<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>gb-2007-8-8-r169</ui>
   <ji>GBJ</ji>
   <fm>
      <dochead>Research</dochead>
      <bibl>
         <title>
            <p>The impact of chromatin modifiers on the timing of locus replication in mouse embryonic stem cells</p>
         </title>
         <aug>
            <au id="A1" ca="yes">
               <snm>J&#248;rgensen</snm>
               <mi>F</mi>
               <fnm>Helle</fnm>
               <insr iid="I1"/>
               <email>helle.jorgensen@csc.mrc.ac.uk</email>
            </au>
            <au id="A2">
               <snm>Azuara</snm>
               <fnm>V&#233;ronique</fnm>
               <insr iid="I1"/>
               <insr iid="I2"/>
               <email>v.azuara@imperial.ac.uk</email>
            </au>
            <au id="A3">
               <snm>Amoils</snm>
               <fnm>Shannon</fnm>
               <insr iid="I1"/>
               <email>S.Amoils@nature.com</email>
            </au>
            <au id="A4">
               <snm>Spivakov</snm>
               <fnm>Mikhail</fnm>
               <insr iid="I1"/>
               <email>mikhail.spivakov@csc.mrc.ac.uk</email>
            </au>
            <au id="A5">
               <snm>Terry</snm>
               <fnm>Anna</fnm>
               <insr iid="I1"/>
               <email>anna.terry@imperial.ac.uk</email>
            </au>
            <au id="A6">
               <snm>Nesterova</snm>
               <fnm>Tatyana</fnm>
               <insr iid="I3"/>
               <email>tatyana.nesterova@csc.mrc.ac.uk</email>
            </au>
            <au id="A7">
               <snm>Cobb</snm>
               <mi>S</mi>
               <fnm>Bradley</fnm>
               <insr iid="I1"/>
               <email>brad.cobb@imperial.ac.uk</email>
            </au>
            <au id="A8">
               <snm>Ramsahoye</snm>
               <fnm>Bernard</fnm>
               <insr iid="I4"/>
               <email>Bernard.Ramsahoye@ed.ac.uk</email>
            </au>
            <au id="A9">
               <snm>Merkenschlager</snm>
               <fnm>Matthias</fnm>
               <insr iid="I1"/>
               <email>matthias.merkenschlager@imperial.ac.uk</email>
            </au>
            <au ca="yes" id="A10">
               <snm>Fisher</snm>
               <mi>G</mi>
               <fnm>Amanda</fnm>
               <insr iid="I1"/>
               <email>amanda.fisher@csc.mrc.ac.uk</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Lymphocyte Development Group, MRC Clinical Sciences Centre, Imperial College School of Medicine, London W12 0NN, UK</p>
            </ins>
            <ins id="I3">
               <p>Developmental Epigenetics, MRC Clinical Sciences Centre, Imperial College School of Medicine, London W12 0NN, UK</p>
            </ins>
            <ins id="I4">
               <p>Developmental Epigenetics, University of Edinburgh, Western General Hospital, Edinburgh EH4 2XR, UK</p>
            </ins>
            <ins id="I2">
               <p>Current address: Institute of Reproductive and Developmental Biology, Imperial College School of Medicine, London W12 0NN, UK</p>
            </ins>
         </insg>
         <source>Genome Biology</source>
         <issn>1465-6906</issn>
         <pubdate>2007</pubdate>
         <volume>8</volume>
         <issue>8</issue>
         <fpage>R169</fpage>
         <url>http://genomebiology.com/2007/8/8/R169</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">17705870</pubid>
               <pubid idtype="doi">10.1186/gb-2007-8-8-r169</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>6</day>
               <month>3</month>
               <year>2007</year>
            </date>
         </rec>
         <revrec>
            <date>
               <day>26</day>
               <month>6</month>
               <year>2007</year>
            </date>
         </revrec>
         <acc>
            <date>
               <day>17</day>
               <month>8</month>
               <year>2007</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>17</day>
               <month>08</month>
               <year>2007</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2007</year>
         <collab>J&#248;rgensen et al.; licensee BioMed Central Ltd.</collab>
         <note>This is an open access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <shorttitle>
         <p>Regulation of replication timing in ES cells</p>
      </shorttitle>
      <shortabs>
         <p>A panel of mutant embryonic stem (ES) cell lines lacking important chromatin modifiers was used to dissect the relationship between chromatin structure and replication timing, revealing the importance of several chromatin modifiers for maintaining correct replication of satellite sequences in pluripotent ES cells.</p>
      </shortabs>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>The time of locus replication during S-phase is tightly regulated and correlates with chromatin state. Embryonic stem (ES) cells have an unusual chromatin profile where many developmental regulator genes that are not yet expressed are marked by both active and repressive histone modifications. This poised or bivalent state is also characterized by locus replication in early S-phase in ES cells, while replication timing is delayed in cells with restricted developmental options.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>Here we used a panel of mutant mouse ES cell lines lacking important chromatin modifiers to dissect the relationship between chromatin structure and replication timing. We show that temporal control of satellite DNA replication is sensitive to loss of a variety of chromatin modifiers, including Mll, Eed, Dnmt1, Suv39h1/h2 and Dicer. The replication times of many single copy loci, including a 5 Mb contiguous region surrounding the <it>Rex1 </it>gene, were retained in chromatin modifier mutant ES cells, although a subset of loci were affected.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>This analysis demonstrates the importance of chromatin modifiers for maintaining correct replication of satellite sequences in pluripotent ES cells and highlights the sensitivity of some single copy loci to the influence of chromatin modifiers. Abundant histone acetylation is shown to correlate well with early replication. Surprisingly, loss of DNA methylation or histone methylation was tolerated by many loci, suggesting that these modifications may be less influential for the timing of euchromatin replication.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <meta>
      <classifications>
         <classification type="BMC" subtype="man_spc_id" id="30010004">Cell biology</classification>
         <classification type="BMC" subtype="man_spc_id" id="30010016">Molecular biology</classification>
         <classification type="BMC" subtype="man_spc_id" id="30010005">Development</classification>
         <classification type="BMC" subtype="man_spc_id" id="30010010">Genome studies</classification>
      </classifications>
   </meta>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>DNA labeling experiments have shown that replication patterns are faithfully inherited through multiple cell divisions <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. Individual genes replicate at similar times in each cell of a given type but locus replication timing often differs between cell types. In embryonic stem (ES) cells, the timing of DNA replication of several genes is altered in response to differentiation <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr></abbrgrp>, which reflects changes in both gene expression and the decline in developmental potential that accompanies lineage commitment <abbrgrp><abbr bid="B4">4</abbr></abbrgrp>. More generally, replication timing is influenced by both chromosome context <abbrgrp><abbr bid="B5">5</abbr><abbr bid="B6">6</abbr></abbrgrp> and underlying nucleotide composition <abbrgrp><abbr bid="B3">3</abbr></abbrgrp>. Genome-wide and single gene analyses have shown that early replication timing correlates with transcriptional activity (reviewed in <abbrgrp><abbr bid="B7">7</abbr></abbrgrp>) as well as with chromatin accessibility, or permissivity <abbrgrp><abbr bid="B8">8</abbr></abbrgrp>, and is often associated with enrichment of acetylated histones <abbrgrp><abbr bid="B9">9</abbr><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr></abbrgrp>. The exact relationship between chromatin structure and time of locus replication in S-phase remains unresolved.</p>
         <p>Chromatin structure depends on both the action of sequence-specific DNA binding proteins and epigenetic features such as post-translational modifications of histones, the extent of DNA methylation and nuclear location (reviewed in <abbrgrp><abbr bid="B12">12</abbr></abbrgrp>). Proteins capable of changing these parameters, chromatin modifiers, are important for establishing and maintaining particular chromatin configurations. For example, enzymes that methylate Lys4 on histone H3 or acetylate histone H3 or H4 are thought to be important for retaining accessibility whereas histone deacetylases (HDACs) and histone methyl transferases (HMTases) that target histone H3 Lys9, Lys27 and histone H4 Lys20 are important for the formation of repressive chromatin. Other factors, including DNA methyltransferases, methyl-DNA binding proteins, polycomb repressor complexes (PRCs), nucleosome remodeling complexes and Dicer-dependent short interfering RNA (siRNA), also induce or stabilize repressed chromatin states.</p>
         <p>Recently, we showed that many genes encoding key developmental regulators replicate early in ES cells, despite being inactive at this stage <abbrgrp><abbr bid="B4">4</abbr></abbrgrp>. Importantly, the promoters of these genes displayed an unusual chromatin profile, being enriched for both marks of active (H3K9ac, H3K4me2/3) and repressive (H3K27me3) chromatin <abbrgrp><abbr bid="B4">4</abbr><abbr bid="B13">13</abbr></abbrgrp>. This bivalent structure is interpreted as representing a 'poised' yet non-expressed state, in which H3K27 methylation is key to ensure repression <abbrgrp><abbr bid="B4">4</abbr><abbr bid="B14">14</abbr><abbr bid="B15">15</abbr></abbrgrp>. Upon differentiation, many lineage inappropriate genes switch from early to late replication <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr></abbrgrp>, suggesting that early replication of lineage specifiers in undifferentiated ES cells is actively maintained. Here, a genetic approach was used to analyze the impact of different chromatin modifiers on the replication timing profile of mouse ES cells. We show that, while early replication in ES cells correlates with peaks of increased histone acetylation, the replication times of many, but not all, single copy genes was preserved, even in mutant cells where polycomb group (PcG)-, H3K9me- or CpG methylation-mediated repression was abrogated. This conclusion is based on analysis of multiple individual genes and extended chromosome walking. The replication timing of repetitive DNA was consistently altered in many mutant ES cell lines and we demonstrate that DNA methylation is particularly important for the temporal regulation of pericentric DNA duplication in ES cells.</p>
      </sec>
      <sec>
         <st>
            <p>Results and discussion</p>
         </st>
         <sec>
            <st>
               <p>Replication timing of many genes is unchanged in mutant ES cells</p>
            </st>
            <p>Mutation of chromatin modifiers <it>in vivo </it>often results in embryonic lethality and impaired development (Table <tblr tid="T1">1</tblr>). Despite this, murine ES cell lines lacking individual modifiers have been established and, in many cases, shown to retain multi-lineage potential. Using a panel of mutant ES cell lines (described in detail in Table <tblr tid="T1">1</tblr>) we examined whether a lack of specific histone methyltransferases, DNA methyltransferases, the NuRD nucleosome remodeling complex or Dicer activity was sufficient to alter the temporal profile of locus replication in ES cells. All ES cell lines examined displayed ES cell morphology, expressed markers that are characteristic of murine ES cells (such as Oct4, alkaline phosphatase and SSEA-1) and had cell cycle profiles that were comparable with wild-type ES cells (supplementary Table 1 in Additional data file 1, and supplementary Figure 1 in Additional data file 2).</p>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>Characteristics of chromatin modifiers and mutant ES cells</p>
               </caption>
               <tblbdy cols="6">
                  <r>
                     <c ca="left">
                        <p>Name</p>
                     </c>
                     <c ca="left">
                        <p>Protein function</p>
                     </c>
                     <c ca="left">
                        <p>ES cell lines</p>
                     </c>
                     <c ca="left">
                        <p>Phenotype of KO/DKO mice</p>
                     </c>
                     <c ca="left">
                        <p>Phenotype of KO/DKO ES cells</p>
                     </c>
                     <c ca="center">
