (PPREs) and target genes in an unbiased way that is independent of ligand binding and encompasses the whole human genome sequence.</p>
         <p>The <it>in silico </it>searching of the genome sequence provides another way to identify target genes. An essential prerequisite for the direct modulation of transcription by PPAR ligands is the location of at least one activated PPAR protein close to the transcription start site (TSS) of the respective primary PPAR target gene. This is commonly achieved through the specific binding of PPARs to a PPRE and DNA-looping towards the TSS <abbrgrp><abbr bid="B10">10</abbr></abbrgrp>. In detail, the DNA-binding domain of PPARs contacts the major groove of a double-stranded hexameric DNA sequence with the optimal AGGTCA core binding sequence. PPARs bind to DNA as heterodimers with the NR retinoid X receptor (RXR) <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>. PPREs are therefore formed by two hexameric core binding motifs in a direct repeat orientation with an optimal spacing of one nucleotide (DR1), where PPAR occupies the 5'-motif <abbrgrp><abbr bid="B12">12</abbr></abbrgrp>. However, characterization of PPREs from regulated gene promoters has resulted in a large collection of PPREs that deviate significantly from this consensus sequence. The ubiquity of such PPRE-like sequences on a whole genome level is in contrast to the number of potential PPAR target genes in a physiological context (a few hundred to a few thousand per tissue <abbrgrp><abbr bid="B13">13</abbr></abbrgrp> and the number of receptor molecules (a few thousand per cell). A recent effort to better model the binding preferences of PPARs used position weight matrices to describe all published PPREs <abbrgrp><abbr bid="B14">14</abbr></abbrgrp>. However, such an approach has limited ability to predict <it>bona fide </it>PPAR binding <it>in vivo</it>.</p>
         <p>In addition to binding strength, a number of additional parameters could influence the functionality of a PPRE. One common trend in location of transcription factor binding sites is a positional bias towards the TSS. This would be apparent from the collection of identified PPREs, but is in contrast with a multi-genome comparison of NR binding site distribution <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>. Furthermore, a common approach for the detection of functional binding sites is to rely on conservation. However, maintenance of responsiveness may not require conservation of exact binding site composition. In contrast, there is also evidence to indicate that regulatory regions may evolve with more flexible constraints. Such a stabilizing model of evolution was proposed based on conservation patterns in the <it>Drosophila eve </it>gene enhancer, where patterns and locations of binding sites were shown to be divergent, but maintain identical patterns of expression <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>. This turnover has been studied with computer simulations demonstrating that appearance and fixation of novel binding sites occurs in short evolutionary time frames <abbrgrp><abbr bid="B17">17</abbr></abbrgrp>.</p>
         <p>In this study, we performed an experiment-based informatics approach for the reliable identification of PPREs and PPAR target genes. We chose to take an unbiased approach for the characterization of PPRE binding variants, utilizing an experimental binding strength dataset. As a first step, we performed <it>in silico </it>screening and binding strength prediction of PPREs in eight known PPAR target genes and found for each four to nine PPREs within a 10 kB distance of their respective TSSs. Seventeen of these (in total 23) genomic regions were found to be functional in liver- and kidney-derived cells and 12 of them associated with PPAR&#945; and its partner proteins. Three of these regions are located in the <it>uncoupling protein 3 </it>(<it>UCP3</it>) gene, for which so far no PPREs had been identified. Next a collection of 38 validated PPAR target genes in human was used for the detection of features of binding site composition in these genes. In conclusion, significant diversification of binding site composition between species was often observed. However, typically these genes contain strong or multiple medium strength PPREs. Based on this insight, we screened the whole of human chromosome 19 (containing 1,445 annotated genes) and the corresponding syntenic regions in the mouse genome (956 known orthologs) and found that our PPAR responsiveness criteria were passed by 116 genes in both species. Under more stringent criteria 8.7% of human genes in the same chromosome would likely be PPAR targets. All six genes, chosen to be representative from this panel, were shown to be primary PPAR&#945; targets. For one of these, the <it>longevity-assurance homologue 1 </it>(<it>LASS1</it>) gene, we demonstrate that a genomic region containing two PPREs is functional and recruits PPAR&#945; as well as its partner proteins.</p>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <sec>
            <st>
               <p>A PPRE binding strength prediction scheme</p>
            </st>
            <p>Recently, we characterized the <it>in vitro </it>binding preferences of the three PPAR subtypes on a panel of 39 systematic single nucleotide variations of the consensus DR1-type PPRE (AGGTCAAAGGTCA) <abbrgrp><abbr bid="B18">18</abbr></abbrgrp>. Based on this analysis we subdivided the single nucleotide variants into three classes (Table <tblr tid="T1">1</tblr>). Sequences in class I are bound by the PPAR subtypes with a strength of 75 &#177; 15% of that of the consensus PPRE; sequences in class II are bound with a strength of 45 &#177; 15% of that of the consensus PPRE; and sequences in class III are bound with a strength of 15 &#177; 15% of that of the consensus PPRE. Although the overall binding pattern of the three PPAR subtypes showed no major differences, some variations gave rise to a PPAR subtype-specific classification. We observed that the number and class of variations seem to correlate with experimental binding. Therefore, we decided to take the concept further to create a classifier for PPREs based on binding data. We sorted a total of 136 DR1-type response elements (REs; including combinations of multiple variations) according to the number and class of variations (Figure <figr fid="F1">1</figr>). The <it>in vitro </it>binding strength to these REs in relation to the consensus DR1-type PPRE was determined by gelshift assays for the RXR heterodimers of all three PPAR subtypes. For each category in Figure <figr fid="F1">1</figr> the average of the relative binding strength was determined (based on 6 to 47 RE/PPAR subtype combinations). REs with 1/0/0, 2/0/0 and 0/1/0 variations (where the numbers indicate the number of variations for the classes I, II and III, respectively) bound the receptor strongly (67%, 43% and 39% relative binding, respectively), REs with 3/0/0, 1/1/0 and 0/0/1 variations were medium PPREs (29%, 22% and 20%, respectively) and REs with 0/2/0, 2/1/0, 1/0/1, 3/1/0 and 4/0/0 variations were considered to be weak PPREs (8%, 4%, 3%, 1% and 1%, respectively). We set 1% as a cut-off limit. Representative DR1-type REs with increasing numbers of more drastic variations were examined as well (Additional data file 1), but these elements were not considered as functional PPREs. Please note that the published PPRE of the <it>acyl-CoA oxidase 1 </it>(<it>ACOX1</it>) gene <abbrgrp><abbr bid="B19">19</abbr></abbrgrp> belongs to the latter list.</p>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>Systematic variation from consensus DR1-type PPRE</p>
               </caption>
               <tblbdy cols="14">
                  <r>
                     <c ca="left">
                        <p>Percent binding strength</p>
                     </c>
                     <c cspan="13" ca="center">
                        <p>PPRE position</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c cspan="13">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>4</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>6</p>
                     </c>
                     <c ca="center">
                        <p>7</p>
                     </c>
                     <c ca="center">
                        <p>8</p>
                     </c>
                     <c ca="center">
                        <p>9</p>
                     </c>
                     <c ca="center">
                        <p>10</p>
                     </c>
                     <c ca="center">
                        <p>11</p>
                     </c>
                     <c ca="center">
                        <p>12</p>
                     </c>
                     <c ca="center">
                        <p>13</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="14">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c cspan="14" ca="left">
                        <p>
                           <b>PPAR&#945;</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>Consensus (90-100)</p>
                     </c>
                     <c ca="center">
                        <p>A/G</p>
                     </c>
                     <c ca="center">
                        <p>G</p>
                     </c>
                     <c ca="center">
                        <p>G</p>
                     </c>
                     <c ca="center">
                        <p>T</p>
                     </c>
                     <c ca="center">
                        <p>A/C</p>
                     </c>
                     <c ca="center">
                        <p>A</p>
                     </c>
                     <c ca="center">
                        <p>A</p>
                     </c>
                     <c ca="center">
                        <p>A</p>
                     </c>
                     <c ca="center">
                        <p>G</p>
                     </c>
                     <c ca="center">
                        <p>G</p>
                     </c>
                     <c ca="center">
                        <p>T</p>
                     </c>
                     <c ca="center">
                        <p>C</p>
                     </c>
                     <c ca="center">
                        <p>A</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>Class I (60-90)</p>
                     </c>
                     <c ca="center">
                        <p>T</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>C</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>G</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>T</p>
                     </c>
                     <c ca="center">
                        <p>G</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>T</p>
                     </c>
                     <c ca="center">
                        <p>C/G</p>
                     </c>
                     <c ca="center">
                        <p>A/G</p>
                     </c>
                     <c ca="center">
                        <p>G</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>Class II (30-60)</p>
                     </c>
                     <c ca="center">
                        <p>C</p>
                     </c>
                     <c ca="center">
                        <p>T</p>
                     </c>
                     <c ca="center">
                        <p>A/T</p>
                     </c>
                     <c ca="center">
                        <p>A/C/G</p>
                     </c>
                     <c ca="center">
                        <p>T</p>
                     </c>
                     <c ca="center">
                        <p>T</p>
                     </c>
                     <c ca="center">
                        <p>C/G</p>
                     </c>
                     <c ca="center">
                        <p>C</p>
                     </c>
                     <c ca="center">
                        <p>A/C/T</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>T</p>
                     </c>
                     <c ca="center">
                        <p>C/T</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>Class III (0-30)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>A/C</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>C/G</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>T</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>A/C</p>
                     </c>
                     <c ca="center">
                        <p>A</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="14" ca="left">
                        <p>
                           <b>PPAR&#947;</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>Consensus (90-100)</p>
                     </c>
                     <c ca="center">
                        <p>A/G</p>
                     </c>
                     <c ca="center">
                        <p>G</p>
                     </c>
                     <c ca="center">
                        <p>G</p>
                     </c>
                     <c ca="center">
                        <p>T</p>
                     </c>
                     <c ca="center">
                        <p>C/G</p>
                     </c>
                     <c ca="center">
                        <p>A</p>
                     </c>
                     <c ca="center">
                        <p>A</p>
                     </c>
                     <c ca="center">
                        <p>A</p>
                     </c>
                     <c ca="center">
                        <p>G</p>
                     </c>
                     <c ca="center">
                        <p>G</p>
                     </c>
                     <c ca="center">
                        <p>T</p>
                     </c>
                     <c ca="center">
                        <p>C</p>
                     </c>
                     <c ca="center">
                        <p>A</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>Class I (60-90)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>C/G</p>
                     </c>
                     <c ca="center">
                        <p>A/T</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>T</p>
                     </c>
                     <c ca="center">
                        <p>G</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>T</p>
                     </c>
                     <c ca="center">
                        <p>C/G</p>
                     </c>
                     <c ca="center">
                        <p>A/G/T</p>
                     </c>
                     <c ca="center">
                        <p>G</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>Class II (30-60)</p>
                     </c>
                     <c ca="center">
                        <p>C/T</p>
                     </c>
                     <c ca="center">
                        <p>A/T</p>
                     </c>
                     <c ca="center">
                        <p>T</p>
                     </c>
                     <c ca="center">
                        <p>A</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>C</p>
                     </c>
                     <c ca="center">
                        <p>C</p>
                     </c>
                     <c ca="center">
                        <p>A/C/T</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>C/T</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>Class III (0-30)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>C</p>
                     </c>
                     <c ca="center">
                        <p>A/C</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>C/G/T</p>
                     </c>
                     <c ca="center">
                        <p>G</p>
                     </c>
                     <c ca="center">
                        <p>T</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>A/C</p>
                     </c>
                     <c ca="center">
                        <p>A</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="14" ca="left">
                        <p>
                           <b>PPAR&#946;/&#948;</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>Consensus (90-100)</p>
                     </c>
                     <c ca="center">
                        <p>A/G</p>
                     </c>
                     <c ca="center">
                        <p>G</p>
                     </c>
                     <c ca="center">
                        <p>G</p>
                     </c>
                     <c ca="center">
                        <p>T</p>
                     </c>
                     <c ca="center">
                        <p>C</p>
                     </c>
                     <c ca="center">
                        <p>A</p>
                     </c>
                     <c ca="center">
                        <p>A</p>
                     </c>
                     <c ca="center">
                        <p>A</p>
                     </c>
                     <c ca="center">
                        <p>G</p>
                     </c>
                     <c ca="center">
                        <p>G</p>
                     </c>
                     <c ca="center">
                        <p>T</p>
                     </c>
                     <c ca="center">
                        <p>C</p>
                     </c>
                     <c ca="center">
                        <p>A</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>Class I (60-90)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>C/G</p>
                     </c>
                     <c ca="center">
                        <p>G/T</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>T</p>
                     </c>
                     <c ca="center">
                        <p>G</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>T</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>G/T</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>Class II (30-60)</p>
                     </c>
                     <c ca="center">
                        <p>C</p>
                     </c>
                     <c ca="center">
                        <p>A/T</p>
                     </c>
                     <c ca="center">
                        <p>T</p>
                     </c>
                     <c ca="center">
                        <p>A</p>
                     </c>
                     <c ca="center">
                        <p>A</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>A/T</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>C/G</p>
                     </c>
                     <c ca="center">
                        <p>A</p>
                     </c>
                     <c ca="center">
                        <p>G/C/T</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>Class III (0-30)</p>
                     </c>
                     <c ca="center">
                        <p>T</p>
                     </c>
                     <c ca="center">
                        <p>C</p>
                     </c>
                     <c ca="center">
                        <p>A/C</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>C/G/T</p>
                     </c>
                     <c ca="center">
                        <p>C/G</p>
                     </c>
                     <c ca="center">
                        <p>C/T</p>
                     </c>
                     <c ca="center">
                        <p>C</p>
                     </c>
                     <c ca="center">
                        <p>A/C</p>
                     </c>
                     <c ca="center">
                        <p>A</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>The binding strengths of <it>in vitro </it>translated PPAR-RXR heterodimers to 39 systematic variations of the DR1-type consensus PPRE AGGTCAAAGGTCA were determined by gelshift assays in reference to this consensus PPRE. Based on their average binding strength, all variations are sorted into three classes.</p>
               </tblfn>
            </tbl>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>Testing the RE classification scheme on natural DR1-type sequences</p>
               </caption>
               <text>
                  <p>Testing the RE classification scheme on natural DR1-type sequences. The average binding strength of <it>in vitro </it>translated PPAR-RXR heterodimers to DR1-type PPREs was determined by gelshift assays in reference to the consensus PPRE AGGTCAAAGGTCA, including all categories (that is, combinations of the classes I, II and III) that resulted in an average binding of at least 1%. Variations from the consensus PPRE are highlighted in green for PPAR&#945;, in dark blue for PPAR&#947; and in light blue for PPAR&#946;/&#948;. In total, the <it>in vitro </it>binding data of 136 different REs were used (the non-binding DR1-type REs are shown in Additional data file 1), with a minimum of six sequences for each category. SD, standard deviation.</p>
               </text>
               <graphic file="gb-2007-8-7-r147-1"/>
            </fig>
            <p>The performance of the classifier in predicting novel binding sites was simulated by random sampling of the experimental data in Figure <figr fid="F1">1</figr> and Additional data file 1 into a training set that was used to re-calculate the category averages at each initialization (approximately 10% of data was used in training) and a validation set that can be used in testing (rest of the data). Representative data from 10 rounds of simulation are shown in Additional data file 2. Interestingly, the category averages were relatively robust to changes in the set of sequences used to calculate the average. This suggests that the introduction of further sequences that belong to the same category will not drastically affect the classifier performance.</p>
         </sec>
         <sec>
            <st>
               <p>Comparison of PPRE classifier to matrix methods</p>
            </st>