                        <p>Reference</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Mll</p>
                     </c>
                     <c ca="left">
                        <p>HMTase: tri-methylation of H3K4</p>
                     </c>
                     <c ca="left">
                        <p>KO: High 6</p>
                     </c>
                     <c ca="left">
                        <p>Embryonic lethal (E11.5-14.5)</p>
                        <p>Homeotic transformations</p>
                        <p>Mis-regulation of Hox gene expression</p>
                     </c>
                     <c ca="left">
                        <p>Mis-regultion of Hox genes</p>
                        <p>Failure of <it>in vitro </it>differentiation to hematopoietic pre-cursors</p>
                     </c>
                     <c ca="center">
                        <p>[42-44]</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Eed</p>
                     </c>
                     <c ca="left">
                        <p>Subunit of PRC2 Cofactor for Ezh2 (H3K27 HMTase)</p>
                     </c>
                     <c ca="left">
                        <p>KO: B1.3, G8.1</p>
                     </c>
                     <c ca="left">
                        <p>Embryonic lethal (E6.5)</p>
                        <p>Failure to maintain inactive X in trophoblast derivatives</p>
                     </c>
                     <c ca="left">
                        <p>Loss of H3K27me2/3</p>
                        <p>Reduced H3K27me1</p>
                        <p>Contribute to all tissues of chimeras</p>
                     </c>
                     <c ca="center">
                        <p>[4,45-47]</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Dnmt1</p>
                     </c>
                     <c ca="left">
                        <p>Maintenance DNA methyl transferase</p>
                     </c>
                     <c ca="left">
                        <p>KO: c/c</p>
                     </c>
                     <c ca="left">
                        <p>Embryonic lethal (E11.5)</p>
                     </c>
                     <c ca="left">
                        <p>Reduced DNA methylation level</p>
                        <p>Reduced differentiation</p>
                     </c>
                     <c ca="center">
                        <p>[36,48,49]</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Dnmt 3a/3b</p>
                     </c>
                     <c ca="left">
                        <p><it>De novo </it>DNA methyl transferase</p>
                     </c>
                     <c ca="left">
                        <p>DKO: clone 10 (early passage)</p>
                     </c>
                     <c ca="left">
                        <p>Embryonic lethal (E11.5)</p>
                     </c>
                     <c ca="left">
                        <p>Lack <it>de novo </it>DNA methylation activity DNA methylation levels slightly reduced in early passage (severly reduced in late passage cells)</p>
                        <p>Retains differentiation potential at early passages</p>
                     </c>
                     <c ca="center">
                        <p>[27,37,50]</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Mbd3</p>
                     </c>
                     <c ca="left">
                        <p>Subunit of NuRD (nucleosome remodeling and HDAC complex)</p>
                     </c>
                     <c ca="left">
                        <p>KO: Fix2</p>
                     </c>
                     <c ca="left">
                        <p>Embryonic lethal (implantation)</p>
                     </c>
                     <c ca="left">
                        <p>Loss of the NuRD (nucleosome remodeling and HDAC) complex</p>
                        <p>Severe differentiation block</p>
                     </c>
                     <c ca="center">
                        <p>[38,51]</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>G9a</p>
                     </c>
                     <c ca="left">
                        <p>HMTase: H3K9me H3K9me2 euchromatic</p>
                     </c>
                     <c ca="left">
                        <p>WT: Col4</p>
                        <p>KO: 2-3</p>
                        <p>Tg: 15-3</p>
                     </c>
                     <c ca="left">
                        <p>Embryonic lethal (E12.5)</p>
                     </c>
                     <c ca="left">
                        <p>Reduced H3K9me2</p>
                        <p>Increased H3K4me2, H3K9ac</p>
                        <p>Reduced H3K9 methylation in euchromatin</p>
                     </c>
                     <c ca="center">
                        <p>[18,25]</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Suv39 h1/h2</p>
                     </c>
                     <c ca="left">
                        <p>H3K9me3 (hetero-chromatic)</p>
                     </c>
                     <c ca="left">
                        <p>WT: wt26</p>
                        <p>DKO: DN57, DN72</p>
                     </c>
                     <c ca="left">
                        <p>Increased prenatal lethality</p>
                        <p>Growth retarded</p>
                        <p>B-cell lymphomas</p>
                        <p>Male sterility</p>
                        <p>Chromosome instablility in fibroblasts</p>
                     </c>
                     <c ca="left">
                        <p>Reduced H3K9me3 level; Reduced H3K9me3 at pericentric heterochromatin</p>
                        <p>Increased H3K27me3 at pericentric heterochromatin</p>
                        <p>Decreased CpG methylation of satellite repeats</p>
                        <p>Increased transcription of major/minor satellite</p>
                     </c>
                     <c ca="center">
                        <p>[25,35,52,53]</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Dicer</p>
                     </c>
                     <c ca="left">
                        <p>RNase, essential for siRNA/miRNA pathway in mammals</p>
                     </c>
                     <c ca="left">
                        <p>WT: D3</p>
                        <p>KO: D3-S5, D3-S6</p>
                     </c>
                     <c ca="left">
                        <p>Embryonic lethal (E7.5)</p>
                     </c>
                     <c ca="left">
                        <p>Increased transcription of repeats Slow growth</p>
                     </c>
                     <c ca="center">
                        <p>[30,54,55]</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>miRNA, microRNA.</p>
               </tblfn>
            </tbl>
            <p>The replication timing profiles of <it>Oct4</it>, <it>Esg1</it>, <it>Nkx2.9 </it>and <it>Mash1 </it>for four independently derived wild-type (white bars) and eight mutant ES cell lines that lack Mll, Eed, Dnmt 1, Dnmt 3a/3b, Mbd3, G9a, Suv39 h1/h2 or Dicer (gray bars) are shown in Figure <figr fid="F1">1a</figr>. Histograms indicate the abundance of newly synthesized DNA corresponding to each locus in samples prepared from sequential stages of the cell cycle (G1-S, S1, S2, S3, S4 and G2/M) for all the wild-type and mutant ES cell lines. <it>Oct4</it>, which replicates early in S-phase in all cell types analyzed, showed only minor differences between wild-type and mutant cell lines (upper panel). Similarly, there was little variation in the early replication of <it>Esg1 </it>and late replication of <it>Mash1 </it>in wild-type and mutant ES cells, even though these loci are capable of switching replication timing upon differentiation; <it>Esg1 </it>has been shown to shift to late replication upon neural induction while <it>Mash1 </it>shifts to become early replicating <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B16">16</abbr></abbrgrp>. <it>Nkx2.9</it>, a neural specific gene that replicates in mid S-phase in undifferentiated ES cells showed some variation between wild-type and mutant cells. This analysis was extended to include a wider set of candidate loci that also have been shown to be permissive for changes in replication timing <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B4">4</abbr><abbr bid="B17">17</abbr></abbrgrp>. Figure <figr fid="F1">1b</figr> summarizes the data for 14 genes (shown in supplementary Figure 2 in Additional data file 2), in which replication timing is color-coded according to peak abundance in G1-S and/or S1 (early, green), S2 (mid-early, lime), S2 and S3 (middle, yellow), S3 (mid-late, orange), S4 and/or G2/M (late, red). Early replication of <it>Nanog</it>, <it>Zfp57</it>, <it>Oct4</it>, <it>Esg1</it>, <it>Sox2 </it>and <it>Rex1 </it>was unaffected in mutant ES cells lacking either a chromatin activator (Mll) or repressive chromatin modifiers (Eed, Dnmt1, Dnmt3a/3b, Mbd3, G9a, Suv39h1/h2 and Dicer) compared to wild-type cells (OS25 and WT). The replication of several middle- and late-replicating genes was also unchanged in chromatin modifier mutant ES cells, although three loci (<it>Mage a2</it>, <it>Ebf</it>, <it>Sox3</it>), in addition to <it>Nkx2.9</it>, showed some changes in replication patterns in the mutant lines. <it>Sox3 </it>replicated earlier in ES cells that lacked Dnmt1, Dnmt 3a/3b or Dicer but slightly later in Eed-deficient ES cells.<it> Mage a2 </it>was sensitive to loss of G9a (supplementary Figure 3 in Additional data file 2). This gene is transcriptionally regulated by G9a <abbrgrp><abbr bid="B18">18</abbr></abbrgrp> (supplementary Figure 2 in Additional data file 2), and belongs to the <it>Mage </it>genes that are DNA methylated in adult somatic tissues <abbrgrp><abbr bid="B19">19</abbr></abbrgrp>. Replication of <it>Ebf</it>, a gene that replicates earlier in pro- and pre-B cells than in ES cells <abbrgrp><abbr bid="B17">17</abbr></abbrgrp>, showed slight shifts in replication in G9a, Suv39 h1/2 and Dicer-deficient ES cells. From a total of 14 loci analyzed in Figure <figr fid="F1">1b</figr>, four showed a temporal shift in one or more mutant ES cell lines. We analyzed the sequence context of the genes (supplementary Table 2 in Additional data file 1) but neither GC content nor Line density was obviously different between genes that change replication timing or those that remain unchanged in the mutant cells. Bivalent genes were represented among loci that showed shifts in response to loss of chromatin modifiers (such as <it>Nkx2.9 </it>and <it>Msx1</it>) as well as those that did not change their timing of replication (such as <it>Math1 </it>and <it>Sox1</it>; supplementary Figure 2 in Additional data file 2). Some replication timing changes were in the predicted direction (that is, an advance upon loss of a repressive chromatin modifier) whereas others were counter-intuitive, which we cannot explain. Importantly, however, we did not observe consistent shifts towards earlier or later replication in response to removal of a specific chromatin modifier. These results suggest that while some loci may be more sensitive to chromatin changes than others, none of the chromatin modifiers studied here is capable of overt de-regulation of the temporal order of gene replication in ES cells. This was true even for cells lacking Eed (and hence devoid of methylated H3K27), a factor previously shown to be important for transcriptional repression and chromatin bivalency in ES cells <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>. Thus, our data do not support a model where methylation of specific histone residues or CpG dinucleotides confers replication at a certain time in S-phase. To explore this further, we also analyzed a large contiguous region surrounding <it>Rex1 </it>(Figure <figr fid="F1">1c</figr>), a gene that is expressed and early replicating in ES cells, but switches to late replication in differentiated cells and concomitantly looses histone acetylation as the gene is silenced <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>. Chromosome walking has previously identified two domains within this 5 Mb region that replicate early in ES cells and switch to late replication upon differentiation (marked by red lines in Figure <figr fid="F1">1c</figr>) <abbrgrp><abbr bid="B2">2</abbr></abbrgrp> (P Perry and VA, unpublished). Analysis of this entire region in each of the chromatin modifier mutants showed that the boundaries of early and late replication were retained.</p>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>Replication timing of many genes is unchanged in ES mutants</p>
               </caption>
               <text>
                  <p>Replication timing of many genes is unchanged in ES mutants. <b>(a) </b>Replication timing analysis of <it>Oct4</it>, <it>Esg1</it>, <it>Nkx2.9 </it>and <it>Mash1 </it>in wild-type (white bars; OS25, G9a WT, Suv39 h1/h2 WT, Dicer WT) and mutant (gray bars; Mll KO, Eed KO, Dnmt 1 KO, Dnmt3a/3b DKO, Mbd3 KO, G9a KO, Suv39 h1/h2 DKO and Dicer KO) ES cells. The histograms show the relative locus replication within each cell cycle fraction as measured by qPCR for all the wild-type and mutant ES cells analyzed. The mean values and standard error of at least two independent experiments are shown. <b>(b,c) </b>Summary of replication timing of candidate genes (b) and loci surrounding the <it>Rex1 </it>gene (c). In (c), positions of genes are indicated by black boxes and the two regions changing replication timing upon ES cell differentiation are indicated by red bars. <b>(d) </b>Replication timing categories and color code. Early replication (E) is defined by peak abundance in the G1-S and/or S1 fractions, mid-early (ME) by peak replication in S2, middle (M) in S2 and S3, mid-late (ML) in S3 and late (L) replicating loci have peak abundance in S4 and/or G2.</p>
               </text>
               <graphic file="gb-2007-8-8-r169-1"/>
            </fig>
            <p>An explanation for why the replication times of several loci are unchanged in mutant ES cells might be that other modifications compensate for this loss - for example, increased DNA methylation might compensate for loss of Eed-mediated repression. To address this possibility we knocked-down Eed (using short hairpin RNA) in ES cells that already lacked Dnmt1 (supplementary Figure 4a in Additional data file 2) but were unable to detect additional changes in the replication profiles of early (<it>Oct4</it>, <it>Rex1</it>), middle (<it>Nkx2.9</it>) or later replicating loci (<it>Sox3</it>, <it>Mash1</it>, <it>&#946;-Globin</it>) (supplementary Figure 4b in Additional data file 2). Collectively, these data suggest that only a minority of loci (5/23; supplementary Figure 2 in Additional data file 2) change their replication timing in response to severe reduction of DNA methylation (Dnmt 1 knock out (KO)), methylation of H3K27 (Eed KO), euchromatic H3K9 methylation (G9a KO) or NuRD activity (Mbd3 KO), despite being sensitive to changes that occur during normal differentiation <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B4">4</abbr><abbr bid="B16">16</abbr></abbrgrp>.</p>
         </sec>
         <sec>
            <st>
               <p>Histone acetylation and replication timing in ES cells</p>
            </st>
            <p>To assess whether histone acetylation levels are indicative of early replicating regions in ES cells, as has been suggested for other cell types <abbrgrp><abbr bid="B9">9</abbr><abbr bid="B11">11</abbr></abbrgrp>, we compared the abundance of histone acetylation at the candidate loci using the chromatin-immunoprecipitation (ChIP) assay. Replication timing domains are very large (0.2-2 Mb) compared to promoter regions that are conventionally analyzed by ChIP. We therefore applied custom-made tiling arrays to examine approximately 200 kb regions surrounding the loci for enrichment of acetyl-H3K9. Early replicating loci, such as <it>Sox2</it>, <it>Nanog </it>and <it>Rex1</it>, contained numerous peaks of acetylation (eight- to ten-fold enrichment relative to H3; Figure <figr fid="F2">2a</figr> and Additonal data file 3). Loci that replicated in the second half of S-phase showed much fewer peaks and the enrichment was less pronounced (one- to two-fold). Basal histone acetylation levels were, however, relatively constant across each of the regions analyzed, irrespective of whether they replicated early or late.</p>
            <fig id="F2">
               <title>
                  <p>Figure 2</p>
               </title>
               <caption>
                  <p>Histone acetylation and replication timing in ES cells</p>
               </caption>
               <text>
                  <p>Histone acetylation and replication timing in ES cells. <b>(a) </b>The level of acetyl-H3K9 relative to total H3 is shown for each probe in >200 kb regions surrounding the candidate loci (values represent log2{acetylH3K9/H3}). The peaks of histone acetylation were identified using the hidden Markov model and are marked in blue. The location of candidate genes are shown (black box) relative to other genes (white box) within each region. Arrows show the position of the primers used for the replication timing analysis and the size bars (black) represent 25 kb. Raw data are available in Additional data file 3. <b>(b) </b>The replication timing of candidate loci in untreated ES cells (white bars) and after incubation with 10 nM (black bars) or 20 nM (gray bars) TSA is shown as histograms. The mean values and standard error from at least two (two to three) independent experiments are shown.</p>
               </text>
               <graphic file="gb-2007-8-8-r169-2"/>
            </fig>
            <p>To assess whether enhanced histone acetylation was sufficient to determine early replication, we treated ES cells for 24-48 h with doses of the HDAC inhibitor Trichostatin A (TSA), which raised the global levels of histone acetylation in nuclei (as judged by immunofluorescence; data not shown) without compromising cell viability, proliferation or morphology. TSA treatment of wild-type OS25 ES cells did not affect the replication timing of any of the loci tested, including the region surrounding <it>Rex1 </it>(Figure <figr fid="F2">2b</figr>). Similar treatment has been reported to advance replication of the cystic fibrosis transmembrane conductance (CFTR) gene in cell lines <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>. The failure of TSA treatment to impact on replication of these genes in ES cells suggests that either temporal shifts are highly gene specific or that HDAC inhibition by TSA treatment merely increases histone acetylation at sites that are already acetylated and early replicating in ES cells. Consistent with the latter explanation, TSA treatment was recently shown to increase histone acetylation and expression of genes such as <it>Hox B1 </it>and <it>Brachyury </it>that replicate early in ES cells (L Mazzarella and HFJ, unpublished) <abbrgrp><abbr bid="B21">21</abbr></abbrgrp>.</p>
         </sec>
         <sec>
            <st>
               <p>Altered replication of satellite sequences in ES cells lacking specific chromatin modifiers</p>
            </st>
            <p>Next we assessed the replication of three different murine repeat sequences. X141 is a complex X-linked repeat that is constitutively late replicating and heterochromatic <abbrgrp><abbr bid="B6">6</abbr><abbr bid="B22">22</abbr></abbrgrp>. Minor and major satellites are simple direct repeats located around the centromeres of mouse chromosomes that, in wild-type ES cells, replicate in mid-early and mid-late stages of S-phase, respectively (Figure <figr fid="F3">3a</figr>). In mutant ES cells, late replication of X141 was retained but the timing of both minor and major satellites was altered. Minor satellite replication was selectively delayed in ES cells lacking Mll, which catalyses methylation of H3K4, an activating histone mark. The replication of both satellite sequences was delayed in Eed deficient ES cells, which lack repressive H3K27me3 (Figure <figr fid="F3">3a</figr>). Retarded replication of the major satellite was also seen in cells lacking the Suv39h1/h2 HMTases compared with matched wild-type controls. In contrast, major satellite replication was advanced in Dnmt1 KO and G9a KO ES cells. Interestingly, a comparison of matched mutant and wild-type ES cells showed advanced replication of major satellite sequences in the absence of Dicer, consistent with the proposed role of siRNA in silencing repetitive elements <abbrgrp><abbr bid="B23">23</abbr></abbrgrp>. In a recent study, an advance in the replication of the major satellite in Suv39h1/h2 double knockout (DKO) relative to wild-type fibroblasts was reported <abbrgrp><abbr bid="B24">24</abbr></abbrgrp>, although the authors noted that this advance was, in fact, not statistically significant. The apparent discrepancy between their observation and ours could be the result of intrinsic differences in the mutant cell lines used, or reflect secondary adaptations to loss of chromatin components. In this regard, compensatory chromatin modifications have been previously described, including an increase in H3K27me3 levels in Suv39h1/h2 deficient ES cells <abbrgrp><abbr bid="B25">25</abbr></abbrgrp>.</p>
            <fig id="F3">
               <title>
                  <p>Figure 3</p>
               </title>
               <caption>
                  <p>Satellite replication in ES cells is altered by mutation of chromatin modifiers</p>
               </caption>
               <text>
                  <p>Satellite replication in ES cells is altered by mutation of chromatin modifiers. <b>(a) </b>Summary of replication timing of repeat sequences in mutant ES cell lines. Top, ideogram of the acrocentric mouse chromosome X, showing the position of minor satellite (Minor sat), major satellite (Major sat) and the X-linked X141 repeat. <b>(b) </b>Examples show replication timing of repeats in wild type (WT, white bars (OS25 for Mll, Eed and Dnmt1; matched wild-type lines for G9a, Suv39 h1/h2 and Dicer)) compared to ES cells mutant for the indicated chromatin modifier (black bars). The mean values and standard error of at least two (two to five) independent experiments are shown.</p>
               </text>
               <graphic file="gb-2007-8-8-r169-3"/>
            </fig>
            <p>Minor and major satellites both carry DNA methylation and share some histone marks <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>, but their chromatin structure is remarkably dissimilar. Major satellite DNA replicates in mid to late S-phase in ES and somatic cells and is characterized by hypoacetylation, trimethylation of H3K9 and H4K20 and DNA methylation <abbrgrp><abbr bid="B25">25</abbr><abbr bid="B27">27</abbr><abbr bid="B28">28</abbr></abbrgrp>. The minor satellite contains the centromeric H3 variant CenpA, lacks appreciable amounts of the repressive H3K9me3 and does not bind HP1 <abbrgrp><abbr bid="B28">28</abbr><abbr bid="B29">29</abbr></abbrgrp>. Instead, this repeat carries the permissive H3K4me2 mark <abbrgrp><abbr bid="B28">28</abbr></abbrgrp> and it replicates in the first half of S-phase (Figure <figr fid="F3">3</figr>). We show that the replication timing of major and minor satellites responds very differently to mutation of Mll, Dnmt1, Suv39h1/h2, Dicer and G9a, supporting the view that the two repeats are regulated differently.</p>
            <p>Earlier replication of the major satellite in Dicer KO cells might reflect increased repeat RNA accumulation, as has been reported in some cells upon loss of Dicer <abbrgrp><abbr bid="B23">23</abbr><abbr bid="B30">30</abbr></abbrgrp>, prompting us to measure transcript levels of the repeats in each of the mutant cell lines (Table <tblr tid="T2">2</tblr>). Despite variation among different lines of wild-type ES cells (major 0.7-4, minor 0.1-5), a significant increase in major satellite transcript levels was seen in Dicer KO cells (17 compared with 4 in matched wild-type cells). Increased minor and major satellite transcripts were also seen in Eed deficient ES cells but not in other mutant lines that also change satellite replication timing (for example, Dnmt 1 KO). These data suggest that while chromatin modifiers can influence satellite transcript levels, precocious replication is not an invariable consequence of satellite transcription.</p>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Relative transcript levels* of repeats in ES cell lines</p>
               </caption>
               <tblbdy cols="4">
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>Minor satellite</p>
                     </c>
                     <c ca="center">
                        <p>Major satellite</p>
                     </c>
                     <c ca="center">
                        <p>X141</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>WT (OS25)</p>
                     </c>
                     <c ca="center">
                        <p>0.4 &#177; 0.1</p>
                     </c>
                     <c ca="center">
                        <p>1.8 &#177; 0.5</p>
                     </c>
                     <c ca="center">
                        <p>1.8 &#177; 0.3</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Eed KO</p>
                     </c>
                     <c ca="center">
                        <p>7.2 &#177; 6.5<sup>&#8224;</sup></p>
                     </c>
                     <c ca="center">
                        <p>18.5 &#177; 17.0<sup>&#8224;</sup></p>
                     </c>
                     <c ca="center">
                        <p>1.8 &#177; 0.2</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Dnmt1 KO</p>
                     </c>
                     <c ca="center">
                        <p>0.3 &#177; 0.1</p>
                     </c>
                     <c ca="center">
                        <p>2.1 &#177; 0.0</p>
                     </c>
                     <c ca="center">
                        <p>2.0 &#177; 1.3</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Dnmt3a/3b DKO</p>
                     </c>
                     <c ca="center">
                        <p>0.1 &#177; 0.0</p>
                     </c>
                     <c ca="center">
                        <p>5.7 &#177; 2.4</p>
                     </c>
                     <c ca="center">
                        <p>1.5 &#177; 0.9</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>G9a WT</p>