            <p>In order to compare the classifier to the traditional matrix methods, we created a position-specific weight matrix (PSWM) and a position-specific affinity matrix (PSAM) using the PPAR&#947; data from Figure <figr fid="F1">1</figr> and Additional data file 1. For the PSWM we took all medium and strong PPREs with multiple variations from Figure <figr fid="F1">1</figr>, calculated base pair frequencies and converted these to matrix values by logarithmic transformation, where an equal background frequency was assumed and a pseudocount of 0.01 was included for non-observed base-pairs (bp). We chose not to include the systematic single nucleotide variation screen data, since this would have biased the matrix strongly towards the consensus PPRE. In total, 20 sequences were used to construct the matrix, which is in the order of known binding sites typically used as a basis of such matrices in databases, such as JASPAR or TRANSFAC. The PSAM was chosen to represent a matrix method utilizing the single nucleotide screening data, in order to see if these data are sufficient to capture the binding preferences of multiple variation data.</p>
            <p>We compared the three methods first on the level of their ability to detect binding. True positive and false positive rates (TPRs and FPRs, respectively) were calculated using different cut-off values for each method and are represented in the form of a receiver operating characteristic (ROC) curve (Figure <figr fid="F2">2a</figr>). The line of no discrimination is indicated as a diagonal line; perfect performance would give a TPR of 1 and FPR of 0. For all methods an optimum performance was detected with FPR from 20-30% and TPR varying from around 90% for the PPRE classifier to 75% for the PSAM. For clarity, one representative classifier curve out of ten calculated is shown.</p>
            <fig id="F2">
               <title>
                  <p>Figure 2</p>
               </title>
               <caption>
                  <p>ROC curves comparing <it>in silico </it>methods</p>
               </caption>
               <text>
                  <p>ROC curves comparing <it>in silico </it>methods. <b>(a) </b>A PSWM constructed from 20 medium and strong PPREs that contain multiple variations, and a PSAM constructed using the single nucleotide data and ten initializations of PPRE classifier created based on Table 1 and random sampling of Figure 1 and Additional data file 1 were compared for their ability to detect binding. True positive rates (TPRs) and false positive rates (FPRs) were calculated, with false positives given when no binding was detected despite prediction, and false negatives given when binding was detected but not predicted (correlation of matrix scores to predicted binding was done based on lines fitted to correlation plots shown in Additional data file 3). A line of no discrimination is a diagonal line and optimum performance approaches the value (0, 1). For clarity, only one representative instance of a PPRE classifier is shown in (a). <b>(b) </b>To assess how good the predicted experimental binding estimates were, the performance of the method used was tested with a 15% tolerance interval for a match to experimental binding (5% when prediction was 15% or less) using a single cut-off (the optimal cut-off was 3% for the classifier, 25% or a score of 0.0000015 for PSAM, and 20% or a score of 4.7 for PSWM) and calculating again the FPR and TPR for each method. False positives in this case represented predictions that were too high and false negatives predictions that were too low.</p>
               </text>
               <graphic file="gb-2007-8-7-r147-2"/>
            </fig>
            <p>Next we wanted to know whether the scores correlated with experimental binding when comparing single and multiple variation data. We examined this with correlation plots using the PPAR&#947; data as shown in Additional data file 3. In parallel, we set a tolerance interval of 15% relative to the consensus sequence for a match between predicted binding strength and experimental binding (5%, if the predicted binding was less than 15%) and calculated predictions by the different methods. The equations of the lines fitted to the single nucleotide data (Additional data file 3) were used to correlate matrix scores with binding strength. The ideal cut-off values based on the ROC curves were used in the scoring and produced respective data points in the ROC space (Figure <figr fid="F2">2b</figr>), this time with TPR reflecting correct predictions (no underestimation, if 1) and FPR reflecting overestimated values. Several data points are given for the classifier, representing ten separate initializations with the sampling of training and validation sets.</p>
            <p>When comparing the performance of the PSWM between the different datasets (Additional data file 3), a rather clear distinction between the scores of single nucleotide variations (medium and strong PPREs) and the non-binding PPRE classes was observed. The partition of single nucleotide data into two groups of data points shows that the matrix handles variations that were not included in the PPRE set by penalizing these with a constant negative score. Values above 6 still separated quite well from the data points of the last panel. However, the multiple variation data that include weak to strong PPREs were not well resolved by the matrix. Instead a large amount of weak binding sites received high matrix scores, which seems to cause the high FPR rate.</p>
            <p>Despite the fit to the single nucleotide data, the PSAM did not offer a significant improvement to the prediction of multiple variations and also had problems differentiating the non-binding PPREs. This is evident by examining the data points between matrix values 0.000001 and 0.000002. This interval includes weak to strong PPREs with identical matrix scores leading to an increased FPR rate. The classifier correlation was weaker for single nucleotide data compared to the PSAM, but the same variation was preserved for multiple variation data. A clear separation between weak PPREs and those of medium and strong strength was achieved. The ability to use a PPRE prediction that also correlates with binding strength is a clear advantage for the evaluation of putative binding site content of target genes. Based on the different comparisons, we chose the PPRE classifier as most suited for the follow-up analysis of PPAR target genes.</p>
         </sec>
         <sec>
            <st>
               <p><it>In silico </it>analysis of known PPAR target genes</p>
            </st>
            <p>We tested the performance of our PPRE binding strength prediction scheme on eight primary PPAR target genes. We selected the well-known up-regulated human genes <it>ACOX1 </it><abbrgrp><abbr bid="B19">19</abbr></abbrgrp>, <it>carnitine palmitoyl transferase </it>(<it>CPT</it>) <it>1B </it><abbrgrp><abbr bid="B20">20</abbr></abbrgrp> and <it>PPAR&#945; </it><abbrgrp><abbr bid="B21">21</abbr></abbrgrp> and the established down-regulated gene <it>apolipoprotein </it>(<it>APO</it>) <it>C3 </it><abbrgrp><abbr bid="B22">22</abbr></abbrgrp>. The genes <it>angiopoietin-like 4 </it>(<it>ANGPLT4</it>) <abbrgrp><abbr bid="B23">23</abbr></abbrgrp>, <it>sulfotransferase </it>(<it>SULT</it>) <it>2A1 </it><abbrgrp><abbr bid="B24">24</abbr></abbrgrp> and <it>Rev-ErbA&#945; </it>(<it>RVR&#945;</it>) <abbrgrp><abbr bid="B25">25</abbr></abbrgrp> were chosen because their PPREs were at unusual positions, such as in an intron or more than 5 kB upstream of their TSS, or of unusual structure, such as a direct repeat with two intervening nucleotides (DR2). Finally, the gene <it>UCP3 </it><abbrgrp><abbr bid="B26">26</abbr></abbrgrp> was included, because despite being an established PPAR target, no PPRE had yet been characterized within its previously studied regulatory regions. Therefore, the latter gene was a specific challenge to our PPRE prediction approach. By real-time quantitative PCR we confirmed the inducibility of all eight genes by PPAR ligands (Additional data file 4) and demonstrated in parallel that our experimental systems, the human cell lines HEK293 (embryonal kidney) and HepG2 (hepatocarcinoma), with the exception of the <it>APOC3 </it>gene in HEK293 cells, are well suited for the investigation of these genes.</p>
            <p>For the eight PPAR target genes we performed an <it>in silico </it>PPRE search, which spanned 10 kB upstream and downstream of the respective TSS (Figure <figr fid="F3">3</figr>). All PPRE categories that included PPREs with 5% or more binding strength for each subtype are shown. The categories resulting in 1-5% of binding (1/0/1, 3/1/0 and 4/0/0) were indicated only when the PPREs were conserved in the mouse genome. Based on sequence alignments of the human and mouse genome, the evolutionary conservation of all putative REs was evaluated on the level of the RE itself and the level of its flanking sequence (&#177; 50 bp). As a result, we found 5 REs in each of the genes <it>ACOX1</it>, <it>CPT1B</it>, <it>SULT2A1 </it>and <it>ANGPTL4</it>, 9 in the <it>APOC3 </it>gene, 4 in the <it>PPAR&#945; </it>gene, 7 in the <it>RVR&#945; </it>gene and 6 in the <it>UCP3 </it>gene, giving rise to a total of 46 REs in the 160 kB genomic sequence examined. The distribution of the putative REs, relative to the TSS, was roughly equal, since 21 and 25 were found in the upstream regions and downstream areas, respectively. In a cross-species comparison (mouse to human), 10 of the 46 REs were found to be evolutionarily conserved and a further 6 REs were located in conserved regions. Our <it>in silico </it>screening found the published PPREs of the genes <it>ANGPTL4</it>, <it>APOC3 </it>and <it>CPT1B </it>as evolutionarily conserved REs and the published PPREs of the genes <it>SULT2A1 </it>and <it>PPAR&#945; </it>as non-conserved. As mentioned above, the published RE of the <it>ACOX1 </it>gene did not pass our <it>in silico </it>screening parameters and we confirmed by gelshift assays that it does not bind PPARs (Additional data file 1). This observation concurs with a previous report <abbrgrp><abbr bid="B27">27</abbr></abbrgrp>. However, in that study it was claimed that the human <it>ACOX1 </it>gene may not be an active PPAR target, whereas here we show that the gene is regulated by PPARs and suggest five new binding sites, of which one is located in an evolutionarily conserved area of intron 1.</p>
            <fig id="F3">
               <title>
                  <p>Figure 3</p>
               </title>
               <caption>
                  <p><it>In silico </it>analysis of selected primary PPAR target genes</p>
               </caption>
               <text>
                  <p><it>In silico </it>analysis of selected primary PPAR target genes. Overview of the genomic organization of eight human PPAR target genes; 10 kB upstream and downstream of the TSSs are shown (horizontal black line). Putative REs (red boxes, no conservation; orange boxes, within conserved area; yellow boxes, conserved) were identified using the classifier by <it>in silico </it>screening of the genomic sequences and are classified according to their degree of conservation compared to the orthologous mouse gene. Already published PPREs are indicated by an asterisk. For each predicted RE the calculated binding strengths of PPAR&#945; (green), PPAR&#947; (dark blue) and PPAR&#946;/&#948; (light blue) in reference to a consensus DR1-type PPRE are represented by column height. All putative PPRE sequences are available on request. For the <it>UCP3 </it>gene REs, the average <it>in vitro </it>DNA binding strength of PPAR-RXR heterodimers was also determined by gelshift experiments and is shown in the same color code scheme. Horizontal red bars indicate the genomic regions that were subcloned for reporter gene assays (Figure 4) and were analyzed by ChIP assays (Figure 5).</p>