                     </c>
                     <c ca="center">
                        <p>0.1 &#177; 0.0</p>
                     </c>
                     <c ca="center">
                        <p>0.7 &#177; 0.1</p>
                     </c>
                     <c ca="center">
                        <p>0.5 &#177; 0.7</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>G9a KO</p>
                     </c>
                     <c ca="center">
                        <p>0.4 &#177; 0.4</p>
                     </c>
                     <c ca="center">
                        <p>1.0 &#177; 0.2</p>
                     </c>
                     <c ca="center">
                        <p>ND</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Suv39 h1/h2 WT</p>
                     </c>
                     <c ca="center">
                        <p>4.9 &#177; 0.8</p>
                     </c>
                     <c ca="center">
                        <p>2.5 &#177; 1. 6</p>
                     </c>
                     <c ca="center">
                        <p>1.1 &#177; 0.3</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Suv39 h1/h2 DKO</p>
                     </c>
                     <c ca="center">
                        <p>4.0 &#177; 1.3</p>
                     </c>
                     <c ca="center">
                        <p>2.2 &#177; 0.7</p>
                     </c>
                     <c ca="center">
                        <p>2.1 &#177; 0.5</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Dicer WT</p>
                     </c>
                     <c ca="center">
                        <p>0.2 &#177; 0.0</p>
                     </c>
                     <c ca="center">
                        <p>4.1 &#177; 0.0</p>
                     </c>
                     <c ca="center">
                        <p>2.7 &#177; 0.0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Dicer KO</p>
                     </c>
                     <c ca="center">
                        <p>0.9 &#177; 0.6</p>
                     </c>
                     <c ca="center">
                        <p>17.4 &#177; 5.5</p>
                     </c>
                     <c ca="center">
                        <p>4.1 &#177; 1.2</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>C2C12 dif</p>
                     </c>
                     <c ca="center">
                        <p>100</p>
                     </c>
                     <c ca="center">
                        <p>100</p>
                     </c>
                     <c ca="center">
                        <p>100</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>*Levels of repeat sequence RNA were normalized to a house keeping gene (<it>Ube</it>) and expressed as a percentage of the levels detected in differentiated mouse myocytes derived from C2C12 (C2C12 dif), samples in which high levels of major and minor satellite transcripts have previously been detected [56]. Controls without reverse transcriptase were analyzed in parallel to dismiss contamination with genomic DNA.</p>
                  <p><sup>&#8224;</sup>Four independent samples showed variable but increased transcript levels: major satellite, 8.2%, 8.7%, 13.4%, and 43.8% of C2C12; minor satellite, 2.6%, 7.1%, 11.8%, and 13.8% of C2C12. ND, none detected.</p>
               </tblfn>
            </tbl>
            <p>To determine whether satellite sequences are particularly sensitive to loss of chromatin modifiers or if this is a general repeat-associated feature, we analyzed long interspersed nuclear elements (LINEs) and short interspersed nuclear elements (SINEs), which are found as single copies interspersed with genes and other unique sequences at many locations in the genome, as well as the tandemly repeated rDNA array. In wild-type ES cells, SINE B1 replicates early whereas LINE 1 elements show replication in all fractions of the S-phase (Figure <figr fid="F4">4</figr>), consistent with the known genomic distribution of these repeats; SINEs are primarily associated with gene rich regions (which replicate early), whereas LINEs are enriched in AT-rich, gene poor regions (which often replicate late, but can change replication timing depending on the cell type <abbrgrp><abbr bid="B3">3</abbr></abbrgrp>). The rDNA sequence, which in fibroblasts comprises an early replicating active and a late replicating silent fraction <abbrgrp><abbr bid="B31">31</abbr></abbrgrp>, replicated synchronous very early in S-phase in wild-type ES cells (Figure <figr fid="F4">4</figr>), possibly reflecting a high demand for biosynthesis in these rapidly dividing cells. Analysis of these three repeat sequences in the mutant ES cell lines revealed only very small changes with respect to wild-type cells. Replication of rDNA was extended in Eed deficient cells and slightly delayed in ES cells lacking Dicer.</p>
            <fig id="F4">
               <title>
                  <p>Figure 4</p>
               </title>
               <caption>
                  <p>Replication timing of repetitive elements in wild-type and mutant ES cell lines</p>
               </caption>
               <text>
                  <p>Replication timing of repetitive elements in wild-type and mutant ES cell lines. The replication timing was determined for retrotransposons (LINE and SINE B1) and rDNA repeats in wild-type OS25 ES cells and in mutant ES cells lacking Eed, Dnmt 1, Dnmt 3a/3b, G9a or Dicer. The mean values and standard error of at least two independent experiments are shown.</p>
               </text>
               <graphic file="gb-2007-8-8-r169-4"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>DNA methylation selectively affects major satellite replication timing</p>
            </st>
            <p>Our data show that loss of Dnmt1 in ES cells (which causes genome-wide loss of CpG methylation; Table <tblr tid="T1">1</tblr>) results in early replication of the pericentric major satellite sequence without widespread changes in the replication timing of euchromatic loci or other repeat elements (Figures <figr fid="F3">3</figr> and <figr fid="F4">4</figr>). To verify that reduction in DNA methylation is sufficient to precipitate this advance in major satellite replication, we experimentally demethylated wild-type ES cells. Exposure for three days to the Dnmt inhibitor 5-azacytidine reduced DNA methylation (from 0.88 in untreated to 0.21 in 5-azacytidine-treated cells, compared to 0.11 in the Dnmt1 KO ES cell line; Figure <figr fid="F5">5b</figr>) and caused an advanced replication of the major satellite (Figure <figr fid="F5">5a</figr>). The replication timing of the minor satellite as well as single copy genes (<it>&#945;-Globin</it>, <it>Mash1 </it>and <it>Myf5</it>) was unaffected in treated cells. Collectively, these results suggest that DNA methylation <it>per se </it>is important for maintaining the correct temporal replication of the major satellite.</p>
            <fig id="F5">
               <title>
                  <p>Figure 5</p>
               </title>
               <caption>
                  <p>Major satellite replication is specifically advanced by 5-azacytidine treatment</p>
               </caption>
               <text>
                  <p>Major satellite replication is specifically advanced by 5-azacytidine treatment. <b>(a) </b>Replication timing of 5-azacytidine treated (black bars) and untreated ES cells (white bars). The mean values and standard error of at two independent experiments are shown. <b>(b) </b>Demethylation index (HpyCh4IV digested to undigested genomic DNA) of the major satellite in untreated (OS25), 5-azacytidine-treated and Dnmt1 KO ES cells. <it>Sox2 </it>(no HpyCh4IV site) serves as an internal control. Diagrams show the positions of primers and HpyChIV site. The standard deviation is shown in brackets.</p>
               </text>
               <graphic file="gb-2007-8-8-r169-5"/>
            </fig>
            <p>A role for DNA methylation in replication of heterochromatic foci has been previously observed in fibroblasts and during development <abbrgrp><abbr bid="B32">32</abbr></abbrgrp>. Here we show that DNA methylation is important in maintaining late replication specifically of major satellite repeats in undifferentiated ES cells. As DNA methylation of the major satellite is also reduced in Suv39h1/h2 DKO ES cells (Table <tblr tid="T1">1</tblr>), it is perhaps surprising that these mutant cells have delayed major satellite replication (Figure <figr fid="F3">3</figr>). It is possible that other chromatin modifications compensate for the loss of H3K9me3 to ensure heterochromatin formation in Suv39h1/h2 deficient cells, an idea that is consistent with enhanced H3K27me3 at pericentric regions in these cells <abbrgrp><abbr bid="B25">25</abbr></abbrgrp>.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Conclusion</p>
         </st>
         <p>We show that the timing of mouse satellite replication is altered in ES cells lacking specific repressive chromatin modifiers. In particular, replication was advanced by mutation of Dnmt1, G9a or Dicer, consistent with their repressive nature. Earlier replication of major satellite was also induced by 5-azacytidine treatment, demonstrating the importance of DNA methylation for correct timing of this sequence. The sensitivity of satellite repeats to chromatin modifiers may be a reflection of their complexity and size. Genome-wide studies have shown that replication timing of non-repetitive sequences is constant over large 0.2-2 Mb regions <abbrgrp><abbr bid="B7">7</abbr></abbrgrp>, which often include multiple loci that are regulated by different mechanisms. Repetitive regions, on the other hand, have a more uniform chromatin structure, which may make them more vulnerable to loss of specific chromatin modifiers. Consistent with this idea, the major and minor satellites comprise simple direct repeats with high copy numbers (50-200,000) <abbrgrp><abbr bid="B26">26</abbr></abbrgrp> whereas the stable X141 is part of a much more complex repetitive region and is represented only 80-90 times in the mouse genome <abbrgrp><abbr bid="B22">22</abbr></abbrgrp>. Interestingly, the size of the late replicating fraction of the tandemly repeated rDNA array in fibroblasts was shown to depend on NoRC, an ATP-dependant chromatin remodeling complex <abbrgrp><abbr bid="B33">33</abbr></abbrgrp>.</p>
         <p>Of the single copy genes examined in the study, we show that the replication timing of some loci are more sensitive to the loss of individual chromatin modifiers than others. Overall, the apparent stability of gene replication profiles in mutant ES cell lines suggests that for many single copy loci, replication timing is not primarily controlled by methylation of specific histone residues or DNA methylation, but, in agreement with previous studies <abbrgrp><abbr bid="B4">4</abbr><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr><abbr bid="B11">11</abbr></abbrgrp>, histone acetylation is shown to be a good predictor of replication timing. These data are consistent with a mechanistic link between early origin firing and acetylation in mammalian cells, as has been previously demonstrated in yeast <abbrgrp><abbr bid="B10">10</abbr></abbrgrp>.</p>
      </sec>
      <sec>
         <st>
            <p>Materials and methods</p>
         </st>
         <sec>
            <st>
               <p>ES cell culture and drug treatment</p>
            </st>
            <p>ES cells used in this study were wild-type OS25 <abbrgrp><abbr bid="B34">34</abbr></abbrgrp>, G9a knock out (KO) clone 2-3, G9a wild-type clone col4 (G9a WT), G9a transgene rescue clone 15-3 (G9a tg) <abbrgrp><abbr bid="B18">18</abbr></abbrgrp>, Suv39 h1/h2 double KO (DKO) clones DN57/DN72 and wild-type littermate clone wt26 (Suv39 h1/h2 WT) <abbrgrp><abbr bid="B35">35</abbr></abbrgrp>, Eed KO clones B1.3/G8.1 <abbrgrp><abbr bid="B4">4</abbr></abbrgrp>, Dnmt1 c/c (Dnmt1 KO) <abbrgrp><abbr bid="B36">36</abbr></abbrgrp>, Dnmt3a/Dnmt3b DKO clone 10 (Dnmt3a/3b DKO) <abbrgrp><abbr bid="B27">27</abbr><abbr bid="B37">37</abbr></abbrgrp>, Mbd3 KO clone Fix2 <abbrgrp><abbr bid="B38">38</abbr></abbrgrp>, Dicer KO clones D3-S5/D3-S6 and Dicer wild-type clone D3 (described below). ES cells were derived from Dicer flox/flox blastocysts <abbrgrp><abbr bid="B39">39</abbr></abbrgrp> and transfected with the CRE-ER transgene to produce the Dicer flox/flox ES clone D3 (Dicer WT). The Dicer KO clones (D3-S5, D3-S6) were established after tamoxifen treatment (800 nM; Sigma, Poole, UK) of the D3 clone. Deletion of both alleles was confirmed by genotyping.</p>
            <p>The ES cell lines were maintained in the undifferentiated state by culturing on gelatinized plates in KO-DMEM (Invitrogen, Carlsbad, CA, USA) supplemented with leukemia inhibitory factor (LIF), 10% ES-tested fetal calf serum (GlobePharm, Surrey, UK), L-glutamine, 2-mercaptoethanol, non-essential amino acids and antibiotics. For Eed KO and Dicer cells (WT and KO), a feeder layer of mitotic inactivated fibroblasts was used and the medium was additionally supplemented with 5% knockout serum replacement (KSR, Invitrogen). OS25 cells were grown on gelatinized plates in Glasgow-MEM (Invitrogen) supplemented with LIF, FCS-gold (PAA, Yeovil, UK), L-glutamine, 2-mercaptoethanol, non-essential amino acids, sodium pyruvate, sodium bicarbonate and antibiotics. All ES cell lines examined in this study were Oct4 positive as determined by immunofluorescence (>92 %, data not shown). Undifferentiated ES cells (OS25) were treated with 10 nM (Sigma) for 48 h, 20 nM TSA for 24 h or 15 &#956;M 5-azacytidine (Sigma) for 72 h.</p>
         </sec>
         <sec>
            <st>
               <p>Replication timing assay</p>
            </st>
            <p>The protocol described by Azuara <it>et al</it>. <abbrgrp><abbr bid="B6">6</abbr></abbrgrp> was used. Briefly, asynchronous cell populations were pulse labeled with bromodeoxyuridine (BrdU; 30 minutes), fixed in 70% ethanol, stained with propidium iodide and fractionated according to DNA content by fluorescence assisted cell sorting (FACS). For ES cells grown on a feeder layer, the feeder cells were removed by differential attachment; less than 1% fibroblasts remained after 20-25 minutes plating in non-gelatinized plates. Pre-plating of feeder-dependent ES cells in this way may result in a slight delay in the apparent time of replication for genes that normally replicate very early in S-phase. Six cell cycle fractions were collected, G1-S, G2 and four fractions covering S-phase, S1-S4, where S1 corresponds to early S-phase and S4 to late S-phase. An equal amount of BrdU labeled <it>Drosophila </it>DNA was added to each fraction to control for equal recovery. After isolation of total genomic DNA, the DNA was sheared by sonication, denatured and newly replicated, BrdU-labeled DNA was immunoprecipitated using anti-BrdU antibody (BD, Franklin Lakes, NJ, USA). After purification, quantitative real-time PCR (qPCR) was employed to determine the relative quantity of specific loci in each fraction. The sequences of primers for qPCR analysis are given in Table <tblr tid="T3">3</tblr>. Locus replication was categorized based on the peak fraction(s) as early (peak in G1 or S1), middle-early (peak in S2), middle (peak in S2 and S3), middle-late (peak in S3) or late (peak in S4 or G2).</p>
            <tbl id="T3">
               <title>
                  <p>Table 3</p>
               </title>
               <caption>
                  <p>Primer sequences</p>
               </caption>
               <tblbdy cols="4">
                  <r>
                     <c ca="left">
                        <p>Locus</p>
                     </c>
                     <c ca="left">
                        <p>Forward</p>
                     </c>
                     <c ca="left">
                        <p>Reverse</p>
                     </c>
                     <c ca="center">
                        <p>T<sub>ann</sub></p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Replication timing/ChIP</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>
                           <it>Gbe</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>GGTGCAGATCATCCCCTTGA</p>
                     </c>
                     <c ca="left">
                        <p>TTACCCGACGGCGAAAG</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>&#945;-<it>Globin</it></p>
                     </c>
                     <c ca="left">
                        <p>CCACAAGCTGCGTGTGGAT</p>
                     </c>
                     <c ca="left">
                        <p>ATGCCGCCTGCCAGGT</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>
                           <it>Oct4</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>GGGTGAGAAGGCGAAGTCTGAA</p>
                     </c>
                     <c ca="left">
                        <p>GTGAGCCGTCTTTCCACCAGG</p>
                     </c>
                     <c ca="center">
                        <p>55</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>
                           <it>Nanog</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>CCCTCTGAGTTTGACCGGTGA</p>
                     </c>
                     <c ca="left">
                        <p>CAAGCTAGGATGTTAGGTCTCCCTG</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>
                           <it>Esg1</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>AAAGACGAACACAGAGTCAAACACC</p>
                     </c>
                     <c ca="left">
                        <p>CACCTGCTCGATGTGAGACATTC</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>
                           <it>Zfp57</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>TGCAAGATAAGAACGAGGAGCAGGAG</p>
                     </c>
                     <c ca="left">
                        <p>CCTTTGCGGCTTTGTGGATTTGTG</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>
                           <it>Rex1</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>TTTGCGGGAATCCAGCAGT</p>
                     </c>
                     <c ca="left">
                        <p>CGTCCCATCGCCACTCTAGAC</p>
                     </c>
                     <c ca="center">
                        <p>55</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>
                           <it>Sox2</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>CCATCCACCCTTATGTATCCAAG</p>
                     </c>
                     <c ca="left">
                        <p>CGAAGGAAGTGGGTAAACAGCAC</p>
                     </c>
                     <c ca="center">
                        <p>55</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>
                           <it>Nkx2.9</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>AAGTGCGAGGCGCTCG</p>
                     </c>
                     <c ca="left">
                        <p>TGGCACCTTCCGGACTTG</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>
                           <it>Sox3</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>TGCCCAGATGGCTTCCTATT</p>
                     </c>
                     <c ca="left">
                        <p>ACCCGGACATTCTCCGCT</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>
                           <it>Mage a2</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>TTGGTGGACAGGGAAGCTAGGGGA</p>
                     </c>
                     <c ca="left">
                        <p>CGCTCCAGAACAAAATGGCGCAGA</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>
                           <it>Ebf</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>AGATCTGGTTGAAGCCCTGTATGG</p>
                     </c>
                     <c ca="left">
                        <p>CATGTCACATCTCAGATCCTGTGTTCT</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>
                           <it>Mash1</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>CCAGGCTGGAGCAAGGGA</p>
                     </c>
                     <c ca="left">
                        <p>CGGTTGGCTTCGGGAGC</p>
                     </c>
                     <c ca="center">
                        <p>55</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>
                           <it>&#946;-Globin</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>GGTGAACTTTACTGCTGAGGAAAAG</p>
                     </c>
                     <c ca="left">
                        <p>TCACCACCAACCTCTTCAACAT</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>
                           <it>Myf5</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>GGAGATCCGTGCGTTAAGAATCC</p>
                     </c>
                     <c ca="left">
                        <p>CGGTAGCAAGACATTAAAGTTCCGTA</p>
                     </c>
                     <c ca="center">
                        <p>55</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>
                           <it>Math1</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>CCCTCACTCAGGTCGCCTG</p>
                     </c>
                     <c ca="left">
                        <p>CGTGCGAGGAGCCAATCA</p>
                     </c>
                     <c ca="center">
                        <p>55</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>
                           <it>Sox1</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>ACAAGAGGAGGCAGCGAACC</p>
                     </c>
                     <c ca="left">
                        <p>TCGCAGGTGGAAAGTTTCTCC</p>
                     </c>
                     <c ca="center">
                        <p>55</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>
                           <it>Msx1</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>ACAGAAAGAAATAGCACAGACCATAAGA</p>
                     </c>
                     <c ca="left">
                        <p>TTCTACCAAGTTCCAGAGGGACTTT</p>
                     </c>
                     <c ca="center">
                        <p>55</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>
                           <it>Frg1</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>AAGGAGCCTATATCCATGCACTGGAC</p>
                     </c>
                     <c ca="left">
                        <p>GCCTCCCTGCCATTGCTTGT</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>
                           <it>Slc7a2</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>GACAAGGAACAGGGCGAGAAG</p>
                     </c>
                     <c ca="left">
                        <p>CTTTCCTCATCCTGGGCTTGAGTA</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>
                           <it>Msr1</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>GCCACCAATGCCCTAGAATTTC</p>
                     </c>
                     <c ca="left">
                        <p>GGCAGGCTCTCACTAGGAAGC</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>
                           <it>Loc2</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>ACTAGCAACTGGACATAAGAGTACACTACC</p>
                     </c>
                     <c ca="left">
                        <p>ATTACATATGGTGTCTGGAAGCCAG</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>
                           <it>Adam 26</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>CCTTGAACAACGCCCTTTTGTG</p>
                     </c>
                     <c ca="left">
                        <p>GCAAGCTCCCAAAACAGGTGT</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>
                           <it>Loc4</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>TAAGGTAGGCAGTGAGAGACATCCA</p>
                     </c>
                     <c ca="left">
                        <p>GGTGTAAGAAGGTTAGAACTAA</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>X141</p>
                     </c>
                     <c ca="left">
                        <p>GGGTCATAAAACGCTTTTCCAGGAA</p>
                     </c>
                     <c ca="left">
                        <p>TAGCACTGGAGATCAGATTGACGCCT</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>Minor satellite</p>
                     </c>
                     <c ca="left">
                        <p>TGATATACACTGTTCTACAAATCCCGTTTC</p>
                     </c>
                     <c ca="left">
                        <p>ATCAATGAGTTACAATGAGAAACATGGAAA</p>
                     </c>
                     <c ca="center">
                        <p>55</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>Major satellite</p>
                     </c>
                     <c ca="left">
                        <p>GACGACTTGAAAAATGACGAAATC</p>
                     </c>
                     <c ca="left">
                        <p>CATATTCCAGGTCCTTCAGTGTGC</p>
                     </c>
                     <c ca="center">
                        <p>55</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>rDNA</p>
                     </c>
                     <c ca="left">
                        <p>CCTGTGAATTCTCTGAACTC</p>
                     </c>
                     <c ca="left">
                        <p>CCTAAACTGCTGACAGGGTG</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>IAP</p>
                     </c>
                     <c ca="left">
                        <p>TTGATAGTTGTGTTTTAAGTGGTAAATAAA</p>
                     </c>
                     <c ca="left">
                        <p>AAAACACCACAAACCAAAATCTTCTAC</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>LINE 1</p>
                     </c>
                     <c ca="left">
                        <p>TTTGGGACACAATGAAAGCA</p>
                     </c>
                     <c ca="left">
                        <p>CTGCCGTCTACTCCTCTTGG</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>SINE B1</p>
                     </c>
                     <c ca="left">
                        <p>GTGGCGCACGCCTTTAATC</p>
                     </c>
                     <c ca="left">
                        <p>GACAGGGTTTCTCTGTGTAG</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Gene expression</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>
                           <it>Mage a2</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>GAAGATCTCAGGAGTGTCAGGACTG</p>
                     </c>
                     <c ca="left">
                        <p>TCAGCCATTATGACTGTCCTAGGTAA</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>
                           <it>Ubc</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>AGGAGGCTGATGAAGAGCTTGA</p>
                     </c>