               </text>
               <graphic file="gb-2007-8-7-r147-3"/>
            </fig>
            <p>The <it>in silico </it>binding strength predictions were confirmed by gelshift assays for the six REs of the <it>UCP3 </it>gene (novel sequences that had not been used for average calculations in Figure <figr fid="F1">1</figr>). Comparing the experimentally determined and the calculated values, all predicted binding sites match the experimentally determined binding strength with a deviation of less than 15%.</p>
            <p>Taken together, <it>in silico </it>screening predicts that, for each of the eight tested PPAR target genes, there are four to nine PPREs within 10 kB of their respective TSSs, of which at least one is a strong PPRE. The example of the <it>UCP3 </it>gene demonstrates the good correlation between <it>in silico </it>prediction of PPREs and actual <it>in vitro </it>binding of PPAR-RXR heterodimers.</p>
         </sec>
         <sec>
            <st>
               <p>Functionality of PPAR responsive genomic regions</p>
            </st>
            <p>We selected within the regulatory regions of the eight PPAR target genes 10 proximal REs (within 1 kB of the TSS), 10 REs further upstream and 10 REs further downstream (the element of the <it>APOA1 </it>promoter element was counted as a proximal RE because the gene is a known responding gene <abbrgrp><abbr bid="B28">28</abbr></abbrgrp>). These REs are contained within 23 genomic regions (each approximately 300 bp in length; for locations see Figure <figr fid="F3">3</figr> and Table <tblr tid="T2">2</tblr>), which we cloned by PCR and fused with the <it>thymidine kinase </it>promoter driving the <it>luciferase </it>reporter gene. We included the <it>ACOX1 </it>published region, in which we do not predict a PPRE, as a negative control. The activity of the constructs in the absence or presence of PPAR subtype expression vectors in response to PPAR subtype-specific ligands was tested by reporter gene assays in HEK293 and HepG2 cells (Figure <figr fid="F4">4</figr>). Nine of the genomic regions are located within 1 kB of their respective TSSs (Figure <figr fid="F4">4a,d</figr>). With the exception of the <it>RVR&#945; </it>gene TSS, which contains a reported DR2-type PPRE, eight of these regions displayed, in at least one of the two cell lines, significant inducibility by PPAR ligands. The region of the human <it>CPT1B </it>gene was inducible by all three PPAR subtype-specific ligands in both cell lines, whereas the seven other regions show PPAR subtype- and cell type-specific profiles. An increase in the basal activity compared to empty cloning vector and its subsequent loss due to PPAR over-expression were observed with the proximal regions of the genes <it>APOC3 </it>and <it>UPC3 </it>in both cell lines as well as in HepG2 cells with the intron 1-containing region of the <it>ACOX1 </it>gene and the proximal region of the <it>APOA1 </it>gene. This effect may reflect the attraction of constitutively active transcription factors, such as other nuclear receptors that recognize DR1-type REs, for example, HNF4&#945;, to the respective genomic regions and their subsequent displacement <abbrgrp><abbr bid="B22">22</abbr></abbrgrp>. The cellular context may permit stronger activation by the displaced transcription factor, for example, due to higher expression of favored coregulator interaction partners. This switching of activating transcription factor to the binding site could offer one explanation for the observed change in the basal expression level.</p>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Genomic PCR primers</p>
               </caption>
               <tblbdy cols="3">
                  <r>
                     <c ca="left">
                        <p>Gene (region)</p>
                     </c>
                     <c ca="center">
                        <p>Location</p>
                     </c>
                     <c ca="left">
                        <p>Primer sequences (5'-3')</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>ACOX1 </it>(distal)</p>
                     </c>
                     <c ca="center">
                        <p>-4919 to -4643</p>
                     </c>
                     <c ca="left">
                        <p>TGAGCTCTT<b>GATCTCCTCCTCAGAGTCATAG</b></p>
                        <p>GAGTCTAGA<b>CTGGCAATCTTAGCAGAGTTC</b></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>ACOX1 </it>(published)</p>
                     </c>
                     <c ca="center">
                        <p>-1646 to -1374</p>
                     </c>
                     <c ca="left">
                        <p>TGAGCTCTT<b>GAACTAGAAGGTCAGCTGTC</b></p>
                        <p>GGGTCTAGA<b>CTAGCCTGTCTGTAGTCTGTG</b></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>ACOX1 </it>(intron 1)</p>
                     </c>
                     <c ca="center">
                        <p>+599 to +716</p>
                     </c>
                     <c ca="left">
                        <p>TGAGCTCTT<b>GTGATTCAGGGAGGGTGGAAC</b></p>
                        <p>GGGTCTAGA<b>CTGGCTGCGAGTGAGGAAG</b></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>ACOX1 </it>(intron 2)</p>
                     </c>
                     <c ca="center">
                        <p>+2822 to +3154</p>
                     </c>
                     <c ca="left">
                        <p>TGAGCTCTT<b>GAGATAGAGTAACTCCTCCTAG</b></p>
                        <p>GAGTCTAGA<b>GAAGTGTGTCAAAGGGTGTG</b></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>ANGPTL4 </it>(distal)</p>
                     </c>
                     <c ca="center">
                        <p>-6765 to -6535</p>
                     </c>
                     <c ca="left">
                        <p>TGAGCTCTT<b>GAACTAGAAGGTCAGCTGTC</b></p>
                        <p>GAGTCTAGA<b>ATACACTCATGCAGGGTGAGG</b></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>ANGPTL4 </it>(cluster)</p>
                     </c>
                     <c ca="center">
                        <p>+2829 to +3610</p>
                     </c>
                     <c ca="left">
                        <p>TGAGCTCTT<b>CTCCGTTCATCTCGAACCAC</b></p>
                        <p>GAGTCTAGA<b>CATCTCAGAGGCTCTGCCTG</b></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>APOC3 </it>(distal 1)</p>
                     </c>
                     <c ca="center">
                        <p>-6429 to -6143</p>
                     </c>
                     <c ca="left">
                        <p>TGAGCTCTT<b>GCTCAGGCGATAGTTAGAAG</b></p>
                        <p>GAGTCTAGA<b>CTGGATGGTCCCACTCCAGTG</b></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>APOC3 </it>(distal 2)</p>
                     </c>
                     <c ca="center">
                        <p>-4249 to -3886</p>
                     </c>
                     <c ca="left">
                        <p>TGAGCTCTT<b>GACTATGAGGTGACATCCAGG</b></p>
                        <p>GAGTCTAGA<b>GGACACACAGGCAGTACGTG</b></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>APOC3 </it>(proximal)</p>
                     </c>
                     <c ca="center">
                        <p>-870 to -568</p>
                     </c>
                     <c ca="left">
                        <p>TGAGCTCTT<b>GGCAGTGAGGGCTGCTCTTC</b></p>
                        <p>GGGTCTAGA<b>CATCTCTGGGTTTCAATCCAG</b></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>APOC3 </it>(published)</p>
                     </c>
                     <c ca="center">
                        <p>-262 to -3</p>
                     </c>
                     <c ca="left">
                        <p>ATTTCTAGA<b>CAGTCAGCTAGGAAGGAATGAG</b></p>
                        <p>GGGTCTAGA<b>CTAGGGATGAACTGAGCAGAC</b></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>APOC3 </it>(intron)</p>
                     </c>
                     <c ca="center">
                        <p>+2424 to +2722</p>
                     </c>
                     <c ca="left">
                        <p>TGAGCTCTT<b>GATCACACAACTAATCAATCCTC</b></p>
                        <p>GAGTCTAGA<b>CTCAACTTCACTGGACGACAG</b></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>APOA1 </it>(proximal)</p>
                     </c>
                     <c ca="center">
                        <p>+7701 to +8022 (relative to <it>APOC3 </it>TSS)</p>
                     </c>
                     <c ca="left">
                        <p>TGAGCTCTT<b>CCTTCTCGCAGTCTCTAAGC</b></p>
                        <p>GAGTCTAGA<b>GCCAACACAATGGACAATGG</b></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>CPTIB</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>-306 to -64</p>
                     </c>
                     <c ca="left">
                        <p>ATTTCTAGA<b>CAGAGTCTCGTGAGGATGGTG</b></p>
                        <p>GGGTCTAGA<b>GTTAGCGTTCATGCTGCCAG</b></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>PPARa </it>(distal)</p>
                     </c>
                     <c ca="center">
                        <p>-1376 to -1156</p>
                     </c>
                     <c ca="left">
                        <p>TGAGCTCTT<b>CTGGCTAACATGTGCAAGAG</b></p>
                        <p>GGGTCTAGA<b>CACTGTGCTATTTGTGGCAG</b></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>PPARa</it>(proximal)</p>
                     </c>
                     <c ca="center">
                        <p>-938 to -634</p>
                     </c>
                     <c ca="left">
                        <p>TGAGCTCTT<b>CTCCTTGCTCTGGCAGAGTC</b></p>
                        <p>GGGTCTAGA<b>CTCAGAAGTGCGTAGGGTG</b></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>RVRa</it>(distal)</p>
                     </c>
                     <c ca="center">
                        <p>-7279 to -7040</p>
                     </c>
                     <c ca="left">
                        <p>TGAGCTCTT<b>GACCTTCCCAAGCCAAGAAC</b></p>
                        <p>GAGTCTAGA<b>CACTAACCTCACAGACCACTG</b></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>RVRa</it>(proximal)</p>
                     </c>
                     <c ca="center">
                        <p>-510 to -70</p>
                     </c>
                     <c ca="left">
                        <p>TGAGCTCTT<b>CTGGAGGTGTTCTCCCTAAG</b></p>
                        <p>GTGTCTAGA<b>CTGCGCAACGACAAGACTG</b></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>RVRa</it>(TSS)</p>
                     </c>
                     <c ca="center">
                        <p>-510 to +119 (subcloned -266 to +119)</p>
                     </c>
                     <c ca="left">
                        <p>TGAGCTCTT<b>CTGGAGGTGTTCTCCCTAAG</b></p>
                        <p>GTGTCTAGA<b>TTTCACTCTGCCAATCTCAGC</b></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>SULT2A1</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>-6104 to -5797</p>