                     <c ca="left">
                        <p>TGGTTTGAATGGATACTCTGCTGGA</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>
                           <it>Oct4</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>CCCAAGGTGATCCTCTTCTGCTT</p>
                     </c>
                     <c ca="left">
                        <p>GAGAAGGTGGAACCAACTCCCG</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>CpG methylation assay</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>
                           <it>Major sat</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>GACGACTTGAAAAATGACGAAATC</p>
                     </c>
                     <c ca="left">
                        <p>CATATTCCAGGTCCTTCAGTGTGC</p>
                     </c>
                     <c ca="center">
                        <p>55</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>
                           <it>Sox2</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>TGGACTGCGAACTGGAGAAGG</p>
                     </c>
                     <c ca="left">
                        <p>CGCCCGGAGTCTAGCTCTAAATATT</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>IAP, intracisternal A particle. T<sub>ann</sub>, annealing temperature.</p>
               </tblfn>
            </tbl>
            <sec>
               <st>
                  <p>Note regarding replication timing of repeated sequences</p>
               </st>
               <p>As mentioned above, we assessed the proportion of a specific DNA sequence within newly replicated DNA for each cell cycle fraction relative to the total from all six fractions. This means that for single copy genes, a change in one allele will give a shift for 50% of the signal whereas for a multi-copy locus, only a small fraction (1% for a sequence repeated 100 times) will shift. Changes in single copy loci are, therefore, much more readily detected than changes in repeated sequences. Variability in locus replication among multi-copy loci would be predicted to result in a spread-out signal detected across multiple cell cycle fractions.</p>
            </sec>
         </sec>
         <sec>
            <st>
               <p>ChIP</p>
            </st>
            <p>Exponentially growing wild-type ES cells (OS25) were paraformaldehyde (1%) fixed for 10 minutes at room temperature, lysed and chromatin immuno-precipitated essentially as described <abbrgrp><abbr bid="B40">40</abbr></abbrgrp>. Briefly, chromatin (50 &#956;g) was pre-cleared 2 h at 4&#176;C, incubated with antibodies (2 &#956;l IgG (Z0259, DAKO, Copenhagen, Denmark); 2 &#956;l anti-H3 (ab-1791-100, binds H3 independent of modification state, Abcam, Cambridge, UK), 5 &#956;l anti-H3K9me2, 10 &#956;l anti-H3K9me3 or 5 &#956;l anti-H3K9ac (07-441, 07-442, 07-352, Upstate/Millipore, Billerica, MA, USA) at 4&#176;C over night (ON) and the immune-complexes collected by adding protein-A sepharose (Sigma) (incubated 2 h at 4&#176;C). Unbound chromatin was removed by washing 4&#215; in ChIP wash buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 150 mM NaCl, 20 mM Tris.Cl pH 8.1 and protease inhibitors) and 1&#215; in high salt ChIP wash buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 150 mM NaCl, 20 mM Tris.Cl pH 8.1 and protease inhibitors) after which 250 &#956;l elution buffer was added (1% SDS, 0.1 M NaHCO<sub>3</sub>, 100 &#956;g/ml RNaseA, 500 &#956;g/ml Proteinase K). After incubating at 37&#176;C for 2 h and at 65&#176;C ON, DNA was purified using a Gel purification kit (Qiagen, Crawley, UK), using 2 &#215; 40 &#956;l of 10 mM Tris.Cl pH 8 for elution. ChIP samples were analyzed by qPCR (sequences of primers are given in Table <tblr tid="T3">3</tblr>) or microarray hybridization.</p>
         </sec>
         <sec>
            <st>
               <p>Microarray analysis</p>
            </st>
            <p>Input and ChIP samples were amplified by LM-PCR as advised by Nimblegen, Reykjavik, Iceland. Labeling and hybridization was done by Nimblegen using a custom designed 50mer tiling array (100 bp average resolution) covering a region from 100 kb upstream to 100 kb downstream of the analyzed genes. Normalized and scaled Chip: input ratios for anti-H3K9ac and anti-H3 ChIP hybridizations were produced by Nimblegen. The log2(H3K9ac/H3) ratios were calculated from these data and plotted against the chromosomal position of the probes. Blue lines in Figure <figr fid="F2">2</figr> indicate peaks in the dataset detected by a hidden Markov model-based algorithm using TileMap <abbrgrp><abbr bid="B41">41</abbr></abbrgrp>. Gaps in the profile arise from repetitive regions in the genome that are not represented on the array.</p>
         </sec>
         <sec>
            <st>
               <p>Analysis of transcript levels</p>
            </st>
            <p>RNA was isolated from 3-5 &#215; 10<sup>6 </sup>cells using the RNAeasy mini prep kit (Qiagen) with on-column DNase treatment. To remove residual genomic DNA, RNA (1.2 &#956;g) was treated with RNAfree (Ambion, Austin, TX, USA) for 50 minutes before reverse transcription using SuperScript III (Invitrogen) and random primers in 20 &#956;l reactions according to the manufacturer's instructions.</p>
         </sec>
         <sec>
            <st>
               <p>qPCR analysis</p>
            </st>
            <p>The sequence of primer pairs used in this study is given in Table <tblr tid="T3">3</tblr>. All primer pairs were tested for efficiency (>1.95) and linearity (R<sup>2 </sup>> 0.99). Reactions (30 &#956;l) were set up using a Qiagen SYBR green kit with the appropriate template (2 &#956;l (corresponding to 200 cell equivalents) for replication timing, 1.5 &#956;l of 1:5 diluted cDNA for gene expression, 2% of eluted DNA for ChIP, 2 &#956;l (corresponding to 1.7 ng) genomic DNA for analysis of DNA methylation) and analyzed on Chromo4&#8482; Real-Time PCR Detector (Bio-Rad, Hercules, CA, USA) with Opticon Monitor&#8482; software.</p>
         </sec>
         <sec>
            <st>
               <p>DNA methylation assay</p>
            </st>
            <p>Triplicate reactions of genomic DNA with or without the methylation sensitive restriction enzyme HpyCh4IV (New England Biolabs, Beverly, USA) were incubated for 3 h and the extent of digestion analyzed by qPCR. The primers for the major satellite span a HpyCh4IV site. The Sox2 primers, which do not span a HpyCh4IV site, were used to control for equal DNA content.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Additional data files</p>
         </st>
         <p>The following additional data are available with the online version of this paper. Additional data file <supplr sid="S1">1</supplr> contains supplementary materials and methods, legends to supplementary Figures 1-4, and supplementary Tables 1 and 2. Supplementary Table 1 contains the percentages of cells positive for ES cell markers and Supplementary Table 2 contains coordinates, GC content and Line density of the genes analysed in Figure <figr fid="F1">1b</figr>. Additional data file <supplr sid="S2">2</supplr> contains supplementary Figures 1-4. Supplementary Figure 1 shows alkaline phosphatase staining and cell cycle profiles of the mutant ES cell lines analysed. Supplementary Figure 2 contains replication timing profiles of all loci analysed in each of the mutant ES cell lines analysed. Supplementary Figure 3 shows analysis of the <it>Mage a2 </it>gene. Supplementary Figure 4 shows analysis of short hairpin RNA mediated knockdown of Eed in Dnmt1 mutant ES cells. Additional data file <supplr sid="S3">3</supplr> is an archive containing microarray data for the histone acetylation analysis.</p>
         <suppl id="S1">
            <title>
               <p>Additional data file 1</p>
            </title>
            <caption>
               <p>Supplementary materials and methods, legends to supplementary Figures 1-4, and supplementary Tables 1 and 2</p>
            </caption>
            <text>
               <p>Supplementary Table 1 contains the percentages of cells positive for ES cell markers and supplementary Table 2 contains coordinates, GC content and line density of the genes analyzed in Figure <figr fid="F1">1b</figr>.</p>
            </text>
            <file name="gb-2007-8-8-r169-S1.pdf">
               <p>Click here for file</p>
            </file>
         </suppl>
         <suppl id="S2">
            <title>
               <p>Additional data file 2</p>
            </title>
            <caption>
               <p>Supplementary Figures 1-4</p>
            </caption>
            <text>
               <p>Supplementary Figure 1 shows alkaline phosphatase staining and cell cycle profiles of the mutant ES cell lines analyzed. Supplementary Figure 2 contains replication timing individual profiles of all genes in each of the mutant ES cell lines analyzed. Supplementary Figure 3 shows analysis of the <it>Mage a2 </it>gene. Supplementary Figure 4 shows analysis of short hairpin RNA mediated knockdown of Eed in Dnmt1 mutant ES cells.</p>
            </text>
            <file name="gb-2007-8-8-r169-S2.pdf">
               <p>Click here for file</p>
            </file>
         </suppl>
         <suppl id="S3">
            <title>
               <p>Additional data file 3</p>
            </title>
            <caption>
               <p>Microarray data for the histone acetylation analysis</p>
            </caption>
            <text>
               <p>Microarray data for the histone acetylation analysis.</p>
            </text>
            <file name="gb-2007-8-8-r169-S3.zip">
               <p>Click here for file</p>
            </file>
         </suppl>
      </sec>
      <sec>
         <st>
            <p>Abbreviations</p>
         </st>
         <p>BrdU, bromodeoxyuridine; ChIP, chromatin immunoprecipitation; DKO, double knock out; Dnmt, DNA methyl transferase; ES, embryonic stem; HDAC, histone deacetylase; HMTase, histone methyl transferase; KO, knock out; LINE, long interspersed nuclear element; PRC, polycomb repressor complex; qPCR, quantitative real-time PCR; SINE, short interspersed nuclear element; siRNA, short interfering RNA; TSA, trichostatin A.</p>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>HFJ, VA and AGF designed the study described in this report. HFJ performed the experiments, analysed the data, and was responsible for writing the initial versions of the manuscript. SA performed cell culture experiments. MS and AT were involved in performing the microarray analysis. MS analysed the microarray data. TN, BSC and BR contributed material/reagents/analysis tools. MM and AGF supervised and oversaw the completion of the studies as well as the writing of the manuscript. All authors read and approved the final version of the manuscript.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>We thank Brian Hendrich, Thomas Jenuwein, Yoichi Shinkai and En Li for kind gifts of mutant ES cell lines and Rosalind John for advice on culturing Eed KO cells. Pascale Perry and Luca Mazzarella are thanked for sharing unpublished information. Eric O'Connor and Eugene Ng are acknowledged for FACS sorting and Ingrid Devonish for administrative help. This study was supported by the MRC, the EU Epigenome Network of Excellence, the Parkinson's Disease Society (VA) and HEROIC, High-throughput Epigenetic Regulatory Organisation in Chromatin, an Integrated Project funded by the European Union (LSHG-CT-2005-018883).</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Replicon clusters are stable units of chromosome structure: evidence that nuclear organization contributes to the efficient activation and propagation of S phase in human cells.</p>
            </title>
            <aug>
               <au>
                  <snm>Jackson</snm>
                  <fnm>DA</fnm>
               </au>
               <au>
                  <snm>Pombo</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>J Cell Biol</source>
            <pubdate>1998</pubdate>
            <volume>140</volume>
            <fpage>1285</fpage>
            <lpage>1295</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1083/jcb.140.6.1285</pubid>
                  <pubid idtype="pmpid" link="fulltext">9508763</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>A dynamic switch in the replication timing of key regulator genes in embryonic stem cells upon neural induction.</p>
            </title>
            <aug>
               <au>
                  <snm>Perry</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Sauer</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Billon</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Richardson</snm>
                  <fnm>WD</fnm>
               </au>
               <au>
                  <snm>Spivakov</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Warnes</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Livesey</snm>
                  <fnm>FJ</fnm>
               </au>
               <au>
                  <snm>Merkenschlager</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Fisher</snm>
                  <fnm>AG</fnm>
               </au>
               <au>
                  <snm>Azuara</snm>
                  <fnm>V</fnm>
               </au>
            </aug>
            <source>Cell Cycle</source>
            <pubdate>2004</pubdate>
            <volume>3</volume>
            <fpage>1645</fpage>
            <lpage>1650</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">15611653</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>Differentiation-induced replication-timing changes are restricted to AT-rich/long interspersed nuclear element (LINE)-rich isochores.</p>
            </title>
            <aug>
               <au>
                  <snm>Hiratani</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Leskovar</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Gilbert</snm>
                  <fnm>DM</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>2004</pubdate>
            <volume>101</volume>
            <fpage>16861</fpage>
            <lpage>16866</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">534734</pubid>
                  <pubid idtype="pmpid" link="fulltext">15557005</pubid>
                  <pubid idtype="doi">10.1073/pnas.0406687101</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Chromatin signatures of pluripotent cell lines.</p>
            </title>
            <aug>
               <au>
                  <snm>Azuara</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Perry</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Sauer</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Spivakov</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Jorgensen</snm>
                  <fnm>HF</fnm>
               </au>
               <au>
                  <snm>John</snm>
                  <fnm>RM</fnm>
               </au>
               <au>
                  <snm>Gouti</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Casanova</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Warnes</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Merkenschlager</snm>
                  <fnm>M</fnm>
               </au>
               <etal/>
            </aug>
            <source>Nat Cell Biol</source>
            <pubdate>2006</pubdate>
            <volume>8</volume>
            <fpage>532</fpage>
            <lpage>538</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/ncb1403</pubid>
                  <pubid idtype="pmpid" link="fulltext">16570078</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Position effect of human telomeric repeats on replication timing.</p>
            </title>
            <aug>
               <au>
                  <snm>Ofir</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Wong</snm>
                  <fnm>ACC</fnm>
               </au>
               <au>
                  <snm>McDermid</snm>
                  <fnm>HE</fnm>
               </au>
               <au>
                  <snm>Skorecki</snm>
                  <fnm>KL</fnm>
               </au>
               <au>
                  <snm>Selig</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>1999</pubdate>
            <volume>96</volume>
            <fpage>11434</fpage>
            <lpage>11439</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">18051</pubid>
                  <pubid idtype="pmpid" link="fulltext">10500194</pubid>
                  <pubid idtype="doi">10.1073/pnas.96.20.11434</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>Heritable gene silencing in lymphocytes delays chromatid resolution without affecting the timing of DNA replication.</p>
            </title>
            <aug>
               <au>
                  <snm>Azuara</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Brown</snm>
                  <fnm>KE</fnm>
               </au>
               <au>
                  <snm>Williams</snm>
                  <fnm>RR</fnm>
               </au>
               <au>
                  <snm>Webb</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Dillon</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Festenstein</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Buckle</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Merkenschlager</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Fisher</snm>
                  <fnm>AG</fnm>
               </au>
            </aug>
            <source>Nat Cell Biol</source>
            <pubdate>2003</pubdate>
            <volume>5</volume>
            <fpage>668</fpage>
            <lpage>674</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/ncb1006</pubid>
                  <pubid idtype="pmpid" link="fulltext">12833066</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Shaping time: chromatin structure and the DNA replication programme.</p>
            </title>
            <aug>
               <au>
                  <snm>Donaldson</snm>
                  <fnm>AD</fnm>
               </au>
            </aug>
            <source>Trends Genet</source>
            <pubdate>2005</pubdate>
            <volume>21</volume>
            <fpage>444</fpage>
            <lpage>449</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.tig.2005.05.012</pubid>
                  <pubid idtype="pmpid" link="fulltext">15951049</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>Dynamic alterations of replication timing in mammalian cells.</p>
            </title>
            <aug>
               <au>
                  <snm>Lin</snm>
                  <fnm>CM</fnm>
               </au>
               <au>
                  <snm>Fu</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Martinovsky</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Bouhassira</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Aladjem</snm>
                  <fnm>MI</fnm>
               </au>
            </aug>
            <source>Curr Biol</source>
            <pubdate>2003</pubdate>
            <volume>13</volume>
            <fpage>1019</fpage>
            <lpage>1028</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0960-9822(03)00382-8</pubid>
                  <pubid idtype="pmpid" link="fulltext">12814547</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Genomic targeting of methylated DNA: influence of methylation on transcription, replication, chromatin structure, and histone acetylation.</p>
            </title>
            <aug>
               <au>
                  <snm>Schubeler</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Lorincz</snm>
                  <fnm>MC</fnm>
               </au>
               <au>
                  <snm>Cimbora</snm>
                  <fnm>DM</fnm>
               </au>
               <au>
                  <snm>Telling</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Feng</snm>
                  <fnm>YQ</fnm>
               </au>
               <au>
                  <snm>Bouhassira</snm>
                  <fnm>EE</fnm>
               </au>
               <au>
                  <snm>Groudine</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Mol Cell Biol</source>
            <pubdate>2000</pubdate>
            <volume>20</volume>
            <fpage>9103</fpage>
            <lpage>9112</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">102168</pubid>
                  <pubid idtype="pmpid" link="fulltext">11094062</pubid>
                  <pubid idtype="doi">10.1128/MCB.20.24.9103-9112.2000</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Histone acetylation regulates the time of replication origin firing.</p>
            </title>
            <aug>
               <au>
                  <snm>Vogelauer</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Rubbi</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Lucas</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Brewer</snm>
                  <fnm>BJ</fnm>
               </au>
               <au>
                  <snm>Grunstein</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Mol Cell</source>
            <pubdate>2002</pubdate>
            <volume>10</volume>
            <fpage>1223</fpage>
            <lpage>1233</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S1097-2765(02)00702-5</pubid>
                  <pubid idtype="pmpid" link="fulltext">12453428</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Establishment of transcriptional competence in early and late S phase.</p>
            </title>
            <aug>
               <au>
                  <snm>Zhang</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Xu</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Hashimshony</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Keshet</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Cedar</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>2002</pubdate>
            <volume>420</volume>
            <fpage>198</fpage>
            <lpage>202</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nature01150</pubid>
                  <pubid idtype="pmpid" link="fulltext">12432398</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Control of gene expression and assembly of chromosomal subdomains by chromatin regulators with antagonistic functions.</p>
            </title>
            <aug>
               <au>
                  <snm>Ai Leen</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Dorothy</snm>
                  <fnm>EP</fnm>
               </au>
               <au>
                  <snm>Beth</snm>
                  <fnm>AS</fnm>
               </au>
            </aug>
            <source>Chromosoma</source>
            <pubdate>2005</pubdate>
            <volume>114</volume>
            <fpage>242</fpage>
            <lpage>251</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s00412-005-0001-0</pubid>
                  <pubid idtype="pmpid" link="fulltext">16012860</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>A bivalent chromatin structure marks key developmental genes in embryonic stem cells.</p>
            </title>
            <aug>
               <au>
                  <snm>Bernstein</snm>
                  <fnm>BE</fnm>
               </au>
               <au>
                  <snm>Mikkelsen</snm>
                  <fnm>TS</fnm>
               </au>
               <au>
                  <snm>Xie</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Kamal</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Huebert</snm>
                  <fnm>DJ</fnm>
               </au>
               <au>
                  <snm>Cuff</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Fry</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Meissner</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Wernig</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Plath</snm>
                  <fnm>K</fnm>
               </au>
               <etal/>
            </aug>
            <source>Cell</source>
            <pubdate>2006</pubdate>
            <volume>125</volume>
            <fpage>315</fpage>
            <lpage>326</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.cell.2006.02.041</pubid>
                  <pubid idtype="pmpid" link="fulltext">16630819</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>Polycomb complexes repress developmental regulators in murine embryonic stem cells.</p>
            </title>
            <aug>
               <au>
                  <snm>Boyer</snm>
                  <fnm>LA</fnm>
               </au>
               <au>
                  <snm>Plath</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Zeitlinger</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Brambrink</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Medeiros</snm>
                  <fnm>LA</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>TI</fnm>
               </au>
               <au>
                  <snm>Levine</snm>
                  <fnm>SS</fnm>
               </au>
               <au>
                  <snm>Wernig</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Tajonar</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Ray</snm>
                  <fnm>MK</fnm>
               </au>
               <etal/>
            </aug>
            <source>Nature</source>
            <pubdate>2006</pubdate>
            <volume>441</volume>
            <fpage>349</fpage>
            <lpage>353</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nature04733</pubid>
                  <pubid idtype="pmpid" link="fulltext">16625203</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>Stem cells primed for action: polycomb repressive complexes restrain the expression of lineage-specific regulators in embryonic stem cells.</p>
            </title>
            <aug>
               <au>
                  <snm>Jorgensen</snm>
                  <fnm>HF</fnm>
               </au>
               <au>
                  <snm>Giadrossi</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Casanova</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Endoh</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Koseki</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Brockdorff</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Fisher</snm>
                  <fnm>AG</fnm>
               </au>
            </aug>
            <source>Cell Cycle</source>
            <pubdate>2006</pubdate>
            <volume>5</volume>
            <fpage>1411</fpage>