                     </c>
                     <c ca="left">
                        <p>ATTTCTAGA<b>CTTGAATGGAAATGCCTGCTC</b></p>
                        <p>GGGTCTAGA<b>GACTGGGAAGTGGGAGGAGT</b></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>UCP3 </it>(distal)</p>
                     </c>
                     <c ca="center">
                        <p>-9680 to -9349</p>
                     </c>
                     <c ca="left">
                        <p>TGAGCTCTT<b>CTCTAGTCTAAGTGCCTTGTC</b></p>
                        <p>GAGTCTAGA<b>GTAACAGTGAGCCTCTGGTCTG</b></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>UCP3 </it>(proximal)</p>
                     </c>
                     <c ca="center">
                        <p>-396 to -89</p>
                     </c>
                     <c ca="left">
                        <p>TGAGCTCTT<b>GTACCTATCTCATAGGATTGTG</b></p>
                        <p>GTGTCTAGA<b>GTTGACAGCCTGATCACTTGAC</b></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>UCP3 </it>(cluster)</p>
                     </c>
                     <c ca="center">
                        <p>+2036 to +2303</p>
                     </c>
                     <c ca="left">
                        <p>TGAGCTCTT<b>CAGGACTATGGTTGGACTGAAG</b></p>
                        <p>GGGTCTAGA<b>GATGGGAGGAGGCAAGGAAG</b></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>UCP3 </it>(intron)</p>
                     </c>
                     <c ca="center">
                        <p>+5971 to +6236</p>
                     </c>
                     <c ca="left">
                        <p>TGAGCTCTT<b>CTCGTGCTGAGCACTTTACAC</b></p>
                        <p>GAGTCTAGA<b>CACTTGTTGGGTCCATTCTAAC</b></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>LASS1 </it>(region 1)</p>
                     </c>
                     <c ca="center">
                        <p>-5297 to -4917</p>
                     </c>
                     <c ca="left">
                        <p>TGAGCTCTT<b>CTGATGTGCAATCTCAGACAG</b></p>
                        <p>GAGTCTAGA<b>CTCAGTCTCCACCATGAAGG</b></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>LASS1 </it>(region 2)</p>
                     </c>
                     <c ca="center">
                        <p>-2819 to -2499</p>
                     </c>
                     <c ca="left">
                        <p>TGAGCTCTT<b>CCTCCCAGATGTCACCATTG</b></p>
                        <p>GAGTCTAGA<b>CCTCTTTTGCCACTTCCCTC</b></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>LASS1 </it>(region 3)</p>
                     </c>
                     <c ca="center">
                        <p>-1389 to -978</p>
                     </c>
                     <c ca="left">
                        <p>TGAGCTCTT<b>GTGGAACAGGAGCCATAGAG</b></p>
                        <p>GGGTCTAGA<b>CATCGAGGAAGACACTGGTC</b></p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>Sequence and location of the primer pairs used for real-time PCR quantification of genomic regions containing putative REs within the nine PPAR target genes. The positions indicated are in relation to the respective annotated gene TSS. The same primers were used for subcloning; the gene-specific sequences are indicated in bold.</p>
               </tblfn>
            </tbl>
            <fig id="F4">
               <title>
                  <p>Figure 4</p>
               </title>
               <caption>
                  <p>Extra-genomic functionality of the PPRE-containing promoter regions of PPAR target genes</p>
               </caption>
               <text>
                  <p>Extra-genomic functionality of the PPRE-containing promoter regions of PPAR target genes. Reporter gene assays were performed with extracts from <b>(a-c) </b>HEK293 and <b>(d-f) </b>HepG2 cells that were transiently transfected with <it>luciferase </it>reporter constructs containing genomic regions of eight human PPAR target genes (please note that the <it>APOC3 </it>gene forms a cluster with the genes <it>APOC1 </it>and <it>APOC4</it>). These were co-transfected with empty expression vector (endogenous PPAR) or the indicated expression vectors for PPAR&#945;, PPAR&#947; and PPAR&#946;/&#948;. Cells were then treated for 16 h with solvent or PPAR subtype-specific ligands. Relative luciferase activity was determined and normalized to the activity of empty cloning vector control co-transfected with empty expression vector (dashed horizontal red line). The genomic regions were subdivided according to their location into close to TSS (a, d), upstream of TSS (b, e) and downstream of TSS (c, f); for further details see Figure 3 and Table 2. Columns represent the means of at least three experiments and bars indicate standard deviations. Two-tailed Student's <it>t</it>-tests were performed to determine the significance of the ligand induction in reference to solvent controls (*<it>p </it>&lt; 0.05, **<it>p </it>&lt; 0.01, ***<it>p </it>&lt; 0.001).</p>
               </text>
               <graphic file="gb-2007-8-7-r147-4"/>
            </fig>
            <p>Of the nine upstream regions, the region of the <it>SULT2A1 </it>gene was shown to be the most active (Figure <figr fid="F4">4b,e</figr>). In both cell lines over-expression of PPARs clearly increased this fragment's basal activity as well as significant inducibility by all three PPAR ligands. A similar observation was made in HepG2 cells for the distal region of the <it>UCP3 </it>gene, an effect that was far more modest in HEK293 cells. In contrast, neither the distal regions of the genes <it>ACOX1 </it>and <it>RVR&#945; </it>nor the region containing the published PPRE of the gene <it>ACOX1 </it>displayed any inducibility by PPAR ligands in either of the two cells lines. Therefore, they can be considered as negative controls. In addition, the distal regions of the genes <it>ANGPTL4 </it>and <it>APOC3 </it>were only inducible in HEK293 cells, whereas the <it>PPAR&#945; </it>gene's putative PPRE-containing region responded only in HepG2 cells to GW501516 treatment. Interestingly, in HEK293 cells, the distal regions of the genes <it>ANGPLT4</it>, <it>APOC3 </it>and <it>PPAR&#945; </it>showed the already described effects of increased basal activity with endogenous activators and subsequent suppression of the activity by PPAR subtype over-expression.</p>
            <p>Of the five downstream regions, the intron 2 region of the <it>ACOX1 </it>gene and the cluster region of the <it>ANGPTL4 </it>gene (containing four putative PPREs) displayed a clear response to all three PPAR ligands in both cell lines. In contrast, the inducibility of the intronic region of the <it>APOC3 </it>gene was far more modest (Figure <figr fid="F4">4c,f</figr>). Individual mutagenesis of the <it>ANGPLT4 </it>REs was carried out and this resulted in reduced activity, thus demonstrating that the other REs, in addition to the published PPRE, contribute to the responsiveness of this region (data not shown). Finally, the cluster and intronic region of the <it>UCP3 </it>gene responded only in HEK293 cells to GW501516 treatment.</p>
            <p>In summary, of the 23 investigated genomic regions containing putative PPREs, up to 17 display significant inducibility in the presence of PPAR ligands (Table <tblr tid="T3">3</tblr>).</p>
            <tbl id="T3">
               <title>
                  <p>Table 3</p>
               </title>
               <caption>
                  <p>Functionality of genomic regions</p>
               </caption>
               <tblbdy cols="7">
                  <r>
                     <c ca="left">
                        <p>Genomic region</p>
                     </c>
                     <c ca="left">
                        <p>Predicted binding</p>
                     </c>
                     <c ca="center">
                        <p>Response in RGA</p>
                     </c>
                     <c ca="center">
                        <p>Association of PPAR&#945;</p>
                     </c>
                     <c ca="center">
                        <p>Association of RXR&#945;</p>
                     </c>
                     <c ca="center">
                        <p>Association of pPol II</p>
                     </c>
                     <c ca="center">
                        <p>PPRE status</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>ACOX1 </it>intron 1</p>
                     </c>
                     <c ca="left">
                        <p>Strong</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>APOC3 </it>proximal</p>
                     </c>
                     <c ca="left">
                        <p>Weak</p>
                     </c>
                     <c ca="center">
                        <p>Down</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>APOC3 </it>published</p>
                     </c>
                     <c ca="left">
                        <p>Medium</p>
                     </c>
                     <c ca="center">
                        <p>Down</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>APOA1 </it>proximal</p>
                     </c>
                     <c ca="left">
                        <p>Weak</p>
                     </c>
                     <c ca="center">
                        <p>+/down</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>CPT1B</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Strong</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>&#177;</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>PPAR&#945; </it>proximal</p>
                     </c>
                     <c ca="left">
                        <p>Medium</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>RVR&#945; </it>proximal</p>
                     </c>
                     <c ca="left">
                        <p>Medium</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>RVR&#945; </it>TSS</p>
                     </c>
                     <c ca="left">
                        <p>No DR1</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>+*</p>
                     </c>
                     <c ca="center">
                        <p>+*</p>
                     </c>
                     <c ca="center">
                        <p>+*</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>UCP3 </it>proximal</p>
                     </c>
                     <c ca="left">
                        <p>Medium</p>
                     </c>
                     <c ca="center">
                        <p>Down</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>ACOX1 </it>distal</p>
                     </c>
                     <c ca="left">
                        <p>Medium</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>ACOX1 </it>published</p>
                     </c>
                     <c ca="left">
                        <p>Not binding</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>ANGPLT4 </it>distal</p>
                     </c>
                     <c ca="left">
                        <p>Weak</p>
                     </c>
                     <c ca="center">
                        <p>+/down</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>APOC3 </it>distal 1</p>
                     </c>
                     <c ca="left">
                        <p>Medium</p>
                     </c>
                     <c ca="center">
                        <p>&#177;</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>APOC3 </it>distal 2</p>
                     </c>
                     <c ca="left">
                        <p>Medium</p>
                     </c>
                     <c ca="center">
                        <p>&#177;</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>PPAR&#945; </it>distal</p>
                     </c>
                     <c ca="left">
                        <p>Strong</p>
                     </c>
                     <c ca="center">
                        <p>+/down</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>RVR&#945; </it>distal</p>
                     </c>
                     <c ca="left">
                        <p>Weak</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>&#177;</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>SULT2A1</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Strong</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>UCP3 </it>distal</p>
                     </c>
                     <c ca="left">
                        <p>Strong</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>ACOX1 </it>intron 2</p>
                     </c>
                     <c ca="left">
                        <p>Medium</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>ANGPTL4 </it>cluster</p>
                     </c>
                     <c ca="left">
                        <p>Strong</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>APOC3 </it>intron</p>
                     </c>
                     <c ca="left">
                        <p>Strong</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>&#177;</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>UCP3 </it>cluster</p>
                     </c>
                     <c ca="left">
                        <p>Weak</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>UCP3 </it>intron</p>
                     </c>
                     <c ca="left">
                        <p>Medium</p>
                     </c>
                     <c ca="center">
                        <p>Down</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>The data from reporter gene assay (RGA) and ChIP assays are summarized for each genomic region tested. The PPRE status indicates the conclusion drawn from the assays concerning the functionality of each region, with '+' assigned to functional regions, '-' to non-functional regions and '&#177;' where the two assays were not in agreement. *Impossible to assess independent of adjacent region.</p>
               </tblfn>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Association of PPARs and their partner proteins to PPRE-containing regions</p>
            </st>
            <p>The same 23 genomic regions of the eight PPAR target genes were investigated by chromatin immuno-precipitation (ChIP) assays with chromatin extracts from HEK293 cells (or from HepG2 cells for regions from the <it>APOC3 </it>gene) that were treated with solvent or for 120 minutes with the PPAR&#945; ligand GW7647 (Figure <figr fid="F5">5</figr>). We assessed these regions for the binding of PPAR&#945;, its partner receptor RXR&#945; and pPol II (the latter as a sign for a direct connection between the RE-containing region and the TSS). Chromatin templates were analyzed by quantitative real-time PCR and the specificity of the antibodies for the three proteins was compared with the non-specific background binding to IgG. Of the 23 tested regions, the region of the <it>CPT1B </it>gene, the distal and published region of the <it>ACOX1 </it>gene, the distal 1, distal 2 and intronic region of the <it>APOC3 </it>gene and the cluster of the <it>UCP3 </it>gene did not show specific binding of any of the three proteins. For the two regions of the <it>ACOX1 </it>gene this result confirmed their failure in the previous functionality test (Figure <figr fid="F4">4</figr>). The 16 other regions showed a significant association with PPAR&#945; in the presence of ligand. When comparing the relative association levels of PPAR&#945; under these conditions, we found that the most prominent binding was to the region of the <it>SULT2A1 </it>gene, followed by the regions of the <it>RVR&#945; </it>TSS and the proximal region of the <it>PPAR&#945; </it>gene (Figure <figr fid="F5">5d</figr>). Interestingly, the latter two regions as well as the proximal regions of the genes <it>APOA1 </it>and <it>UCP3</it>, the distal region of the <it>RVR&#945; </it>gene and the distal and intronic region of the <it>UCP3 </it>gene even displayed ligand-independent binding of PPAR&#945;. Similarly, a GW7647-independent association of RXR&#945; was found on the published region of the <it>APOC3 </it>gene, on the proximal regions of the genes <it>APOA1</it>, <it>PPAR&#945; </it>and <it>UCP3 </it>and on the distal regions of the genes <it>ANGPTL4 </it>and <it>UCP3</it>. In contrast, no statistically significant binding of pPol II, irrespective of the presence of ligand, was found on the published region of the <it>APOC3 </it>gene and in the distal regions of the genes <it>ANGPTL4 </it>and <it>RVR&#945;</it>.</p>
            <fig id="F5">
               <title>
                  <p>Figure 5</p>
               </title>
               <caption>
                  <p>Association of genomic regions of PPAR target genes with PPARs and their partner proteins</p>
               </caption>
               <text>
                  <p>Association of genomic regions of PPAR target genes with PPARs and their partner proteins. Chromatin was extracted from HEK293 cells that had been treated with solvent (DMSO) or for 120 minutes with 100 nM GW7647. The association of PPAR&#945;, RXR&#945; and pPol II was monitored by ChIP assays with respective antibodies on genomic regions of the eight PPAR target genes that are <b>(a) </b>close to the TSS, <b>(b) </b>upstream of the TSS and <b>(c) </b>downstream of the TSS; for location see Figure 3 and Table 2. Since the <it>APOC3 </it>gene is not expressed in HEK293 cells, the data for its four genomic regions were obtained using chromatin derived from HepG2 cells. Real-time quantitative PCR was performed on chromatin templates and the fold change of the antibody-precipitated template in relation to an IgG-precipitated specificity control template was calculated. <b>(d) </b>PPAR&#945; shows specific association with 15 of the 23 tested regions and the relative association with these regions is shown. Columns represent means of at least three experiments and bars indicate standard deviations. Two-tailed Student's <it>t</it>-tests were performed to determine the significance of association in reference to IgG controls (*<it>p </it>&lt; 0.05, **<it>p </it>&lt; 0.01, ***<it>p </it>&lt; 0.001).</p>
               </text>
               <graphic file="gb-2007-8-7-r147-5"/>
            </fig>
            <p>Taken together, PPAR&#945; and RXR&#945; associate in living cells with 16 of the 23 genomic regions. Thirteen of these regions also associate with pPol II, twelve of which show functionality in reporter gene assays (Figure <figr fid="F4">4</figr>, Table <tblr tid="T3">3</tblr>). With the exception of the <it>CPT1B </it>gene, the tested PPAR target genes possess one to three of these tested regions. The regions show neither positional bias nor do they preferentially contain evolutionarily conserved PPREs. However, each of them contains at least one predicted medium or strong PPRE. Three of the twelve fully functional regions, the <it>ANGPTL4 </it>cluster region, the proximal region of the <it>PPAR&#945; </it>gene and the distal region of the <it>SULT2A1 </it>gene, were already known, but we identified two alternative regulatory regions for each of the genes <it>ACOX1 </it>and <it>APOC3</it>, and one for the <it>RVR&#945; </it>gene. We also found one additional regulatory region for the <it>PPAR&#945; </it>gene. Finally, for the <it>UCP3 </it>gene, for which no regulatory regions had so far been described to account for the effect of PPAR ligands on its mRNA transcription, we identified three functional areas.</p>
         </sec>
         <sec>
            <st>
               <p>Clustering of PPAR target genes by self-organizing maps</p>
            </st>
            <p>The common feature of the eight investigated PPAR target genes appears to be a prevalence for strong PPREs at a distance of up to 10 kB from the TSS. With the aim of extending this conclusion, we next compared all human genes that are known as primary PPAR targets. The genes were selected according to the following criteria: mRNA or protein level changes were reported for human cells or tissues; a PPRE was described for the human gene and it was experimentally confirmed by either gelshift, reporter gene or ChIP assay. This resulted in 30 additional genes, for which we performed <it>in silico </it>analysis for putative REs up to a distance of 10 kB from their respective TSSs (as done for the first eight genes; see Figure <figr fid="F3">3</figr>). In addition, for all of the 38 genes, the orthologous mouse gene was investigated in the same way (Figures <figr fid="F6">6</figr> and <figr fid="F7">7</figr>). From these data, overview figures for each gene were constructed that show the location of the PPREs (x-axis) and their respective predicted binding strength (y-axis). In order to reveal further characteristics of the genes and their PPREs, such as overall similarity of their patterns and evolutionary conservation, they were clustered using a self-organizing map (SOM) algorithm followed by Sammon's mapping to illustrate the clusters. The input dataset of the SOM consisted of six variables, which are the sum of the predicted binding strength (BS), the number of conserved strong and medium binding sites (CS) and the number of weak binding sites (CW) both for the human and the mouse gene (Additional data file 5). An initial map resulted in four clusters, which were then each separated in the final map in up to five subclusters (Figures <figr fid="F6">6</figr> and <figr fid="F7">7</figr>).</p>
            <fig id="F6">
               <title>
                  <p>Figure 6</p>
               </title>
               <caption>
                  <p>SOM analysis of established primary PPAR target genes, clusters I and II</p>
               </caption>
               <text>
                  <p>SOM analysis of established primary PPAR target genes, clusters I and II. Overview of the genomic organization of 38 known human PPAR target genes (left) and their mouse orthologs (right); 10 kB upstream and downstream of the TSS are shown in this and Figure 7. Please note that for the mouse <it>CYP1A1 </it>gene and the human <it>FADS2 </it>gene, there are discrepancies between the Ensembl (E) and NCBI (N) databases; therefore, both versions are shown. Putative PPREs (red boxes, no conservation; orange boxes, within conserved area; yellow boxes, conserved) were identified by <it>in silico </it>screening of the genomic sequences and are classified according to their degree of conservation between mouse and human. Already published PPREs are indicated by an asterisk. For each of the predicted PPREs, the calculated binding strengths of PPAR&#945; (green), PPAR&#947; (dark blue) and PPAR&#946;/&#948; (light blue) in reference to a consensus DR1-type PPRE are represented by column height. All putative PPRE sequences are available on request. The genes were sorted by SOM analysis with respect to overall PPRE pattern similarity and their evolutionary conservation into <b>(a) </b>cluster I and <b>(b) </b>cluster II.</p>
               </text>
               <graphic file="gb-2007-8-7-r147-6"/>
            </fig>
            <fig id="F7">
               <title>
                  <p>Figure 7</p>
               </title>
               <caption>
                  <p>SOM analysis of established primary PPAR target genes, clusters III and IV</p>
               </caption>
               <text>
                  <p>SOM analysis of established primary PPAR target genes, clusters III and IV. The genes were sorted by SOM analysis with respect to overall PPRE pattern similarity and their evolutionary conservation into <b>(a) </b>cluster III and <b>(b) </b>cluster IV. For more details, see the Figure 6 legend.</p>
               </text>
               <graphic file="gb-2007-8-7-r147-7"/>
            </fig>
            <p>While the evolution of protein-coding sequences within genomes is well understood, the same cannot be said of the regions regulating transcription. The conservative model, often utilized as a limit for <it>in silico </it>binding site predictions, requires the strict preservation of binding site sequence and location. However, recent research on enhancer evolution has challenged this view. From these data, it appears possible to maintain overall functional conservation of regulatory elements over long evolutionary times, despite having high structural architecture turnover rates <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>. This feature has not been widely explored with human target genes, but is important to consider for target gene prediction. We therefore sought to identify traces of binding site evolutionary patterns in the clusters of this dataset. In general, clusters I and II contain genes that are well conserved between human and mouse, while the genes in cluster III are more divergent and those in cluster IV show no evolutionary conservation of PPREs.</p>
            <p>Cluster I contains genes that carry multiple conserved PPREs (Figure <figr fid="F6">6a</figr>). Cluster IA contains the genes <it>ANGLPTL4</it>, <it>CPT1A </it><abbrgrp><abbr bid="B29">29</abbr></abbrgrp>, <it>lipoprotein lipase </it>(<it>LPL</it>) <abbrgrp><abbr bid="B30">30</abbr></abbrgrp> and <it>phosphoenolpyruvate carboxykinase </it>(<it>PEPCK</it>) 1 <abbrgrp><abbr bid="B31">31</abbr></abbrgrp>, which have, in both human and mouse, multiple conserved regions with strong REs. While each gene contains a conserved medium/strong element, a subset of genes expanded this set: human <it>CPT1A </it>and mouse <it>LPL </it>show significant enrichment of <it>de novo </it>binding sites compared to their orthologs. Cluster IB contains the genes <it>glycerol kinase </it>(<it>GK</it>) <abbrgrp><abbr bid="B32">32</abbr></abbrgrp> and <it>UCP3</it>, which have multiple conserved RE regions. The distal UCP3 PPRE is conserved as a strong PPRE but is outside the 10 kB window in mouse. The cluster of PPREs in the human <it>GK </it>promoter seems to have lost significance in the mouse. The <it>lipoprotein receptor-related protein 1 </it>(<it>LRP1</it>) <abbrgrp><abbr bid="B33">33</abbr></abbrgrp> gene represents cluster IC, in which multiple conserved REs are strong in mouse but weaker in human. Together with the genes <it>GK </it>and <it>LRP1</it>, the genes found in cluster ID, <it>caveolin 1 </it><abbrgrp><abbr bid="B34">34</abbr></abbrgrp> and <it>insulin-like growth factor binding protein 1 </it>(<it>IGFBP1</it>) <abbrgrp><abbr bid="B18">18</abbr></abbrgrp>, exhibit a retain-loss pattern concerning conserved PPREs, where only one species retained a cluster of strong PPREs. In the case of the <it>LRP1 </it>gene, this appears to have arisen in the context of several compensating <it>de novo </it>binding sites.</p>
            <p>Cluster II differs from cluster I by having one or two strong or medium conserved REs in human, which are found in a comparable strength and location in mouse (Figure <figr fid="F6">6b</figr>). This cluster is subdivided into two clusters. Cluster IIA contains the genes <it>APOC3</it>, <it>CPT1B</it>, <it>CPT2 </it><abbrgrp><abbr bid="B35">35</abbr></abbrgrp>, <it>cytochrome P450 </it>(<it>CYP</it>) <it>1A1 </it><abbrgrp><abbr bid="B36">36</abbr></abbrgrp>, <it>3-hydroxy-3-methylglutaryl-CoA synthase 2 </it>(<it>HMGCS2</it>) <abbrgrp><abbr bid="B37">37</abbr></abbrgrp> and <it>scavenger receptor B1 </it>(<it>SRB1</it>) <abbrgrp><abbr bid="B38">38</abbr></abbrgrp>, which have relatively comparable PPRE content. In contrast, cluster IIB contains the genes <it>adipose differentiation-related protein </it>(<it>ADRP</it>) <abbrgrp><abbr bid="B39">39</abbr></abbrgrp>, APOA1, <it>G0/G1 switch gene 2 </it>(<it>G0S2</it>) <abbrgrp><abbr bid="B40">40</abbr></abbrgrp>, <it>liver X receptor </it>(<it>LXR</it>)<it>&#945; </it><abbrgrp><abbr bid="B41">41</abbr></abbrgrp> and <it>spermidine/spermine N1-acetyltransferase </it>(<it>SSAT</it>) <abbrgrp><abbr bid="B42">42</abbr></abbrgrp>, which exhibit an increase in PPRE content in the mouse gene.</p>
            <p>Cluster IIIA, which contains the genes <it>cyclooxygenase 2 </it>(<it>COX2</it>) <abbrgrp><abbr bid="B43">43</abbr></abbrgrp> and <it>semaphorin </it>(<it>SEMA</it>) <it>6B </it><abbrgrp><abbr bid="B44">44</abbr></abbrgrp>, extends the pattern observed above with an opposite trend; the human ortholog contains one or two medium/strong REs, which are conserved but only weak in the mouse (Figure <figr fid="F7">7a</figr>). Possible compensating elements appeared in the mouse <it>SEMA6B </it>gene, while this is not the case for the mouse <it>COX2 </it>gene. Also, cluster IIIB contains one or two conserved REs, but they are weak in both human and mouse. This cluster comprises the genes <it>APOA2 </it><abbrgrp><abbr bid="B45">45</abbr></abbrgrp>, <it>APOA5 </it><abbrgrp><abbr bid="B46">46</abbr></abbrgrp>, <it>fatty acid desaturase 1 </it>(<it>FADS2</it>) <abbrgrp><abbr bid="B47">47</abbr></abbrgrp>, <it>pregnane X receptor </it>(<it>PXR</it>) <abbrgrp><abbr bid="B48">48</abbr></abbrgrp>, <it>RVR&#945; </it>and <it>solute carrier </it>(<it>SLC</it>) <it>10A2 </it><abbrgrp><abbr bid="B49">49</abbr></abbrgrp>. Interestingly, these genes each have novel binding sites at nearly similar locations.</p>
            <p>Cluster IV contains genes that carry one or more REs, but none of them is conserved (Figure <figr fid="F7">7b</figr>). The <it>ACOX1 </it>gene represents cluster IVA, in which multiple strong, but non-conserved, REs are found in both species. The genes <it>resistin </it><abbrgrp><abbr bid="B50">50</abbr></abbrgrp> and <it>SULT2A1 </it>form cluster IVB; they have one or two strong non-conserved REs in human and multiple REs in mouse. The genes <it>APOE </it><abbrgrp><abbr bid="B51">51</abbr></abbrgrp> and <it>PPAR&#945; </it>are in cluster IVC, which is characterized by one strong RE in the mouse ortholog and one or more non-conserved REs in the human gene. In cluster IVD are the genes <it>CYP27A1 </it><abbrgrp><abbr bid="B52">52</abbr></abbrgrp>, <it>glutathione S-transferase </it>(<it>GST</it>) <it>A2 </it><abbrgrp><abbr bid="B53">53</abbr></abbrgrp>, <it>transferrin </it><abbrgrp><abbr bid="B54">54</abbr></abbrgrp> and <it>UDP-glycosyltransferase </it>(<it>UGT</it>) <it>1A9 </it><abbrgrp><abbr bid="B55">55</abbr></abbrgrp>, which carry one or two medium, non-conserved REs in both species. Finally, the <it>cyclin-dependent kinase inhibitor 2A </it>(<it>CDKN2A</it>) <abbrgrp><abbr bid="B56">56</abbr></abbrgrp> gene represents cluster IVE, in which strong or medium non-conserved REs are found in mouse and but only weak REs are found in human.</p>
            <p>In summary, SOM clustering of the 38 presently known human PPAR target genes sorts them into four clusters, of which the first three contain different numbers of evolutionarily conserved REs, while the 10 genes of cluster IV are characterized by having non-conserved REs. Interestingly, although for some genes a conservation of the PPRE pattern is evident, significant diversity in the composition of PPREs is visible as well.</p>
         </sec>
         <sec>
            <st>
               <p>Evolutionary preservation patterns of PPREs in the genes <it>ACOX1 </it>and <it>ANGPLT4</it></p>
            </st>
            <p>In order to explore the evolutionary preservation patterns of PPREs further, the genes <it>ACOX1 </it>and <it>ANGPLT4 </it>from the genomes of chicken, chimpanzee, dog, rat and zebrafish were also analyzed (Figure <figr fid="F8">8</figr>). In the genome of the chimpanzee (<it>Pan troglodytes</it>), the closest relative to human, four conserved PPREs were located in the <it>ACOX1 </it>gene, but the intron 2 region is missing. The respective human PPRE is not conserved in any of the species analyzed, suggesting that it is human-specific. Mouse and rat (<it>Rattus norvegicus</it>) share two PPREs, although both also contain a unique set of further REs. The analysis of the <it>ACOX1 </it>gene in chicken (<it>Gallus gallus</it>), dog (<it>Canis familiaris</it>) and zebrafish (<it>Danio rerio</it>) is in accordance with the overall pattern of relatively species-specific composition of PPREs. Within mammals, the cluster of intronic REs of the <it>ANGPLT4 </it>gene is rather well conserved. The closest PPRE pattern in comparison to the human gene is observed in the dog. Two intronic PPREs are also present in rat, but a significant expansion in PPREs seems to have occurred in this species, including a distal consensus RE. The zebrafish <it>ANGPLT4 </it>gene is also profoundly enriched with strong PPREs, whereas the chicken gene has a quite poor PPRE content. Moreover, the loss of the published PPRE is observed in the chimpanzee gene. Therefore, while this gene is an example of a much more preserved PPRE pattern, significant diversification is evident amongst the genomes analyzed and not all functional PPREs are conserved.</p>
            <fig id="F8">
               <title>
                  <p>Figure 8</p>
               </title>
               <caption>
                  <p>Conservation patterns across multiple species</p>
               </caption>
               <text>
                  <p>Conservation patterns across multiple species. The genes <it>ACOX1 </it>and <it>ANGPLT4 </it>from chicken, chimpanzee, dog, rat and zebrafish were also analyzed. Putative PPREs (red boxes, no conservation; orange boxes, within conserved area; yellow boxes, conserved in human; pink boxes, conserved in mouse) were identified by <it>in silico </it>screening of the genomic sequences. For each of the predicted PPREs, the calculated binding strengths of PPAR&#945; (green), PPAR&#947; (dark blue) and PPAR&#946;/&#948; (light blue) in reference to a consensus DR1-type PPRE are represented by column height. All putative PPRE sequences are available on request.</p>
               </text>
               <graphic file="gb-2007-8-7-r147-8"/>
            </fig>
            <p>In conclusion, the SOM analysis and further genome comparisons together suggest that functional RE choice is evolutionarily flexible with respect to first gaining and then maintaining responsiveness to PPARs. In effect, integration of the stabilizing selection model into target gene identification and characterization may more faithfully identify PPAR targets.</p>
         </sec>
         <sec>
            <st>
               <p>Identifying PPAR target genes in human chromosome 19</p>
            </st>
            <p>For the purpose of target gene identification, the SOM analysis (Figures <figr fid="F6">6</figr> and <figr fid="F7">7</figr>) indicated that either the presence of at least one strong PPRE or more than two medium PPREs within the 20 kB surrounding the annotated TSS of a gene is a strong indication for a PPAR target gene. In this way, 28 out of the 38 human genes (74%) would have been identified as PPAR targets. Similarly, for 29 of these 38 genes (76%) the analysis of their murine ortholog would have come to the same conclusion. A combination of these two criteria (passing the threshold in either the human or mouse ortholog) would have identified 37 of the 38 genes (97%) as PPAR targets. <it>UGT1A9 </it>could be detected from the list of genes having two medium REs. While location clearly is not a major determinant of PPRE functionality, the screening of these regions in 500 bp windows indicates modest enrichment in the proximal promoter (24% of genes have a medium/strong PPRE close to the TSS; data not shown).</p>
            <p>To explore this concept further, we selected the gene-dense human chromosome 19 (63.8 MB, 1,445 known genes in Ensembl, release 41) and its syntenic mouse regions (956 genes have known orthologs) and screened both species for medium and strong PPREs (based on a PPAR&#947; prediction). We extracted from four human microarray datasets <abbrgrp><abbr bid="B8">8</abbr><abbr bid="B57">57</abbr><abbr bid="B58">58</abbr><abbr bid="B59">59</abbr></abbrgrp> those genes located on chromosome 19 that were shown to be regulated and determined whether these passed the criteria derived from the 38 target genes (that is, having a strong PPRE, a proximal medium PPRE or more than two medium PPREs). Typically, each dataset contained 6 to 8 genes from chromosome 19, out of which at least 5 (71-100%) passed the criteria in either or both species, and typically 1 or 2 genes had 2 medium PPREs only. This implies that the sensitivity of detecting targets based on our screen for medium and strong PPREs is high.</p>
            <p>The background frequency of strong PPREs calculated by the total number of predicted strong PPREs divided by the length of chromosome 19 was found to be 0.66 for the 20 kB region considered for each gene, whereas that of medium or strong PPREs is 1.3. Twenty percent of genes of chromosome 19 contain a co-localizing strong PPRE and an additional four percent have more than two medium PPREs or a proximal medium PPRE. These numbers suggest a total of 4,000 to 5,000 targets for PPARs in the human genome, if no false positives are assumed. A complete evaluation of the selectivity is complicated by the restricted expression profiles of the predicted genes, which prevents simple read-outs from individual target tissues (regulation of only two genes from chromosome 19 was detected on more than two microarrays used earlier). We chose a focused list for further inspection, by requiring detection in human and mouse. In total, 116 genes (12.1%) from chromosome 19 pass the filter (Table <tblr tid="T4">4</tblr>). Furthermore, all 1,445 human genes were screened for high enrichment of PPREs, that is, for assemblies of at least three medium or strong PPREs (of which at least one was strong). These even more stringent criteria were fulfilled by 50 genes of both species (bold entries in Table <tblr tid="T4">4</tblr>) and an additional 75 human genes (Additional data file 6), a sample that represented 8.7% of all genes from human chromosome 19.</p>
            <tbl id="T4">
               <title>
                  <p>Table 4</p>
               </title>
               <caption>
                  <p>Predicted PPAR target genes in human chromosome 19</p>
               </caption>
               <tblbdy cols="3">
                  <r>
                     <c ca="left">
                        <p>Ensembl ID (human)</p>
                     </c>
                     <c ca="left">
                        <p>Gene name</p>
                     </c>
                     <c ca="left">
                        <p>Ensembl ID (mouse)</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ENSG00000004776</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>
                              <it>Heat-shock protein beta-6</it>
                           </b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>ENSMUSG00000036854</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ENSG00000004777</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>
                              <it>TC10/CDC42 GTPase-activating protein</it>
                           </b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>ENSMUSG00000036882</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ENSG00000005007</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Regulator of nonsense transcripts 1</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>ENSMUSG00000058301</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ENSG00000010310</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Gastric inhibitory peptide receptor</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>ENSMUSG00000030406</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ENSG00000032444</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Neuropathy target esterase</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>ENSMUSG00000004565</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ENSG00000039987</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Bestrophin-2</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>ENSMUSG00000052819</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ENSG00000060566</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>cAMP responsive element binding protein 3-like 3</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>ENSMUSG00000035041</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ENSG00000063176</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>
                              <it>Sphingosine kinase 2</it>
                           </b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>ENSMUSG00000057342</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ENSG00000063241</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Isochorismatase domain containing 2</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>ENSMUSG00000052605</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ENSG00000064547</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>
                              <it>Lysophosphatidic acid receptor Edg-4</it>
                           </b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>ENSMUSG00000031861</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ENSG00000072954</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Transmembrane protein 38A</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>ENSMUSG00000031791</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ENSG00000072958</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>AP-1 complex subunit mu-1</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>ENSMUSG00000003309</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ENSG00000076944</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Syntaxin binding protein 2</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>ENSMUSG00000004626</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ENSG00000077348</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Exosome complex exonuclease RRP46</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>ENSMUSG00000061286</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ENSG00000079435</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>
                              <it>Lipase, hormone sensitive</it>
                           </b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>ENSMUSG00000053714</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ENSG00000080031</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Protein tyrosine phosphatase, receptor type, H precursor</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>ENSMUSG00000035429</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ENSG00000080511</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>
                              <it>Retinol dehydrogenase 8</it>
                           </b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>ENSMUSG00000053773</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ENSG00000083807</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>SLC27A5</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>ENSMUSG00000030382</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ENSG00000083838</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>
                              <it>Zinc finger protein 446</it>
                           </b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>ENSMUSG00000033961</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ENSG00000089327</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>FXYD domain-containing ion transport regulator 5 precursor</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>ENSMUSG00000009687</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ENSG00000089639</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>
                              <it>GEM-interacting protein</it>
                           </b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>ENSMUSG00000036246</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ENSG00000099203</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Transmembrane emp24 domain-containing protein 1 precursor</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>ENSMUSG00000032180</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ENSG00000099308</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Microtubule-associated serine/threonine-protein kinase 3</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>ENSMUSG00000031833</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ENSG00000099331</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>
                              <it>Myosin-9B</it>
                           </b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>ENSMUSG00000004677</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ENSG00000099617</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Ephrin-A2 precursor</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>ENSMUSG00000003070</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ENSG00000099622</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>
                              <it>Cold-inducible RNA-binding protein</it>
                           </b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>ENSMUSG0000