            <lpage>1414</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">16855402</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Neural induction promotes large-scale chromatin reorganisation of the Mash1 locus.</p>
            </title>
            <aug>
               <au>
                  <snm>Williams</snm>
                  <fnm>RR</fnm>
               </au>
               <au>
                  <snm>Azuara</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Perry</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Sauer</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Dvorkina</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Jorgensen</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Roix</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>McQueen</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Misteli</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Merkenschlager</snm>
                  <fnm>M</fnm>
               </au>
               <etal/>
            </aug>
            <source>J Cell Sci</source>
            <pubdate>2006</pubdate>
            <volume>119</volume>
            <fpage>132</fpage>
            <lpage>140</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1242/jcs.02727</pubid>
                  <pubid idtype="pmpid" link="fulltext">16371653</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>Distinct promoters mediate the regulation of Ebf1 gene expression by interleukin-7 and Pax5.</p>
            </title>
            <aug>
               <au>
                  <snm>Roessler</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Gyory</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Imhof</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Spivakov</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Williams</snm>
                  <fnm>RR</fnm>
               </au>
               <au>
                  <snm>Busslinger</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Fisher</snm>
                  <fnm>AG</fnm>
               </au>
               <au>
                  <snm>Grosschedl</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Mol Cell Biol</source>
            <pubdate>2007</pubdate>
            <volume>27</volume>
            <fpage>579</fpage>
            <lpage>594</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1800812</pubid>
                  <pubid idtype="pmpid" link="fulltext">17101802</pubid>
                  <pubid idtype="doi">10.1128/MCB.01192-06</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>G9a histone methyltransferase plays a dominant role in euchromatic histone H3 lysine 9 methylation and is essential for early embryogenesis.</p>
            </title>
            <aug>
               <au>
                  <snm>Tachibana</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Sugimoto</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Nozaki</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Ueda</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Ohta</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Ohki</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Fukuda</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Takeda</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Niida</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Kato</snm>
                  <fnm>H</fnm>
               </au>
               <etal/>
            </aug>
            <source>Genes Dev</source>
            <pubdate>2002</pubdate>
            <volume>16</volume>
            <fpage>1779</fpage>
            <lpage>1791</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">186403</pubid>
                  <pubid idtype="pmpid" link="fulltext">12130538</pubid>
                  <pubid idtype="doi">10.1101/gad.989402</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Promoter methylation controls the expression of MAGE2, 3 and 4 genes in human cutaneous melanoma.</p>
            </title>
            <aug>
               <au>
                  <snm>Sigalotti</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Coral</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Nardi</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Spessotto</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Cortini</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Cattarossi</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Colizzi</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Altomonte</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Maio</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>J Immunother</source>
            <pubdate>2002</pubdate>
            <volume>25</volume>
            <fpage>16</fpage>
            <lpage>26</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1097/00002371-200201000-00002</pubid>
                  <pubid idtype="pmpid" link="fulltext">11924907</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>The replication timing of CFTR and adjacent genes.</p>
            </title>
            <aug>
               <au>
                  <snm>Englmann</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Clarke</snm>
                  <fnm>LA</fnm>
               </au>
               <au>
                  <snm>Christan</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Amaral</snm>
                  <fnm>MD</fnm>
               </au>
               <au>
                  <snm>Schindelhauer</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Zink</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Chromosome Res</source>
            <pubdate>2005</pubdate>
            <volume>13</volume>
            <fpage>183</fpage>
            <lpage>194</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s10577-005-0845-4</pubid>
                  <pubid idtype="pmpid" link="fulltext">15861307</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>The role of histone acetylation in regulating early gene expression patterns during early embryonic stem cell differentiation.</p>
            </title>
            <aug>
               <au>
                  <snm>McCool</snm>
                  <fnm>KW</fnm>
               </au>
               <au>
                  <snm>Xu</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Singer</snm>
                  <fnm>DB</fnm>
               </au>
               <au>
                  <snm>Murdoch</snm>
                  <fnm>FE</fnm>
               </au>
               <au>
                  <snm>Fritsch</snm>
                  <fnm>MK</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>2007</pubdate>
            <volume>282</volume>
            <fpage>6696</fpage>
            <lpage>6706</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1074/jbc.M609519200</pubid>
                  <pubid idtype="pmpid" link="fulltext">17204470</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>Unusual molecular characteristics of a repeat sequence island within a Giemsa-positive band on the mouse X chromosome.</p>
            </title>
            <aug>
               <au>
                  <snm>Nasir</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Fisher</snm>
                  <fnm>EM</fnm>
               </au>
               <au>
                  <snm>Brockdorff</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Disteche</snm>
                  <fnm>CM</fnm>
               </au>
               <au>
                  <snm>Lyon</snm>
                  <fnm>MF</fnm>
               </au>
               <au>
                  <snm>Brown</snm>
                  <fnm>SD</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>1990</pubdate>
            <volume>87</volume>
            <fpage>399</fpage>
            <lpage>403</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">53271</pubid>
                  <pubid idtype="pmpid" link="fulltext">2296595</pubid>
                  <pubid idtype="doi">10.1073/pnas.87.1.399</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>The role of RNA interference in heterochromatic silencing.</p>
            </title>
            <aug>
               <au>
                  <snm>Lippman</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Martienssen</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>2004</pubdate>
            <volume>431</volume>
            <fpage>364</fpage>
            <lpage>370</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nature02875</pubid>
                  <pubid idtype="pmpid" link="fulltext">15372044</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>Uncoupling global and fine-tuning replication timing determinants for mouse pericentric heterochromatin.</p>
            </title>
            <aug>
               <au>
                  <snm>Wu</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Singh</snm>
                  <fnm>PB</fnm>
               </au>
               <au>
                  <snm>Gilbert</snm>
                  <fnm>DM</fnm>
               </au>
            </aug>
            <source>J Cell Biol</source>
            <pubdate>2006</pubdate>
            <volume>174</volume>
            <fpage>185</fpage>
            <lpage>194</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1083/jcb.200601113</pubid>
                  <pubid idtype="pmpid" link="fulltext">16831888</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>Partitioning and plasticity of repressive histone methylation states in mammalian chromatin.</p>
            </title>
            <aug>
               <au>
                  <snm>Peters</snm>
                  <fnm>AH</fnm>
               </au>
               <au>
                  <snm>Kubicek</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Mechtler</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>O'Sullivan</snm>
                  <fnm>RJ</fnm>
               </au>
               <au>
                  <snm>Derijck</snm>
                  <fnm>AA</fnm>
               </au>
               <au>
                  <snm>Perez-Burgos</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Kohlmaier</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Opravil</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Tachibana</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Shinkai</snm>
                  <fnm>Y</fnm>
               </au>
               <etal/>
            </aug>
            <source>Mol Cell</source>
            <pubdate>2003</pubdate>
            <volume>12</volume>
            <fpage>1577</fpage>
            <lpage>1589</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S1097-2765(03)00477-5</pubid>
                  <pubid idtype="pmpid" link="fulltext">14690609</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>The profile of repeat-associated histone lysine methylation states in the mouse epigenome.</p>
            </title>
            <aug>
               <au>
                  <snm>Martens</snm>
                  <fnm>JH</fnm>
               </au>
               <au>
                  <snm>O'Sullivan</snm>
                  <fnm>RJ</fnm>
               </au>
               <au>
                  <snm>Braunschweig</snm>
                  <fnm>U</fnm>
               </au>
               <au>
                  <snm>Opravil</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Radolf</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Steinlein</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Jenuwein</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>EMBO J</source>
            <pubdate>2005</pubdate>
            <volume>24</volume>
            <fpage>800</fpage>
            <lpage>812</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">549616</pubid>
                  <pubid idtype="pmpid" link="fulltext">15678104</pubid>
                  <pubid idtype="doi">10.1038/sj.emboj.7600545</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>DNA methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development.</p>
            </title>
            <aug>
               <au>
                  <snm>Okano</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Bell</snm>
                  <fnm>DW</fnm>
               </au>
               <au>
                  <snm>Haber</snm>
                  <fnm>DA</fnm>
               </au>
               <au>
                  <snm>Li</snm>
                  <fnm>E</fnm>
               </au>
            </aug>
            <source>Cell</source>
            <pubdate>1999</pubdate>
            <volume>99</volume>
            <fpage>247</fpage>
            <lpage>257</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0092-8674(00)81656-6</pubid>
                  <pubid idtype="pmpid" link="fulltext">10555141</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>Centromeric chromatin exhibits a histone modification pattern that is distinct from both euchromatin and heterochromatin.</p>
            </title>
            <aug>
               <au>
                  <snm>Sullivan</snm>
                  <fnm>BA</fnm>
               </au>
               <au>
                  <snm>Karpen</snm>
                  <fnm>GH</fnm>
               </au>
            </aug>
            <source>Nat Struct Mol Biol</source>
            <pubdate>2004</pubdate>
            <volume>11</volume>
            <fpage>1076</fpage>
            <lpage>1083</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmc